Journal of Biomedical Research 13(1) : (2012) Morphological and Histological Changes in Photoaged Hairless Mice Induced by Phellodendrin cortex
|
|
|
- 예슬 문
- 5 years ago
- Views:
Transcription
1 Journal of Biomedical Research 13(1) : (2012) Morphological and Histological Changes in Photoaged Hairless Mice Induced by Phellodendrin cortex Water Extract Application In-Soon Bae 1, Mi-Ja Shim 2, Mi-Soon Park 3, Young-Chul Kim 1 * 1 Department of Public Health, Graduate School, Keimyung University, Daegu , Korea 2 Department of Broadcasting & Entertainment Coordination, Gyeongbuk Provincial College, Yecheon Gun , Korea 3 Department of Health Care, Graduate School, Hanseo University, Chungnam , Korea (Received Jan 10, 2012 / Revised Feb 18, 2012 / Accepted Mar 8, 2012) ABSTRACT: This study was intended to evaluate the alleviating effects of Phellodendrin cortex water extract (PCWE) on skin aging in hairless mice via observing morphogical and histological changes. Skin aging was induced by UVB irradiation and squalene monohydroperoxide (Sq-OOH) application to the back skin of hairless mice for 6 weeks. And at the same time, saline (C), jojoba oil (VC), PCWE (E) and 0.01% retinoic acid diluted with polyethylene glycol (PC) were applied topically twice a day, 6 days a week for 6 weeks. Retinoic acid and PCWE application groups improved wrinkle formation in a pattern of shallow furrows and thin and narrow crests compared to the C group. As based on the morphologic analysis for skin wrinkles, E group showed lower levels in skin roughness, maximum roughness, average roughness, smoothness depth and arithmetic average roughness by 13.1, 17.2, 18.4, 15.4 and 16.1%, respectively than the C group, indicating that PCWE inhibited potential formation of wrinkles in the skin. The structure of lipid lamellae and collagen fibers were broken or deformed with an irregular arrangement in the C group. The retinoic acid and PCWE applications protect against the deformity of lipid lamellae and collagen fibers. Elastic fibers in dermis of the C group were also transformed severely but applications of retoinoic acid and PCWE significantly decreased the number of denatured elastic fibers. Therefore, PCWE could have a alleviating effects on the skin aging induced by UVB irradiation and Sq-OOH application. Key words: Phellodendrin cortex water extract, Skin aging, Collagen fiber, Elastic fiber *Corresponding author: Young-Chul Kim Department of Public Health, Graduate School, Keimyung University, 1000 Shindang-dong, Dalseo-gu, Daegu , Korea Tel: Fax: yckim@kmu.ac.kr
2 36 In-Soon Bae et al. 서론과량의자외선에지속적으로노출된피부에서는기질금속단백분해효소 (matrix metalloproteinases, MMPs) 의과다한발현증가로세포와세포외기질의변형이관찰되며피부진피조직의교원섬유 (collagen) 와탄력섬유 (elastin) 의양과탄성이감소하고피부세포내수분이감소되어 [1] 피부가건조해지고거칠며탄력성이저하되어주름형성이깊어진다 [2]. MMPs는세포외기질의많은성분을분해할수있는 endopeptidase로서염증세포에서만만들어지고자외선에의한광노화피부에서는피부표면조직의파괴로표피가두꺼워지고진피에피부염증을유발, 비만세포의탈과립, 홍반을수반하게된다 [3]. Squalene monohydroperoxide (Sq-OOH) 는과산화된 squalene의초기생성물로자외선에노출됨으로써피부에서생성된다 [4]. Hairless 마우스실험에서 Sq-OOH는활성산소종을생성시키고다른 monohydroperoxides나자극제들보다더피부거침, 각화층의수분손실, 주름형성을야기시키는것으로보고되었다 [5]. Hairless 마우스는 UVB 조사시표피세포의과증식으로인해피부두께가두꺼워지고, 탄력섬유의변형등표피와진피의변화양상이사람에게일어나는광노화와유사한변화가나타나기때문에노화연구모델로가장널리사용되고있는실험동물이다 [6]. Retinoid는세포분화를촉진하고생체에필요한각종단백질의생합성등의기능으로주름개선에효과가있는것으로보고되고있다 [7]. Retinol은생체내에서레티노인산 (retinoic acid) 으로변환되고, retinoic acid는비타민 A 유도체로서세포내활성산소를제거하여세포의증식을억제하는작용을한다 [8]. Retinoic acid는 transforming growth factorbeta (TGF-β) 를유도하고 TGF-β는진피층에있는 Type-1, 3의 procollagen 유전자의생성을유도하여교원섬유의합성을증가시키며 [7] 피지선억제, 면역조절및항염증작용등이있어여드름, 건선등의피부질환이나피부암, T세포림프종등의악성종양 의치료에도이용된다. 또한, 자외선조사로생성된교원섬유분해효소인 MMP-1의생성을억제할수있기때문에광노화의치료제로서사용되기도하며 retinol은얼굴등피부의주름을예방또는개선하고자하는목적으로기능성화장품원료로서국내에서도널리상용되고있다. 그러나 retinoid를국소도포제로사용하는많은환자들은레티노이드피부염 (retinoid dematitis) 이라고불리는일종의자극성접촉피부염을경험하게되는데증상은홍반, 건조, 작열감, 소양감등을나타내며환자들중다수가이러한부작용으로치료를중단하게된다 [9]. 최근웰빙열풍과자연주의확산으로천연소재를이용한기능성화장품개발이지속적으로증가하고, 천연물소재개발이전세계적으로매우활발히진행되고있다. 황백 ( 黃柏, Phellodendri cortex) 은운향과 (rutaceae) 식물에속하는황벽나무 (Phellodendron amurense Ruprecht) 의주피를벗겨내고말린줄기껍질이다. 황백의성분중 berberine은항산화작용 [10], 및항염작용 [11] 이있는것으로알려져있으나현재까지황백열수추출물의피부노화억제효과에관한실험문헌을찾아보기힘들어그유효성을판단하기는힘든실정이다. 이에본연구는 hairless 마우스에반복적으로 UVB 조사와 Sq-OOH를도포하여피부노화를유발시키면서황백열수추출물을도포하여피부노화억제에미치는효과를확인하였다. 재료및방법시약및기기 Hydrogen peroxide는 Junsei사 (Japan) 의제품, hematoxylin, bovine serum albumin, retinoic acid, polyethylene glycol은 Sigma사 (USA) 의제품, squalene은 Acros사 (USA) 의제품, 호호바오일 (jojoba oil) 은 Desert Whale사 (USA) 의제품을사용하였으며그외일반시약들은특급품을사용하였
3 Morphological and Histological Changes in Hairless Mice by Phellodendrin cortex Water Extract 37 다. 실험기기중자외선조사장치는 UVB sunlamp (UVM-225D, Mineral Lamp UVP, USA) 를, 자외선측정장치는 UV-radiometer (HD9021, Delta OHM, Italy) 를사용하였다. 피부유분및수분함량측정은각각 Sebumeter (SM815, CK electronic GmbH, Germany) 와 Corneometer (CM825, CK ele-ctronic GmbH, Germany) 를사용하였다. 시료추출은초고속감압저온추출기 (COSMOS-660, 경서기계산업, 한국 ) 를사용하였다. 조직표본관찰은 Olympus BX51 light microscope (Olympus, Japan) 와 Progres C14 plus digital camera system (Olympus, Japan) 을사용하였다. 시료조제경북영주시에서유기농재배한황백 600 g을구입하여물 6 l를가하여초고속감압저온추출기로열수추출한후 5 l의양을얻었다. 5 l를진공농축용기에담아 2 l로농축하였고파우치진공포장후냉장보관하여실험에사용하였다. 동결건조로측정한황백열수추출물의수율 (yield rate) 은 15.27% 였다. 황백추출물 10 ml + jojoba oil 1 ml + 100% 에탄올 2.5 ml + 물 6.5 ml 비율로혼합하여황백추출물시료로사용하였다. 실험동물및처치실험동물은 7주령의 SKH-1 hairless mouse (Charles-River, Japan) 를분양받아 1주일간사육실에서적응시킨후실험전기간동안사료와물은자유롭게공급하였다. 사육실은온도 22 ± 1 C, 상대습도 50 ± 5%, 조명주기 12시간씩밤낮을유지하였다. 실험동물은실험 6주째되는날 4시간전부터절식시킨다음에테르로마취한후피부를적출한후일부는 10% 중성포르말린용액에고정하여조직학적검사에사용하였고나머지는냉동보관후 MMP 발현측정에사용하였다. 실험군은정상군 (Normal, N) : 아무런처치를하지않은군, 대조 군 (Control, C) : 자외선조사 + Squalene-OOH 도포 + Saline 도포군, 용매대조군 (Vehicle Control, VC) : 자외선조사 + Squalene-OOH 도포 + 용매 (100% 에탄올 + Jojoba oil + 물 ) 도포군, 양성대조군 (Positive Control, PC) : 자외선조사 + Squalene- OOH 도포 + Retinoic acid 도포군, 실험군 (Experimental, E) : 자외선조사 + Squalene-OOH 도포 + 황백열수추출물도포군, 총 5개군으로분류하여군별로 5마리씩총 25마리를실험에사용하였다. 피부노화유발및시료도포자외선조사장치의광원은 302 nm의 UVB를방출하는 sunlamp를사용하였다. 마우스를자외선조사용 cage에가둔후등부위에격일간격으로 1주일에 3회, 6주동안조사하였으며, 자외선조사량은 UV-radiometer로측정하였다. 1주에는 100 mj/ cm 2, 2-3주는 200 mj/cm 2, 4-6주는 300 mj/cm 2 의광량을조사하였다. 피부염증을유발하기위하여 Sq- OOH를 1일 2회, 주 6일, 매회 100 μl씩 6주간도포하였다. 황백열수추출물 (0.366 g/kg BW/day), 용매, saline은 1일 2회, 주 6일, 6주동안매회 200 μl 씩도포하였다. Retinoic acid는 polyethylene glycol에 0.01% 로희석하여 1일 2회, 주 6일, 6주동안매회 200 μl씩도포하였다. 피부유분함량, 수분함량측정유분함량은 Sebumeter (SM815), 수분함량은 Corneometer (CM825) 를사용하여비침습적방법으로실험기간동안주 1회측정하였다. 피부조직의형태 조직학적관찰 1) 육안적관찰피부의육안적관찰은 6주째에테르로가볍게마취를하고디지털카메라로사진촬영을한후 replica를떠서 SV600 software program (C+ K, Germany) 을사용하여주름지표를분석하고주름의양상을알아보았다.
4 38 In-Soon Bae et al. 2) Masson s trichrome 염색관찰절취한피부조직을실온에서 10% 중성포르말린용액에 24시간고정한후통상적인방법으로수세, 탈수, 투명, 침투과정을거친다음파라핀으로포매하고 4 μm 두께로절편을만들어실온에서 bouin 용액에하룻밤담그고 Masson s trichrome 염색후진피층내교원섬유 (collagen fiber) 의양과 형태를광학현미경으로관찰하였다. 3) Verhoeff s 염색관찰절취한피부조직을실온에서 10% 중성포르말린용액에 24시간고정한후통상적인방법으로수세, 탈수, 투명, 침투과정을거친다음파라핀으로포매하고 4 μm 두께로절편을만들어 Verhoeff 용 Table 1. Nucleotide sequence of the primers and expected size of PCR products Items Primers Expected size (bp) 3) GAPDH 1) MMP-3 2) Forward (5' 3') Reverse (5' 3') Forward (5' 3') Reverse (5' 3') 1) GAPDH : Glyceraldehyde-3-phosphate dehydrogenase. 2) MMP-3 : Matrix metalloproteinase-3. 3) bp : basepair. CCCACTAACATCAAATGGGG ACACATTGGGGGTAGGAACA TAGCAGGTTATCCTAAAAGCA CCAGCTATTGCTCTTCAAT Table 2. Changes in lipid capacity of SKH-1 hairless mice skin in 6-week experiment to evaluate the inhibition effect of Phellodendri cortex water extract on skin aging Weeks Normal Control Experimental N C VC PC E ± 1.14 ab 2.50 ± 0.58 a 5.50 ± 1.30 abc 8.00 ± 1.58 c 5.80 ± 4.03 bc ± 1.58 a 1.20 ± 0.84 a 1.20 ± 1.10 a 1.60 ± 0.55 a 1.60 ± 1.82 a ± 1.14 a 0.75 ± 0.96 a 0.80 ± 0.84 a 2.60 ± 2.51 a 0.80 ± 0.45 a ± 1.58 a 1.00 ± 0.82 a 1.40 ± 0.89 a 2.40 ± 2.51 a 1.60 ± 1.34 a ± 1.95 b 1.00 ± 0.71 a 1.20 ± 1.10 a 1.80 ± 1.10 ab 2.00 ± 1.58 ab ± 1.23 b 1.00 ± 0.71 a 1.00 ± 1.16 a 1.25 ± 0.50 ab 3.00 ± 2.00 b Values are mean ± SD of 5 mice. Unit: μg/cm 2 N: No treatment group C: UVB irradiation + Squalene-OOH + Saline application group VC: UVB irradiation + Squalene-OOH + Jojoba oil + 100% ethanol + Water application group PC: UVB irradiation + Squalene-OOH + Retinoic acid application group E: UVB irradiation + Squalene-OOH + Phellodendri cortex extracts application group Values with different superscripts in the same row are significantly different (P<0.05) by ANOVA and Duncan's multiple range tests.
5 Morphological and Histological Changes in Hairless Mice by Phellodendrin cortex Water Extract 39 액에염색후수세, ferric chloride 2% 로감별수세후 sodium thiosulfate에처리하여피부진피층내의탄력섬유 (elastic fiber) 의변화, 소실및퇴행성변화등을광학현미경으로관찰하였다. 피부조직의 Matrix metalloproteinase-3 1) RNA 추출 Deep freezer에냉동보관하였던피부조직을액화질소에담아이송한후얼음으로저온을유지시키며조직 50 mg당 1 ml의 Trizol (Invitrogen, New Zealand) 을첨가하여조직을마쇄하고실온에서 5 분간 incubation 시킨후 chloroform 200 μl를첨가하여실온에서 3분간방치후 rpm, 4 C, 10 분간원심분리하였다. 상층액을취한후 isopropyl alcohol을 500 μl 첨가한다음 rpm, 4 C, 15 분간원심분리후상층액은제거하고 70% ethanol 1 ml을첨가하여 RNA pellet을 washing하고 rpm, 4 C, 2분간원심분리하여나온상층액은제거하고남은 RNA pellet을실온에서건조후 diethylpyrocarbonate (DEPC) 로희석하여 260 nm 에서 optical density (OD) 값을측정하여 RNA를정량하였다. 280 nm에서 OD값을측정하고 absorbance ratio (A260/A280) 가 1.8~2.0 사이인지확인하였다. 2) cdna 합성 BioNEER사의 CycleScript RT PreMix (dt20) kit에서제공하는 protocol에따라 total RNA 양이 0.1~1 μg/μl가되도록 RNA sample을넣고 DEPC 를 20 μl까지채운후 30 C에서 1분간, 50 C에서 4 분간 12 cycle 반응시키고 95 C에서 5분간가열하여반응을종결시켰다. 3) PCR과전기영동 BioNEER사의 AccuPower TM PCR PreMix kit 를구입하여사용하였다. Template 2 μl, forward primer와 reverse primer (10 pmole/l, Bio- NEER, Korea) 를각각 1.4 μl, 멸균된증류수 15.2 μl를섞 고 PCR 반응 (Bio-RAD, Mycycler TM thermal cycler, USA) 을실시하였다. Primer는대조군으로 GAPDH (57 C, 35 cycle), 실험군으로 MMP-3 (60 C, 35 cycle) 을사용하였으며사용된 primer들의염기서열은 Table 1과같다. Tris-acetate ethylenediaminetetra acetic acid (TAE) buffer를이용하여 1.5% agarose gel에전기영동시켜 ethidium bromide에염색한후수세하고 UV를조사하여 DNA band를확인하였고 Gel Logic 100 Imaging System (Kodak, USA) 을이용하여발현량을수치화하여통계처리하였다. 자료분석통계적분석은 SPSS 12.0 for windows (SPSS Inc., USA) 를이용하여일원배치분산분석 (oneway ANOVA) 을이용하였고각그룹간의차이를검증하기위하여 Duncan s 다중비교분석을이용하여사후분석을실시하였다. 통계적유의성검정은 α=0.05 이하에서실시하였다. 결과및고찰피부의유분및수분함량피부유분및수분함량의변동을측정한결과는각각 Table 2와 3과같다. 실험 6주후에대조군, 용매대조군은정상군에비해유의하게낮았으며대조군에비교할때양성대조군은약 25% 높았고황백열수추출물도포군은약 200% 유의하게높았으며 (P<0.05) 정상군과비슷한수치를나타내었다. 피부수분함량의변동을측정한결과는 Table 3과같다. 실험 6주후에대조군, 용매대조군은정상군에비해유의하게낮았으며 (P<0.05) 양성대조군, 황백열수추출물도포군은각각약 18%, 22.5% 수분함량이낮았다. 양성대조군과황백열수추출물도포군은대조군에비해각각 59%, 50.3% 유의하게높았다 (P<0.05). 이와같이황백열수추출물도포
6 40 In-Soon Bae et al. 군은대조군에비해피부유분함량과수분함량에있어유의하게높게나타나표피층내피부장벽의손상이경감되었음을확인하였다. 피부는외부환경과직접적으로접하고있는광범위한기관으로서수분과전해질의손실을막고, 세균의침입을막아주며물리화학적손상으로부터인체를보호하는보호장벽의기능이있다 [12]. 자외선에노출된피부표면에서지질과산화물의함유량이높으며광노화피부에서만성적으로태양에노출된부위에지질과산화생성이증가된다. 각질층지질은피부장벽대의역할인각질층내수분유지와함께외부수분의유입을막는기능을담당하며상피세포증식조절, 세포간응집과표피탈락에도관여한다 [13]. 피부장벽을손상시키는외부의물리화학적자극이피부에가해지면표피를통한수분의손실이발생하는데, 이때에칼슘이온등의표피내농도를변화시키고, 이는피부장벽을회 복시키는항상성반응을시작하는신호로작용하여, 각질세포간지질의전구체를함유한층판소체 (lamellar body) 를분비시키고, 새로운층판소체를생성하여손상된각질세포간지질을보충하여다시튼튼한각질세포간지질막을재형성하게된다 [14]. 이때표피의각질형성세포에서는 cytokine을분비하여각질형성세포의증식을직접자극하거나자극을받은진피내의염증세포에서분비된 cytokine에의하여각질형성세포의 DNA합성을증가시키고증식을간접적으로자극시켜서표피의증식을초래한다 [15]. 피부조직의형태 조직학적변화 1) 육안적및주름지표비교피부주름의형태를비교한결과는 Fig. 1과같다. 정상군과비교할때대조군은주름능선의두께 Table 3. Changes in water capacity of SKH-1 hairless mice skin in 6-week experiment to evaluate the inhibition effect of Phellodendri cortex water extract on skin aging Weeks Normal Control Experimental N C VC PC E ± 5.45 b ± 5.18 a ± 4.32 a ± 8.18 a ± 3.86 a ± 6.40 b ± 8.58 a ± 4.42 ab ± 8.90 b ± b ± 4.99 b ± 8.02 a ± 6.71 a ± 8.42 a ± 3.13 a ± 8.25 b ± 6.86 a ± 5.54 a ± 4.47 a ± 6.89 a ± 4.64 c ± 6.18 a ± 3.76 b ± 4.04 b ± 2.94 b ± c ± 6.76 a ± 6.38 ab ± 6.61 bc ± 4.07 bc Values are mean ± SD of 5 mice. Unit: AU(Arbitrary Unit) N: No treatment group C: UVB irradiation + Squalene-OOH + Saline application group VC: UVB irradiation + Squalene-OOH + Jojoba oil + 100% ethanol + Water application group PC: UVB irradiation + Squalene-OOH + Retinoic acid application group E: UVB irradiation + Squalene-OOH + Phellodendri cortex extracts application group Values with different superscripts in the same row are significantly different (P<0.05) by ANOVA and Duncan's multiple range tests.
7 Morphological and Histological Changes in Hairless Mice by Phellodendrin cortex Water Extract 41 가굵고간격이넓으며주름이깊게형성된반면, 양성대조군과황백열수추출물도포군은상대적으로주름능선의두께가얇고간격이좁으며주름이얕게형성되어있어정상군에가까운양상을보였다. 피부주형을이용하여군별주름양상을나타내는객관적지표 (R1-R5) 들의분석치를통계처리한 결과는 Table 4와같다. 피부주름형태분석에서실험군이대조군에비해 R1 (Skin Roughness), R2 (Maximum Roughness), R3 (Average Rough ness), R4 (Smoothness Depth), R5 (Arithmetic Average Roughness) 가각각 13.1, 17.2, 18.4, 15.4, 16.1% 낮게나타나황백열수추출물이피부노화의대표적인징후인주름형성억제효과가있음을확인하 Fig. 1. Anti-wrinkle effect of 6-week Phellodendri cortex water extract application in photoaged SKH-1 hairless mice skin.
8 42 In-Soon Bae et al. 였다. 인간의피부에서노화와관련하여관찰되는변화중상피세포의형태학적변화와더불어각질층에서의습윤감소로인한거칠어짐과주름등이두드러진다 [16]. 피부는자외선에노출되면표피의각질형성세포와진피의섬유아세포의표면에있는성장인자나 cytokine 수용체를활성화시켜 nuclear transcription factor인 AP-1을활성화시키고, 이는 matrix metalloproteinases (MMPs) 유전자전사를촉진시킨다. AP-1은또한섬유아세포에작용하여 procollagen 유전자의발현을억제한다 [17]. MMP 는진피의교원섬유와그외세포외기질단백질을분해시키는작용을하며손상된진피의불완전한수복은세포외기질을기능적구조적으로취약하게하여반복적인자외선노출은진피의손상을심화시키고결국광노화의특징인주름을생성시킨다 [18]. 2) Masson s Trichrome 염색관찰진피층내교원섬유의양과형태를관찰한결과는 Fig. 2와같다. 정상군은교원섬유의밀도가조 밀하고배열이규칙적인반면, 대조군은교원섬유가파괴되어밀도가엉성하고배열이불규칙적이고양도많이줄어있었다. 양성대조군과황백열수추출물도포군은대조군에비해교원섬유의밀도가조밀하고배열이규칙적으로나타남을확인하였다. 3) Verhoeff s 염색관찰진피층내탄력섬유의양과형태를관찰한결과는 Fig. 3과같다. 정상군은탄력섬유의배열이규칙적인반면, 대조군은진피가두꺼워지고변성되고엉긴탄력섬유가증가하였다. 양성대조군과황백열수추출물도포군은대조군에비해변성된탄력섬유가많이줄어들어있음을확인하였다. 피부의진피조직속에는교원섬유와탄력섬유가그물망구조를형성하고있는데, 이러한탄력섬유는 elastase에의해분해되어그물망구조가깨어지면서피부가처지고주름이생겨내인성피부노화가발생한다. 선행연구에서 UV 조사에의한 hairless 마우스의진피층에서교원섬유의감소와함께변형된탄력섬유가다소증가하는탄력섬유증 (elastosis) 이관찰되었으며 [19], elastosis는 UV 조 Table 4. Comparison in wrinkle parameters of SKH-1 hairless mice skin induced by 6-week Phellodendri cortex water extract application Items Normal Control Experimental N C VC PC E R ± 0.13 a 1.75 ± 0.18 a 1.62 ± 0.67 a 1.52 ± 0.22 a 1.52 ± 0.28 a R ± 0.16 a 1.63 ± 0.18 a 1.49 ± 0.63 a 1.40 ± 0.21 a 1.35 ± 0.34 a R ± 0.15 a 1.14 ± 0.13 a 1.07 ± 0.46 a 1.00 ± 0.16 a 0.93 ± 0.24 a R ± 0.03 a 0.26 ± 0.03 a 0.24 ± 0.15 a 0.23 ± 0.04 a 0.22 ± 0.04 a R ± 0.05 a 0.56 ± 0.06 a 0.54 ± 0.23 a 0.55 ± 0.09 a 0.47 ± 0.13 a Values are mean ± SD of 5 mice. R1: Skin Roughness R2: Maximum Roughness R3: Average Roughness R4: Smoothness Depth R5: Arithmetic Average Roughness
9 Morphological and Histological Changes in Hairless Mice by Phellodendrin cortex Water Extract 43 사에 의한 전형적인 병변으로 보고된바 있다[20]. 매대조군, 양성대조군, 황백 열수추출물 도포군은 피부조직의 MMP-3 발현 비교 출물이 자외선에 의한 MMP의 발현을 억제시키는 피부조직의 MMP-3 mrna 발현량을 측정한 결 과는 Fig. 4와 같다. 정상군에 비해 대조군은 유의 하게 높았고(P<0.05), 용매대조군은 유의성은 없 었지만 약 68.1% 높게 나타났다. 대조군에 비해 용 유의하게 낮았다(P<0.05). 이를 통해 황백 열수추 효과가 있음을 확인하였으며 이와 같은 결과는 대 조군과 용매대조군에 비해 양성대조군과 황백 열수 추출물 도포군이 교원섬유의 밀도가 조밀하고 배열 이 규칙적이며 탄력섬유의 변성도 적게 나타난 조 Fig. 2. Histological observation on collagen fibers in photoaged SKH-1 hairless mice skin after 6-week application of Phellodendri cortex water extract. Masson s Trichrome stain, 200.
10 44 In-Soon Bae et al. Fig. 3. Histological observation on elastic fibers in photoaged SKH-1 hairless mice skin after 6-week application of Phellodendri cortex water extract. Verhoff s stain, 200 & c 직학적 소견을 뒷받침해 준다. UVB 조사로 유도된 MMPs는 피부의 교원섬유 를 감소시킨다. 그 중 MMP-3는 각질형성세포, 섬 유아세포에서 발현되며[21], gelatin, proteoglycan, laminin, fibronectin, type III과 IV collagen을 포함 한 다양한 세포외 기질단백질의 분해를 담당한다 [22]. MMP-3/GAPDH(%) 100 b ab a ab N C VC PC E Groups Fig. 4. Comparison of MMP-3 mrna expression in photoaged SKH-1 hairless mice skin induced by 6-week Phellodendri cortex water extract application.
11 Morphological and Histological Changes in Hairless Mice by Phellodendrin cortex Water Extract 45 참고문헌 1. So SH, Lee SK, Hwang EI, Koo BS, Han GH, Kim NM. Effects of Korean red ginseng and herb extracts mixture (KTNG0345) on procollagen biosynthesis and matrix metalloproteinase-1 activity in human dermal fibroblast. J Ginseng Res 2007;31: Karin SK, Peter B, Jutta W, Gernot H, Weijan M, Lale K, Christian M, Meinhard W. Photoaging of the skin from phenotype to mechanisms. Exper Gerontol 2000;35: Chiba K, Kawakami K, Sone T, Onoue M. Characteristics of skin wrinkling and dermal changes induced by repeated application of squalene monohydroperoxide to hairless mouse skin. Skin Pharm Appl Skin Physiol 2003;16: Kohno Y, Takahashi M. Peroxidation in human skin and its prevention. J Jpn Oil Chem Soc 1995;44(4): Chiba K, Sone T, Kawakami K, Onoue M. Skin roughness and wrinkle formation induced by repeated application of squalenemonohydroperoxide to the hairless mouse. Exp Dermatol 1999;8: Kligman LH. The hairless mouse model for photoaging. Clin Dermatol 1996;14: Gary JF, Kang SW, Varani J, Zsuzsanna BC, Wan Y, Datta S, Voorhees JJ. Mechanisms of photoaging and chronological skin aging. Arch Dermatol 2002;138: Weiss JS, Ellis CN, Headington JT, Voorhees JJ. Topical tretinoin in the treatment of aging skin. J Am Acad Dermatol 1988;19: Fisher GJ, Esmann J, Griffiths CEM, Talwar HS, Duell EA, Hammerberg C, Elder JT, Karabin GD, Nickoloff BJ, Cooper KD, Voorhees JJ. Cellular, immunologic and biochemical characterization of topical retinoic acid-treated human skin. J Invest Dermatol 1991;96: Lee MJ, Park JW, Kim DS, Kim JK, Choi DY, Kim CH. Antioxidant and Nitrite Scavenging Activity of Water - Extract from Phellodendron amurense Rupr. Kor J Ori Med Pathol 1999;13(1): Choi KH, Kim YK, Kang SK, Jung SY, Jung JH, Seo HS, Yoo JG. The study on the antiinflammatory effects of Phellodendri cortex, indigo naturalis, alumen, and Chinensis galla, most frequently used for the external theraphy of Gu-Chang. J Kor Orient Med Ophthal Otolaryngol Dermatol 2005;18: Elias PM, Choi EH. Interactions among stratum corneum defensive functions. Exp Dermatol 2005;14: Blanken R, Van Vilsteren MJT, Tupker RA, Conraads PJ. Effect of mineral oil and linoleicacid-containing emulsions on the skin vapour loss of sodium-lauryl-sulphate-induced irritant skin reactions. Contact Dermatitis 1989;20: Schurer NY, Plewig G, Elias PM. Stratum corneum lipid function. J Dermatol 1991;183: Candi E, Melino G, Mei G, Tarcsa E, Chung SI, Marekov LN. Biochemical, structural, and transglutaminase substrate properties of human loricrin, the major epidermal cornified cell envelope protein. J Biol Chem 1995;270: Freeberg IM, Eisen AZ, Wolff K, Austen KF, Goldsmith LA, Katz SI. Aging of skin. In: Gilchrest BA, Blog FB, Szabo G (eds.). Fitzpatrick s Dermatology in General Medicine. 5th ed. New York: Mcgraw Hill; p Fisher GJ, Kang S, Varani J, Bata-Csorgo Z, Wan Y, Datta S, Voorhees JJ. Mechanisms of photoaging and chronological skin aging. Arch Dermatol 2002;138: Yang ES, Hong RH, Kang SM. The effect of genistein on the proliferation and type I pn collagen synthesis in aged normal human fibroblasts. J Kor Soc Microbiol Biotechnol 2007;35: Lee JH, Lee BS, Yang MS, Byun BS, Kim WG, Kim BH, Lee SJ. Prevention of photoaging and
12 46 In-Soon Bae et al. wrinkle formation in hairless mice dorsal skin by APB-03. J Kor Soc Food Sci Technol 2005;37(6): Sternlicht M, Lochter A, Sympson CJ. The stromal proteinase MMP3/storelysin-1 promotes mammary carcinogenesis. Cell 1999;98: MacNaul KL, Chartrain N, Lark M, Tocci MJ, Hutchinson NI. Discoordinate expression of stromelysin, collagenase, and tissue inhibitor of metalloproteinases-1 in rheumatoid human synovial fibroblast. Synergistic effects of interleukin-1 and tumor necrosis factoralpha on stromelysin expression. J Biol Chem 1990;265:
DBPIA-NURIMEDIA
백작약 열수추출물의 피부노화 억제 효과 (II) -주름형성 억제 효과를 중심으로- 권미화, 최소영 1, 김영철 1, J. ENVIRON. TOXICOL. Vol. 24, No. 2, 169~178 (2009) 국립독성과학원 독성병리과, 1 계명대학교 대학원 공중보건학과 Inhibitory Effects of Peonia japonica Water Extract
DBPIA-NURIMEDIA
J. ENVIRON. TOXICOL. Vol. 24, No. 4, 351~357 (2009) Hairless 마우스에서대추열수추출물의피부내염증및장벽손상완화효과 최소영, 김영철 계명대학교대학원공중보건학과 Alleviative Effects of Jujube Water Extract on the Inflammation and Barrier Damage in Hairless
α α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
Journal of Life Science 2011, Vol. 21. No μ μ
Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,
- 1 -
- 1 - - 2 - - 3 - - 4 - - 5 - SUMMARY ( 영문요약문 ) - 6 - - 7 - - 8 - - 9 - cavenging - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 -
Lumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
(01) hwp
Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of
386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
207.fm
Lab. Anim. Res. 2010: 26(2), 173-180 Aspectual Comparison of the Skin Changes in Hairless Mice According to the Aging Type Kyoung-Hwa Choi, Young-Chul Kim* and Bae-Hwan Kim* Department of Public Health,
27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
untitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
γ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
Jksvs019(8-15).hwp
Grade I Grade II Grade III 12 대한혈관외과학회지 : 제 20 권 제 1 호 2004 Control Group A Group B Fig. 4. Microscopic findings of vein wall in control, group A and group B on the day of 7 after venous occlusion. The
09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
Abstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
12.077~081(A12_이종국).fm
J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 77-81 y w» e wx Á w œw Fabrication of Ceramic Batch Composition for Porcelain by Using Recycled Waste Ceramic Powder Hyun Guen Han, and
01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
124 Ⅰ. 서론 생체에서적정량의활성산소는체내에침입해 온이물질을제거하는중요한역할을담당하나과 량의활성산소는인체의세포를공격하여여러가 지질병을유발시킨다. 1) 피부는활성산소를제거 하는 SOD,CAT,glutathioneperoxidase(GPx), glutathionered
대한피부미용학회지제 7 권제 2 호 123 Hairless 마우스에서치자열수추출물의피부주름형성억제효과 형순희 민경진 김영철 계명대학교대학원공중보건학과 Ⅰ. 서론 Ⅱ. 재료및방법 1. 시약및기기 2. 시료조제 3. 실험동물및처치 4. 피부주름유발및시료도포 5. 피부표면의형태학적관찰 < 목차 > 6. 피부의조직학적관찰 7. 피부조직의유해산소대사효소활성측정 8.
54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3
27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,
03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
Sheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120:
Sheu HM, et al., British J Dermatol 1997; 136:884-890 Kao JS, et al., J Invest Dermatol 03; 1:446-464 1 10 0 3 Day Normal MLE Lotion Lotion MLE Cream Cream 80 7 70 6 3 Day Normal MLE Lotion Lotion MLE
( )Kjhps043.hwp
Difference of Fistula Maturation Degree and Physical Property by the Types of Tube Material: An Experimental Study Sang Koo Kang, M.D. 1, Hee Chul Yu, M.D. 1,4, Woo Sung Moon, M.D. 2,4, Ju Hyoung Lee,
- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
현대패션의 로맨틱 이미지에 관한 연구
한지닥섬유제품의인체생리반응및쾌적성평가 임순 Evaluation of Thermal Physiological Responses and Comfort in Dox Fabric Soon Im Professor, Dept. of Fashion Industry, Incheon National University This study performed the evaluation
Jkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
Statistical Data of Dementia.
Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.
μ μ μ μ μ μ μ μ μ α μ μ β μ α μ α γ μ α β α α γ γ μ μ μ αα αα α α β μ α Diabetic Patients ( 천만 ) 35 30 25 20 15 10 5 0 1985 2003 2010 2025 Year Anual number of Diabetic Patients α β α α
( )Jkstro011.hwp
비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy
- 1 -
- 1 - - 2 - - 3 - - 4 - - 5 - - 6 - ι κ λ β β β β β - 7 - - 8 - - 9 - - 1 - - 11 - 마. - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 2 - - 21 - - 22 - - 23 - - 24 - ι κ λ β β - 25 - - 26 - -
14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
Apparel Purchase Behaviors and Image Preferences of Preteen Girls and Their Mothers: Considering Preteen Girls BMI and Body Image Department of Home Economics Education, Pai Chai University Assistant Professor
03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education
DBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상
6차 산업 수익모델 시범사업 농산물가공품개발 연구용역 최 종 보 고 서 영남대학교 식품공학과 연구책임자 : 한 기 동 제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김
석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( )
:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α=.83.91.,.,,..,,,.,. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ..,.,.,. Bandura(1997),.,,,,., (,,, 2009), (,,,, 2014).?.,,,.. Bandura (1995) (Resiliency
<30392E20C0CCBFEBC0BA2DBBEABBEF20BEE0C4A7C0C720C7C7BACE20C1D6B8A720B0B3BCB120C8BFB0FABFA120B4EBC7D120BFACB1B82E687770>
Original Article 대한침구의학회지 제32권 제2호 (2015년 6월) : 97-103 The Acupuncture Vol. 32 No. 2 June 2015 : 97-103 pissn 1229-1137 eissn 2287-7797 http://dx.doi.org/10.13045/acupunct.2015023 산삼 약침의 피부 주름 개선 효과에 대한
Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
¼º¿øÁø Ãâ·Â-1
Bandwidth Efficiency Analysis for Cooperative Transmission Methods of Downlink Signals using Distributed Antennas In this paper, the performance of cooperative transmission methods for downlink transmission
- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
A Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
Can032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
10(3)-10.fm
w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction
878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
개최요강
55 2009. 5. ( ) ( ) < > 1. 1 2. 2. 2. 3 1) 3 2) 3 3) GC-MS 4. 5 1) 5 2) 5 3) ICP-OES 6 3. 7. 7 1) 7 2) 10. 13 1) 1g 13 2),,, 14 3), 15 4),, 15 4. 17 19 < > [ 1] 2 [ 2] ICP-OES 6 [ 3] 13 [ 4] 1g 13 [ 5]
서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
Kor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on
Jkbcs032.hwp
Clinical Correlation of HER-2/neu Overexpression in Patients with Breast Cancer Sung Yong Kim, Tae Yoon Kim, Jae Jun Kim, Chang Ho Kim, Ok Pyung Song, Min Hyuk Lee, Eui Han Kim 1, and Moo Sik Cho Departments
A Study on the Relationships between Self-Differentiation and Adaptability Factors for Senior Dementia Patients Care Givers Department of Social Welfare, Seoul Welfare Graduate University Full-time Lecturer
μ
μ 초콩의제조중기능적특성비교 173 Table 1. Changes in total polyphenol contents of Chokong as affected by soaking time Extracting solvents Chokong 1) Soaking time (days) 1 4 7 10 14 Water 70% ethanol solution 23.46±4.62
- 1 -
11 1541000-001436-01 수출전략형신수요창출을위한홍마늘및바이오식품개발 (Development of red-garlic and its bio-food for create new market demand and develop of export items) - 1 - - 2 - - 3 - o o - 4 - o o - 5 - o α α - 6 - - 7
Crt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
44-4대지.07이영희532~
A Spatial Location Analysis of the First Shops of Foodservice Franchise in Seoul Metropolitan City Younghee Lee* 1 1 (R) 0 16 1 15 64 1 Abstract The foodservice franchise is preferred by the founders who
- 2 -
- 1 - - 2 - - 3 - - 4 - μ μ μ μ μ μ μ α μ μ μ μ μ - 5 - μ μ μ μ - 6 - μ - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - μ μ μ α μ λ - 14 - μ μ μ μ μ - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22
<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
DBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016) ISSN 228
(JBE Vol. 1, No. 1, January 016) (Regular Paper) 1 1, 016 1 (JBE Vol. 1, No. 1, January 016) http://dx.doi.org/10.5909/jbe.016.1.1.60 ISSN 87-9137 (Online) ISSN 16-7953 (Print) a), a) An Efficient Method
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
main.hwp
열화상 측정기를 이용한 안마의자의 인체 영향 평가 박세진, 구준모, 이현자 한국표준과학연구원 생활계측그룹 Evaluation of Massage Chair Effect on Human Body using Infrared Imaging/Radiometric Camera Se Jin Park, Jun Mo Koo, Hyun Ja Lee Human L ife Measurement
Subject : 귀사의 일익번창하심을 진심으로 기원합니다.
1. 18 D-303 Tel : () 031-711-1560 Fax : 031-711-1563 www.iontec.co.kr e-mail : ion@iontec.co.kr (organic reaction). (esterification) (hydrolysis of ester). Porous type (alkylation) system. ( gel type ).
[ 화학 ] 과학고 R&E 결과보고서 나노입자의표면증강을이용한 태양전지의효율증가 연구기간 : ~ 연구책임자 : 김주래 ( 서울과학고물리화학과 ) 지도교사 : 참여학생 : 원승환 ( 서울과학고 2학년 ) 이윤재 ( 서울과학고 2학년 ) 임종
![[ 화학 ] 과학고 R&E 결과보고서 나노입자의표면증강을이용한 태양전지의효율증가 연구기간 : ~ 연구책임자 : 김주래 ( 서울과학고물리화학과 ) 지도교사 : 참여학생 : 원승환 ( 서울과학고 2학년 ) 이윤재 ( 서울과학고 2학년 ) 임종](/thumbs/103/161032648.jpg "[ 화학 ] 과학고 R&E 결과보고서 나노입자의표면증강을이용한 태양전지의효율증가 연구기간 : ~ 연구책임자 : 김주래 ( 서울과학고물리화학과 ) 지도교사 : 참여학생 : 원승환 ( 서울과학고 2학년 ) 이윤재 ( 서울과학고 2학년 ) 임종")
[ 화학 ] 과학고 R&E 결과보고서 나노입자의표면증강을이용한 태양전지의효율증가 연구기간 : 2013. 3 ~ 2013. 12 연구책임자 : 김주래 ( 서울과학고물리화학과 ) 지도교사 : 참여학생 : 원승환 ( 서울과학고 2학년 ) 이윤재 ( 서울과학고 2학년 ) 임종찬 ( 서울과학고 2학년 ) 소재원 ( 서울과학고 2학년 ) 1,.,.,.... surface
歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
ePapyrus PDF Document
Trans. of the Korean Hydrogen and New Energy Society(2013. 4), Vol. 24, No. 2, pp. 136~141 DOI: http://dx.doi.org/10.7316/khnes.2013.24.2.136 흡기관 분사식 수소 SI기관의 희박과급 적용에 관한 연구 이광주 1 ㆍ이종구 1 ㆍ이종태 2 1 성균관대학교
歯5-2-13(전미희외).PDF
The Korean Journal of Counseling 2004, Vol. 5, No. 2, 423-434,. 4 5 18 9, 9.,,,,,.,,, t-.. :,,, (,, 1996),.,,. (, 2001),... 88 98 2000, 88 12.5%(250 )98 35.6%(712 )2.8 (,,, 2001) (Corresponding Author)
자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr
Original Article pissn 1738-2637 J Korean Soc Radiol 2012;67(2):129-134 The Survey of Magnetic Resonance Imaging Quality according to in Korea 1 자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 1 Hyun-Hae
한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26
2015 한국전지학회 춘계학술대회 2일차 한국전지학회 춘계 학술대회(신소재 및 시장동향 관련 주제 발표) 시간 제목 비고 세션 1 차세대 이차전지용 in-situ 분석기술 좌장 : 윤성훈 09:00~09:30 Real-time & Quantitative Analysis of Li-air Battery Materials by In-situ DEMS 김동욱(한국화학연구원)
Æ÷Àå82š
Lee, Kyungbae (E-mail : kblee6078@ex.co.kr) Lee, Jaehoon (E-mail : ranian74@ex.co.kr) Sohn, Duecksu (E-mail : mgsds@ex.co.kr) Kwon, Soonmin (E-mail : soonmini2@ex.co.kr) ABSTRACT PURPOSES : The purpose
388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR
6 3 2000 ; 387-392 (3) Dysplastic Nodule Young Nyun Park, M.D., Chanil Park, M.D. Department of Pathology, Yonsei University College of Medicine BRIEF HISTORY 56. AST/ALT 72/73 IU/L, total bilirubin 0.7
27 2, 17-31, , * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** ( :
27 2, 17-31, 2009. -, * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** (: dminkim@cau.ac.kr) 18 한국교육문제연구제 27 권 2 호, 2009. Ⅰ. (,,, 2004). (,, 2006).,,, (Myrick,
Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI: 3 * Effects of 9th
Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp.357-378 DOI: http://dx.doi.org/10.21024/pnuedi.29.2.201906.357 3 * Effects of 9th Grade Students Participation in Career Curriculum Cluster
(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re
EMF Health Effect 2003 10 20 21-29 2-10 - - ( ) area spot measurement - - 1 (Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern
1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
10(3)-09.fm
w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½
16_이주용_155~163.hwp
사상체질의학회지 2008;20(2):155-163 J of Sasang Constitutional Medicine Vol. 20, No. 2, 2008:155-163 http://www.esasang.com 腦 梗 塞 으로 발생한 少 陽 人 半 身 舞 蹈 病 患 者 치험 1례 이주용 이한얼 한경수 안택원 Abstract 대전대학교 한의과대학 사상체질과 A Soyangin
untitled
- 345 - - 346 - - 347 - - 348 - - 349 - - 350 - - 351 - - 352 - - 353 - - 354 - - 355 - - 356 - - 357 - - 358 - - 359 - - 360 - - 361 - 샘플발광억제율 샘플함량단위활성혈액샘플희석율표준품 실측샘플발광억제 샘플희석배율 비교활성 단위활성 혈액혈액 - 362 -
<303720C7CFC1A4BCF86F6B2E687770>
1) < 論 文 > 라이프스타일 세분화를 통한 실버타운 수요자 분석 133 주택연구 제15권 4호 2007. 12/15(4) : 133~160 Housing Studies Review Vol. 15, No. 4 : 133~160 접수일 : 2007. 7. 9, 심사일 : 2007. 7. 16, 심사완료일 : 2007. 8. 29 라이프스타일 세분화를 통한 실버타운
Kaes010.hwp
갑상선자극호르몬이갑상선암세포의 VEGF, 신생혈관형성, 성장, 침윤및전이에미치는영향 Effects of TSH on the Production of VEGF, Angiogenesis, Growth, Invasion and Metastasis in Thyroid Cancer Cells Euy Young Soh, M.D., Hee Boong Park, M.D.,
ECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of
한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and
(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
untitled
Journal of Korean Medicine Rehabilitation Vol. 23 No. 3, July 2013 pissn 1229-1854 eissn 2288-4114 Original Article 봉독약침이 흰쥐의 국소뇌혈류량 및 평균혈압에 미치는 영향 민선정 염승룡 권영달 원광대학교 한의과대학 한방재활의학과교실 Effects of Bee Venom
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Feb.; 29(2), 93 98. http://dx.doi.org/10.5515/kjkiees.2018.29.2.93 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) UHF-HF
<35BFCFBCBA2E687770>
주요개념 : 컴퓨터음란물 접촉자, 성지식, 성태도 남자중학생의 컴퓨터음란물 접촉자와 비접촉자간의 성지식과 태도의 차이 김 영 혜* 이 화 자** 정 향 미*** 1. 연구의 필요성 한국은 I. 서 론 1960 년대 이후부터 시작된 돌진적 산업화 ( 한 상진, 1996) 로 인하여 경제적 부흥을 이루어 집집마다 TV 수상기를 가질 수 있게 되었고 최근에는 PC보급율
A 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: NCS : G * The Analy
Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.133-158 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.133 NCS : G * The Analysis of the Cognitive Level of Basic Job Skills of Specialized
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., Vol. 13 No. 6, , December 2015 Sericine 과 Alpha-Mangostin 의주름개선상승효과 김기쁨 1, 조아령 1, 차화준 2, 신상훈 2, 이정
RESEARCH ARTICLE Sericine 과 Alpha-Mangostin 의주름개선상승효과 김기쁨 1, 조아령 1, 차화준 2, 신상훈 2, 이정주 2, 이현경 2, 안인숙 1 * 1 한국피부임상과학연구소, 2 건국대학교생물공학과 Synergetic Effects of Sericin and Alpha-Mangostin on Anti-wrinkle Effects
00....
Fig. 1 2.5%. 51.5%, 46.0%,.. /, Table 1 (U.V.; Ultraviolet 10-400 nm)/ (NIR; Near Infrared 700 nm - 5 µm) ( TiO 2, WO 3, ZnO, CeO, ATO, Sb 2O 3-ZnO, ITO.) (400 nm - 780 nm). /. Fig. 1.. 23 Table 1. / /