( )kjh012.hwp
|
|
- 준희 정
- 6 years ago
- Views:
Transcription
1 Korean J Hematol Vol. 43, No. 2, June, 2008 Original Article 혈소판 ADP 수용체 P2Y1 유전자단일염기다형성과허혈성혈관질환과의상관관계연구 1 중앙대학교의과대학내과학교실, 서울대학교의과대학 2 내과학교실, 3 예방의학교실, 4 서울대학교천연물연구소 박은경 1 ㆍ김효수 2 ㆍ박성효 2 ㆍ박진식 2 ㆍ김인호 2 ㆍ박선양 2 박소연 3 ㆍ김진희 3 ㆍ홍윤철 3 ㆍ윤혜숙 4 ㆍ이상재 1 The Relationship of P2Y1 ADP Receptor Polymorphisms and Ischemic Vascular Disease Eunkyung Park 1, Hyo-Soo Kim 2, Sung Hyo Park 2, Jin Sik Park 2, In Ho Kim 2, Seonyang Park 2, So-Yeon Park 3, Jin Hee Kim 3, Yun-Chul Hong 3, Hye Sook Yun 4 and Sang Jae Lee 1 1 Department of Internal Medicine, Chung-Ang University College of Medicine, Departments of 2 Internal Medicine and 3 Preventive Medicine, Seoul National University College of Medicine, 4 Natural Product Research Institute, Seoul National University, Seoul, Korea Background: The platelet ADP receptor P2Y1 plays a key role in platelet aggregation. Methods: We tested eight sites of P2Y1 and studied the possible link between the presence of P2Y1 polymorphisms and the risk of is chemic vascular disease in a case-control study. The polymorphisms A1622G, C647G and C2259G were selected according to linkage disequilibrium. We evaluated 275 patients with is chemic cerebrovascular disease and 275 control subjects. We also evaluated 171 patients with acute myocardial infarction (AMI), 166 patients with unstable angina (UA), 173 patients with stable angina (SA) and 188 control subjects. Results: For the cerebrovascular disease patients, A1622G AA, AG [odds ratio (OR), 1.170; 95% confidence interval (CI), to 1.748] and GG (OR, 1.031; 95% CI, to 1.918) did not show any difference between the case and control subjects. C647G CC, CG (OR, 0.995; 95% CI, to 1.550) and GG (OR, 1.012; 95% CI, to 2.277) did not show any difference between the case and control subjects. C2259G CC, CG (OR, 0.619; 95% CI, to 1.082) and GG did not show any difference between the case and control subjects. For coronary artery disease patients, C2259G GG, CG (for AMI patients OR, 0.880, 95% CI, to 2.016; for UA patients, OR, 0.885, 95% CI, to 1.911; for SA patients, OR, 1.156, 95% CI, to 2.501) and CC did not show any difference between AMI, UA and SA patients and each control subject. C647G GG, CG (for AMI patients OR, 1.351, 95% CI, to 2.497; for UA patients OR, 1.292, 95% CI, to 2.309; for SA patients OR, 0.977, 95% CI, to 1.803) and CC (for AMI patients OR, 0.355, 95% CI, to 1.358; for UA patients OR, 0.645, 95% CI, to 2.028; for SA patients OR, 0.385, 95% CI, to 1.311) did not show any difference between AMI, UA and SA patients and each control subject. A1622G AA, AG (for AMI patients OR, 1.416, 95% CI, to 2.549; for UA patients OR, 1.079, 95% CI, to 1.904; for SA patients OR, 0.958, 95% CI, to 1.732) and GG (for AMI patients OR, 0.525, 95% CI, to 1.411; for UA patients OR, 0.568, 95% CI, to 1.401; for SA patients OR, 0.441, 95% CI, 접수 :2008 년 4 월 12 일, 수정 :2008 년 5 월 26 일승인 :2008 년 6 월 2 일교신저자 : 박은경, 서울특별시동작구흑석동 , 중앙대학교병원내과 Tel: , Fax: lisa1114@naver.com 69 Correspondence to:eunkyung Park Department of Internal Medicine, Chung-Ang University Hospital 224-1, Heukseok-dong, Dongjak-gu, Seoul , Korea Tel: , Fax: lisa1114@naver.com
2 70 Korean J Hematol Vol. 43, No. 2, June, 2008 to 1.154) did not show any difference between AMI, UA and, SA patients and the control subjects. Conclusion: The distribution of P2Y1 polymorphisms did not show any association with ischemic vascular disease. (Korean J Hematol 2008;43:69-76.) Key Words: Platelet receptor, Polymorphism, Platelet aggregation, Ischemic vascular disease 서 허혈성혈관질환 (ischemic vascular diseases) 은선진국에서는발병률과사망률이가장높은질환군으로우리나라에서도평균수명의증가와더불어발생이증가하는추세에있다. 관상동맥질환과허혈성뇌혈관질환은 1차발병후재발의위험이높으며, 합병증및후유증도심각하다. 허혈성혈관질환의병인은유전적소인, 호르몬, 흡연, 과체중등의환경적요인과고혈압, 당뇨병, 호모시스틴혈증 (homocysteinemia), 이상지혈증 (dyslipidemia) 등과같은여러요인이복잡하게관련되나, 직접적인병인은혈소판의활성화와이로인한혈전생성에따른혈액흐름의방해및이에의한경색, 허혈이다. 1) 최근까지우리나라를포함하여동양인에서는인종적요인또는생활습관의차이로허혈성혈관질환의발생빈도가서구보다낮다고막연히알려져있었다. 최근산업구조의서구화에따라각종후천적인혈전호발요소가점차증가하고동양인의허혈성혈관질환의발병률이빠른속도로증가하고있어이에대한보다나은예방및치료를위해발병원인또는발병가능성을증가시키는요인에대한연구는중요한과제이다. 손상된혈관주변에혈소판은여러단계의과정을거쳐응집괴를형성한다. 활성화된혈소판은유용성응착물질 (soluble adhesion molecule) 과결합하고상호응집되며섬유소 (fibrin) 와결합하여혈전을형성한다. 이러한과정에여러리간드 (ligand) 들이복잡하게관여하며, 각각의리간드가결합하는혈소판수용체들이밝혀지고있다. 이중혈소판에서유리된 ADP에결합하는수용체에는 P2Y1, P2Y12, P2X1의 3종이알려져있으며혈소판응집과정에서의역할등에대해연구가이루어지고있는데, 최근에는 P2Y1 A1622G SNP에따라 ADP에대한혈소판반응이다름이보고되었다. 2) 혈소판의활성화에따른허혈성혈관질환발병에는누적된환경적, 후천적요인과함께유전적요인이상당한역할을할것으로생각된다. 유전적요인은인종 론 간에상당한차이가있다고알려져있으나, 동양에서혈소판과관련한단일염기다형성 (single nucleotide polymorphism, SNP) 연구는일본및국내에서일부이루어지고있을뿐이다. 3-10) 혈소판응집관련 SNP에의한유전적인요인과질환의관련성에대하여특수유전성질환과의연관성에대하여는상당한진척이있으나, 허혈성혈관질환과유전자 SNP의상관성에대한연구보고는매우제한적이다. 혈소판응집에대한개인별민감성차이에대하여국내에서도최근연구가시작되고있다. 6) 본연구자들은지난 2005년허혈성뇌혈관질환환자와정상인의혈소판수용체 SNP 차이를확인하고자 100명의허혈성뇌혈관질환환자와 97명의정상대조군에서연구를진행하였다. 기존에알려진혈소판수용체각각에대해보고된 SNP 위치 9개를임의로선택하여 GP IIIa (C1565T), GP Ia (C807T), GP Ibα (Kozak T/C polymorphism, HPA-2), GP IIb (HPA-3), P2Y1 (A1622G), P2Y12 (G52T), thromboxane A2 receptor (C795T, T924T) 에대하여분석하였고, P2Y1 ADP 수용체유전자다형성 (A1622G의 G allele) 이통계적으로유의하지는않았으나환자군에서높은경향을보였다 (P=0.09). 11) 본연구에서는기존연구결과를토대로혈소판 ADP 수용체중 P2Y1 SNP 발현과허혈성혈관질환의관계를보고자하였으며, 대상환자수와대상 SNP의수를증가시켜통계학적검정력을늘리고자하였다. 이러한상관관계를확인한다면, 관련유전자검사로서한국인에서허혈성혈관질환의발병을예측할수있을것이다. 1. 연구대상 대상및방법 대조군은만 20 59세의건강한정상인으로본실험에관한설명과함께참여의사여부를확인하여동의하는사람만을선별하여피험자로모집하였다. 환자군은만 20 59세의세계보건기구 (World Health Organization) 진단기준에합당한심근경색증, 불안정성협
3 박은경외 : P2Y1 SNP 와허혈성혈관질환 71 심증, 안정성협심증또는뇌동맥경색증의현병력을가진혈전성심혈관질환자를대상으로하였다. 2. 연구기간및윤리심사본연구의연구기간은 2006년 3월부터 2008년 2월까지로하였다. 본연구는서울대학교병원임상시험심의위원회의승인을거쳐시행되었다. 3. 혈액채취및시료제작 3.8% 구연산삼나트륨 (trisodium citrate, 1:9) 이담겨있는플라스틱관에혈액을채취하였다. 180g에서 10 분간원심분리하여상층액혈소판풍부혈장 (platelet rich plasma, PRP) 을얻고, 나머지는 2,000g에서 15분간원심분리하여혈소판결핍혈장 (platelet poor plasma, PRP) 을얻었다. PUREGENE blood DNA kit (Gentra Inc. Minneapolis, MN, USA) 를이용하여핵산을추출하고 80 o C에서보관하였다. 4. 단일염기확장방법 (single base extension analysis) 에의한 SNP의분석 SNP 표지자의위치바로앞까지해당하는염기서열로짜여진유전자형분석시발체 (genotyping primer) 를이용하여 SNP의유전형을분석하였으며 (Table 1) SNaPshot 분석기기를이용하였다. SNP 유전자형분석은 ABI PRISM SNaPShot Multiplex kit (ABI, Foster City, CA, USA) 를이용한단일염기확장방법을통해시행하였다. 핵산은전진성 (forward) 및후진성 (reverse) 시발체와표준중합효소연쇄반응 (PCR) 용액을이용하여 PCR반응을시행하였다. 10ng의핵산, 0.5pM의각올리고뉴클레오티드 (oligonucleotide) 시발체, 1μL 의 10X PCR Gold 완충액 (buffer), 250uM dntp (deoxynucleotides), 3mM MgCl 2, 0.25 unit i-startaq 핵산중합효소 (intron Biotechnology, Sungnam, Kyungki-Do, Korea) 가포함된 10μL 반응액을사용하여 PCR반응으로증폭시켰다. PCR반응은다음과같이진행하였다. 95 o C에서 10분동안 1주기를시행하였고, 95 o C에서 30초동안, 55 o C에서 1분동안, 72 o C에서 1분동안 30 주기를시행한뒤, 72 o C에서 7분동안 1주기를시행하 였다. 증폭이후, PCR반응의생산물을새우알칼리성인산효소 (shrimp alkaline phosphatase, SAP) (Roche) 와핵산외부가수분해효소 (exonuclease) I (USB Corporation) 각 1 unit를이용하여 37 o C에서 60분, 72 o C에서 15분동안처리하여증폭된생산물을정제하였다. 1μL의정제증폭된생산물을 0.15 pmols의시발체연장반응을위한유전자형분석시발체를포함한 SNaPshot Multiplex Ready 반응혼합물에첨가하였다. 시발체연장반응은 96 o C에서 10초동안, 50 o C에서 5초동안, 60 o C 에서 30초동안 25주기를시행하였다. 과다한형광염료시약을제거하기위하여 1 unit의 SAP를 PCR반응생산물과함께 37 o C에서 1시간동안, 72 o C에서 15분동안처리하였다. 연장생산물을포함한최종반응용액 1μL 를 9μL의 Hi-Di formamide (ABI, Foster City, CA) 에첨가하였다. 혼합물을 95 o C에서 5분간배양하고얼음에서 5분간처리한후 ABI Prism 3730xl DNA analyzer 를이용하여전기영동하였다. 결과는 Gene Scan analysis software (ABI) 를이용하여분석하였다. 5. P2Y1 SNP의선택 P2Y1 유전자에서발견가능한 A2591T, C1382T, A1622G, C893T, C1881G, C2259G, A1747T, C647G의유전자형분석을시행하였다. 8개의 SNP 중 A2591T는대립유전자빈도가 A:T=1:0으로분석에서제외시켰다. C1382T와 A1622G, C893T와 C1881G, A1747T와 C647G는각각서로인접한위치에있어 A1622G, C893T, C647G를다시선별하고인접한다른 SNP는제외시켰다. C893T와 A1622G는완전연관 (complete linkage) 되어있었다 ( D' =1). 최종적으로 C2259G, A1622G, C647G의 3개 SNP를환자-대조군분석에이용하였다 (Fig. 1). Table 1. P2Y1 primers Primer Sequence (5' 3') P2Y1-A1622G-F TCCTCTGAGGAGAAAATCGATGGATGTA CCTGGT P2Y1-A1622G-R AGACACAGCAAAAACAGTCAGTAC Fig. 1. The selection of P2Y1 polymorphism site.
4 72 Korean J Hematol Vol. 43, No. 2, June, P2Y1 SNP와허혈성혈관질환과의상관성에대한분석 1) 허혈성뇌혈관질환환자와정상인의 P2Y1 SNP 비교환자-대조군연구로서허혈성뇌혈관질환환자 275 명과연령, 성별보정정상대조군 275명에대하여시행되었다. 핵산의보존상태가좋지않았던대상자를제외하면 A1622G는환자군 271명, 대조군 275명, C647G는환자군 267명, 대조군 267명, C2259G는환자군 271명, 대조군 275명을분석하였다. 2) 관상동맥질환 (coronary artery disease) 환자와정상인의 P2Y1 SNP 비교환자-대조군연구로서급성심근경색증 (acute myocardial infarction) 171명, 불안정성협심증 (unstable angina) 166명, 안정성협심증 (stable angina) 173명과연령, 성별보정정상대조군 188명에대하여시행하였다. 핵산의보존상태가좋지않았던대상자를제외하면 A1622G는급성심근경색증군 171명, 불안정성협심증군 166명, 안정성협심증군 173명, 연령, 성별보정정상대조군 188명, C647G는급성심근경색증군 167 명, 불안정성협심증군 165명, 안정성협심증군 170명, 연령, 성별보정정상대조군 185명, C2259G는급성심근경색증군 167명, 불안정성협심증군 164명, 안정성협심증군 170명, 연령, 성별보정정상대조군 188명을분석하였다. 7. 통계적분석환자군과대조군에서각인자들이차이가있는지알아보기위해로지스틱회귀분석 (logistic regression) 을사용하였다. 통계적유의수준은 P<0.05로하여 odds ratio (OR) 와 95% confidence interval (95% CI) 를사용하였다. 흡연, 고혈압, 당뇨병의혈전형성위험인자의차이에대하여대조군및환자군 ( 허혈성뇌혈관질환, 급성심근경색증, 불안정성협심증, 안정성협심증 ) 에서 분석을하였고, 연속변수에대하여 ANOVA (analysis of variance), 비연속변수에대하여카이-제곱검정 (chisquare test) 을사용하였다. P2Y1 환자-대조군연구에서혈전형성에영향을주는유의한인자에대하여는통계적보정을하였다. 통계프로그램은 SAS version 8.1 (SAS Institute Inc., Cary, NC, USA) 를사용하였다. 결과 1. 허혈성혈관질환환자혈소판수용체의 P2Y1 SNP 1) 허혈성뇌혈관질환환자혈소판수용체의 P2Y1 SNP 환자군의연령은 63.5±12.3세 (mean±standard deviation), 대조군의연령은 63.1±12.0로차이가없었고, 성비는양군에서모두 1.3:1 (M:F) 이었다. A1622G는 AA가환자군 124명, 대조군 122명, AG 가환자군 114명, 대조군 122명, GG가환자군 33명, 대조군 31명으로환자군과대조군에서유의한차이를보이지않았다. C647G는 CC가환자군 158명, 대조군 149명, CG가환자군 91명, 대조군 97명, GG가환자군 18명, 대조군 18명으로환자군과대조군에서유의한차이를보이지않았다. C2259G는 CC가환자군 227명, 대조군 241명, CG가환자군 44명, 대조군 33명, GG가환자군 0명, 대조군 1명으로환자군과대조군에서유의한차이를보이지않았다 (Table 2). 2) 관상동맥질환환자혈소판수용체의 P2Y1 SNP 관상동맥질환환자군의연령은급성심근경색증군 62.8±9.6세, 불안정성협심증군 62.9±9.6세, 안정성협심증군 63.1±9.7세, 대조군의연령은 62.4±9.6세로차이가없었다. 성비는급성심근경색증군에서 1.12:1, 불안정성협심증군에서 1.18:1, 안정성협심증군에서 1.16:1, 대조군에서 1.29:1이었다. 각 SNP는각각의관상동맥질환환자군과대조군에서유의한차이를보 Table 2. The P2Y1 polymorphism in patients with ischemic cerebrovascular diseases P2Y1 genotype Control N (%) Case N (%) OR (95% CI) A1622G AA 122 (44.4) 124 (45.8) AG 122 (44.4) 114 (42.1) (0.784, 1.748) GG 31 (11.2) 33 (12.1) (0.554, 1.918) C647G CC 149 (56.5) 158 (59.2) CG 97 (36.7) 91 (34.1) (0.639, 1.550) GG 18 (6.8) 18 (6.7) (0.450, 2.277) C2259G CC 241 (87.5) 227 (83.8) CG 33 (12.1) 44 (16.2) (0.354, 1.082) GG 1 (0.4) 0
5 박은경외 : P2Y1 SNP 와허혈성혈관질환 73 이지않았다 (Table 3). C2259G의 GG는대조군 162명, 급성심근경색증군 142명, 불안정성협심증군 139명, 안정성협심증군 146명으로대조군과급성심근경색증군사이, 대조군과불안정성협심증군사이, 대조군과안정성협심증군사이에차이가없었다. C2259G의 CG는대조군 26명, 급성심근경색증군 22명, 불안정성협심증군 24명, 안정성협심증군 24명으로대조군과급성심근경색증군사이, 대조군과불안정성협심증군사이, 대조군과안정성협심증군사이에차이가없었다. C2259G 의 CC는대조군 0명, 급성심근경색증군 3명, 불안정성협심증군 1명, 안정성협심증군 0명으로환자수가적어서통계분석이불가능하였다. C647G의 GG는대조군 110명, 급성심근경색증군 103명, 불안정성협심증군 95 명, 안정성협심증군 99명으로대조군과급성심근경색증군사이, 대조군과불안정성협심증군사이, 대조군과안정성협심증군사이에차이가없었다. C647G의 CG는대조군 60명, 급성심근경색증군 57명, 불안정성협심증군 63명, 안정성협심증군 59명으로대조군과급성심근경색증군사이, 대조군과불안정성협심증군사이, 대조군과안정성협심증군사이에차이가없었다. C647G의 CC는대조군 15명, 급성심근경색증군 7명, 불안정성협심증군 7명, 안정성협심증군 12명으로대조군과급성심근경색증군사이, 대조군과불안정성협심증군사이, 대조군과안정성협심증군사이에차이가없었다. A1622G의 AA는대조군 90명, 급성심근경색증군 79명, 불안정성협심증군 78명, 안정성협심증군 81명으로대조군과급성심근경색증군사이, 대조군과불안정성협심증군사이, 대조군과안정성협심증군사이에차이가없었다. A1622G의 AG는대조군 73명, 급성심근경색증군 80명, 불안정성협심증군 74명, 안정성협심증군 74명으로대조군과급성심근경색증군사이, 대조군과불안정성협심증군사이, 대조군과안정성협심증군사이에차이가없었다. A1622G의 GG는대조군 25명, 급성심근경색증군 12명, 불안정성협심증군 14명, 안정성협심증군 18명으로대조군과급성심근경색증군사이, 대조군과불안정성협심증군사이, 대조군과안정성협심증군사이에차이가없었다 (Table 3). 2. 기타혈전형성의위험인자와혈소판수용체의 P2Y1 SNP 1) 허혈성뇌혈관질환환자와혈전형성의위험인자허혈성뇌혈관질환환자군과대조군의흡연, 고혈압, 당뇨병에대한차이를조사하였다. 각 275명의환자군과대조군에서흡연자는환자군 99명, 대조군 67명으로환자군에서많았다 (P=0.004). 고혈압은환자군 55 명, 대조군 15명으로환자군에서많았다 (P<0.001). 당뇨병은환자군 68명, 대조군 22명으로환자군에서많았다 (P<0.001). 흡연, 고혈압, 당뇨병에대하여각각하위집단분석 (subgroup analysis) 을시행하였고허혈성뇌혈관질환환자군과대조군사이에혈소판수용체 P2Y1 SNP의유의한차이는없었다. Table 3. The P2Y1 polymorphism in patients with coronary artery diseases Geno Control N (%) AMI N (%) OR (95% CI)* UA N (%) OR (95% CI)* CSA N (%) OR (95% CI)* types A1622G AA 90 (47.9) 79 (46.2) (47.0) (46.8) AG 73 (38.8) 80 (46.8) (0.786, 2.549) 74 (44.6) (0.611, 1.904) 74 (42.8) (0.529, 1.732) GG 25 (13.3) 12 (7.0) (0.195, 1.411) 14 (8.4) (0.231, 1.401) 18 (10.4) (0.169, 1.154) AG+GG 98 (52.1) 92 (53.8) (0.670, 2.038) 88 (53.0) (0.550, 1.604) 92 (53.2) (0.464, 1.419) C647G GG 110 (59.5) 103 (61.7) (57.6) (58.2) CG 60 (32.4) 57 (34.1) (0.731, 2.497) 63 (38.2) (0.723, 2.309) 59 (34.7) (0.530, 1.803) CC 15 (8.1) 7 (4.2) (0.093, 1.358) 7 (4.2) (0.205, 2.028) 12 (7.1) (0.113, 1.311) CG+CC 75 (40.5) 64 (38.3) (0.621, 2.001) 70 (42.4) (0.666, 2.002) 71 (41.8) (0.469, 1.496) C2259G GG 162 (86.2) 142 (85.0) (84.8) (85.9) CG 26 (13.8) 22 (13.2) (0.384, 2.016) 24 (14.6) (0.410, 1.911) 24 (14.1) (0.534, 2.501) CC 0 (0) 3 (1.8) 1 (0.6) 0 (0) CG+CC 26 (13.8) 25 (15.0) (0.504, 2.430) 25 (15.2) (0.424, 1.952) 24 (14.1) (0.534, 2.501) *OR adjusted with age, sex, and smoking status. Abbreviations: AMI, acute myocardial infarction; UA, unstabel angina; CSA, chronic stable angina.
6 74 Korean J Hematol Vol. 43, No. 2, June, ) 관상동맥질환환자와혈전형성의위험인자 관상동맥질환환자군과대조군의흡연, 고혈압, 당뇨병에대한차이를조사하였다. 192명의대조군, 173 명의급성심근경색증군, 167명의불안정성협심증군, 173명의안정성협심증군에서흡연자는대조군 48명, 급성심근경색증군 61명, 불안정성협심증군 56명, 안정성협심증군 49명으로각군에서차이를보였다 (P= 0.009). 고혈압은대조군 9명, 급성심근경색증군 85명, 불안정성협심증군 75명, 안정성협심증군 91명으로각군에서유의한차이를보였다 (P=0.012). 당뇨병은대조군 8명, 급성심근경색증군 40명, 불안정성협심증군 42명, 안정성협심증군 51명으로각군에서유의한차이를보였다 (P<0.001). 흡연, 고혈압, 당뇨병에대하여각각하위집단분석을시행하였고각관상동맥질환환자군과대조군사이에혈소판수용체 P2Y1 SNP 의유의한차이는없었다. 고 혈소판의활성화와혈전형성과정에는여러리간드들이결합하는혈소판수용체들이있다. 혈소판수용체의 SNP는동종면역성혈소판감소증 (alloimmune thrombocytopenia) 이나수혈불응증 (transfusion refractoriness), 수혈후자반증 (post transfusion purpura) 등의발생에중요한역할을담당하는데혈소판막당단백중에서특히 GP Ia, GP Ib, GP IIIa의 SNP가허혈성혈관질환위험의증가와관련이있다고보고되었다 ) ADP 수용체에는 P2Y12, P2Y1, P2X1의 3가지퓨린수용체가있는데, P2Y12와 P2Y1 SNP는 ADP에대한다양한혈소판반응과연관이있다. 2,18-23) P2Y1 수용체는 G 단백질을통하여혈소판의활성화에관여하고혈소판의형태를변화시킨다. 19,20) P2Y12 수용체는 adenylate cyclase와결합하여 camp의생성을저해한다. 20) 이는혈소판의응집을극대화하고응괴를안정시킨다. 18,21) P2Y1 수용체와 P2Y12 수용체는정상적인 ADP에의해유도되는혈소판응집에필수적으로작용한다. P2X1 수용체는자극이되면비특이적인이온채널을통하여 Na + 와 Ca 2+ 이온이내향전류를일으키는데, 이수용체의역할은아직까지불분명한상태이다. 20,21,24) P2Y12 SNP는 H1과 H2, 2개의 haplotype이보고되어있는데, H1은 G52T의 G 유전자, H2는 G52T의 T 유전자에해당한다. Fontana 등은 H2가 ADP에대한혈소판의반응증가와관련이있다고보고하였으며, 환자- 찰 대조군연구에서말초동맥질환과연관된다고보고하였다. 25) Hetherington 등도 P2Y12 SNP의혈소판응집반응에따른차이를분석하였는데 H2와혈소판응집반응증가와의연관성은없었다. 2) ADP 수용체의다른한가지인 P2Y1에대하여 Hetherington 등은 A1622G SNP가혈소판 ADP 반응과유의한관련이있다고보고하였다. 2) G 대립유전자를가진사람일수록 ADP에의해유도되는혈소판응집반응이높았다. 그러나이 SNP와관련하여혈전질환의위험을임상적으로증명하는자료는아직보고되지않았다. 본연구에서 P2Y1 SNP에관하여 A1622G 이외에기존에보고된적이없는 A2591T, C1382T, C893T, C1881G, C2259G, A1747T, C647G의 7개 SNP를추가하여동시에분석하였다. 총 8개의 SNP에대하여 haplotype을구성하여전부분석하였으나허혈성혈관질환과정상인사이의유의한차이를보이지않았다. P2Y1 은 3,122 염기로구성된단일엑손으로비교적크기가작은유전자이므로 8개의 SNP 위치를찾아분석한것은 P2Y1 전반에걸쳐분석한것이라고할수있다. 최근국내에서허혈성혈관질환과연관되는 SNP를찾는연구가몇가지이루어졌다. 김등이기질금속성단백질분해효소 (matrix metalloproteinase)-9의프로모터부분의 C1562T SNP에서 1562T가급성심근경색의유의한위험인자가된다고보고하였다. 9) 정등은아디포넥틴 (adiponectin) G276T 및 T45G SNP와관상동맥질환과의연관성을규명하고자하였으나, 유의한연관성을찾지못하였다. 10) 기존의허혈성혈관질환과 SNP 의유전적차이의관련성을찾기위한연구들은대부분 1개또는 2개의단편적인 SNP에대하여분석하였다. 본연구에서는 P2Y1 SNP에관하여 A1622G 이외에기존에보고된적이없는 A2591T, C1382T, C893T, C1881G, C2259G, A1747T, C647G의총 8개 SNP를동시에분석하였다. 동맥경화증과이에따른혈전성합병증은다양한원인에의하고환경의영향을받기때문에 SNP가필연적으로이러한질환의개인취약성과연관이있다고제안하기위해서는신중을기하여야할것이다. 본연구에서도흡연, 고혈압, 당뇨병이허혈성혈관질환환자에서높은비율을보여 SNP 단독으로인한혈전형성의영향을비교분석하는데제한이있었다. SNP 이외의유의한혈전위험인자의영향을배제하고분석하기위해서는보다많은수의대상인원이확보되어야통계적인유의성을찾을수있을것이다. 향후다수의 SNP 블록연구또는다른허혈성혈관질환과관련
7 박은경외 : P2Y1 SNP 와허혈성혈관질환 75 된혈소판유전자연구, 허혈성혈관질환의발병기전에관여하는다른효소나수용체에대한 SNP 연구가대단위의환자군에서이루어진다면관련유전자검사로서한국인의허혈성혈관질환발병을예측하는데도움이될것이다. 요약배경 : 혈소판 ADP 수용체 P2Y1은혈소판응집에중요하다. 방법 : 허혈성혈관질환및관상동맥질환환자와정상인에서 P2Y1의유전적차이를 SNP를이용하여발견하여발병가능성을예측하고자하였다. P2Y1에서발견가능한 8개유전자를분석을시행하여환자-대조군연구를시행하였다. 연관값을고려하여최종적으로 A1622G, C647G, C2259G의 3개위치를선택하였다. 허혈성뇌혈관질환에대하여허혈성뇌혈관질환환자군 275명과대조군 275명, 관상동맥질환에대하여급성심근경색증 171명, 불안정성협심증 166명, 안정성협심증 173명과대조군 188명을대상으로하였다. SNP는 SNaPshot방법으로분석하였다. 결과 : 허혈성뇌혈관질환환자에서 A1622G의 AA, AG (OR, 1.170; 95% CI, ), GG (OR, 1.031; 95% CI, ) 는환자군과대조군에서차이를보이지않았다. C647G의 CC, CG (OR, 0.995; 95% CI, ), GG (OR, 1.012; 95% CI, ) 는환자군과대조군에서차이를보이지않았다. C2259G 의 CC, CG (OR, 0.619; 95% CI, ), GG는환자군과대조군에서차이를보이지않았다. 관상동맥질환환자에서 C2259G의 GG, CG (AMI, OR, 0.880, 95% CI, ; UA, OR, 0.885, 95% CI, ; SA, OR, 1.156, 95% CI, ), CC는급성심근경색, 불안정성협심증, 안정성협심증및각대조군에서차이를보이지않았다. C647G의 GG, CG (AMI, OR, 1.351, 95% CI, to 2.497; UA, OR, 1.292, 95% CI, to 2.309; SA, OR, 0.977, 95% CI, to 1.803), CC (AMI, OR, 0.355, 95% CI, to 1.358; UA, OR, 0.645, 95% CI, to 2.028; SA, OR, 0.385, 95% CI, to 1.311) 는급성심근경색, 불안정성협심증, 안정성협심증및각대조군에서차이를보이지않았다. A1622G의 AA, AG (AMI, OR, 1.416, 95% CI, ; UA, OR, 1.079, 95% CI, ; SA, OR, 0.958, 95% CI, ), GG (AMI, OR, 0.525, 95% CI, ; UA, OR, 0.568, 95% CI, ; SA, OR, 0.441, 95% CI, ) 는급성심근경색, 불안정성협심증, 안정성협심증및각대조군에서차이를보이지않았다. 결론 : P2Y1 유전자단일염기다형성은허혈성혈관질환환자와대조군사이에서유의한차이를보이지않았다. 참고문헌 1) Rauch U, Osende JI, Fuster V, Badimon JJ, Fayad Z, Chesebro JH. Thrombus formation on atherosclerotic plaques: pathogenesis and clinical consequences. Ann Intern Med 2001;134: ) Hetherington SL, Singh RK, Lodwick D, Thompson JR, Goodall AH, Samani NJ. Dimorphism in the P2Y1 ADP receptor gene is associated with increased platelet activation response to ADP. Arterioscler Thromb Vasc Biol 2005;25: ) Yamada S, Akita H, Kanazawa K, et al. T102C polymorphism of the serotonin (5-HT) 2A receptor gene in patients with non-fatal acute myocardial infarction. Atherosclerosis 2000;150: ) Kim GY. Genetic polymorphism of a platelet glycoprotein IIIa as an inherited risk factor for coronary artery disease in Koreans. Korean Circ J 1997;27: ) Park S, Park HY, Park C, et al. Association of the gene polymorphisms of platelet glycoprotein Ia and IIb/IIIa with myocardial infarction and extent of coronary artery disease in the Korean population. Yonsei Med J 2004;45: ) Pyo MK, Yun-Choi HS, Hong YJ. Apparent heterogeneous responsiveness of human platelet rich plasma to catecholamines. Platelets 2003;14: ) Kambayashi J, Shinoki N, Nakamura T, et al. Prevalence of impaired responsiveness to epinephrine in platelets among Japanese. Thromb Res 1996;81: ) Yun-Choi HS, Park KM, Pyo MK. Epinephrine induced platelet aggregation in rat platelet-rich plasma. Thromb Res 2000;100: ) Kim PJ, Chang K, Koh YS, et al. Functional polymorphism in the promoter region of matrix metalloproteinase-9 is strongly associated with acute myocardial infarction. Korean Circ J 2005;35: ) Jung CH, Rhee EJ, Kim SY, et al. Association between two SNPs (+45T>G and +276G>T) of the adiponectin gene and coronary artery diseases. Korean J Med 2006;70: ) Kim JM, Lee YY, Koo YK, et al. Association between
8 76 Korean J Hematol Vol. 43, No. 2, June, 2008 platelet polymorphism and cardiovascular diseases in the Korean population. In: 15th Congress of the Korean Society on Thrombosis and Hemostasis; : The Korean Journal of Thrombosis and Hemostasis; 2005;12: ) Di Castelnuovo A, de Gaetano G, Donati MB, Iacoviello L. Platelet glycoprotein receptor IIIa polymorphism PLA1/PLA2 and coronary risk: a meta-analysis. Thromb Haemost 2001;85: ) Santoso S, Kunicki TJ, Kroll H, Haberbosch W, Gardemann A. Association of the platelet glycoprotein Ia C807T gene polymorphism with nonfatal myocardial infarction in younger patients. Blood 1999;93: ) Gonzalez-Conejero R, Lozano ML, Rivera J, et al. Polymorphisms of platelet membrane glycoprotein Ib alpha associated with arterial thrombotic disease. Blood 1998;92: ) Durante-Mangoni E, Davies GJ, Ahmed N, Ruggiero G, Tuddenham EG. Coronary thrombosis and the platelet glycoprotein IIIA gene PLA2 polymorphism. Thromb Haemost 1998;80: ) Goldschmidt-Clermont PJ, Cooke GE, Eaton GM, Binkley PF. PlA2, a variant of GPIIIa implicated in coronary thromboembolic complications. J Am Coll Cardiol 2000;36: ) Wagner KR, Giles WH, Johnson CJ, et al. Platelet glycoprotein receptor IIIa polymorphism P1A2 and ischemic stroke risk: the stroke prevention in young women study. Stroke 1998;29: ) Rolf MG, Brearley CA, Mahaut-Smith MP. Platelet shape change evoked by selective activation of P2X1 purinoceptors with alpha, beta-methylene ATP. Thromb Haemost 2001;85: ) Foster CJ, Prosser DM, Agans JM, et al. Molecular identification and characterization of the platelet ADP receptor targeted by thienopyridine antithrombotic drugs. J Clin Invest 2001;107: ) Woulfe D, Yang J, Brass L. ADP and platelets: the end of the beginning. J Clin Invest 2001;107: ) MacKenzie AB, Mahaut-Smith MP, Sage SO. Activation of receptor-operated cation channels via P2X1 not P2T purinoceptors in human platelets. J Biol Chem 1996;271: ) Léon C, Hechler B, Freund M, et al. Defective platelet aggregation and increased resistance to thrombosis in purinergic P2Y(1) receptor-null mice. J Clin Invest 1999;104: ) Fontana P, Gaussem P, Aiach M, Fiessinger JN, Emmerich J, Reny JL. P2Y12 H2 haplotype is associated with peripheral arterial disease: a case-control study. Circulation 2003;108: ) Huo Y, Ley KF. Role of platelets in the development of atherosclerosis. Trends Cardiovasc Med 2004;14: ) Fontana P, Dupont A, Grandrille S, et al. Adenosine diphosphate-induced platelet aggregation is associated with P2Y12 gene sequence variations in healthy subjects. Circulation 2003;108:
Lumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information(Microsoft PowerPoint - CXBTUEOAPVQY.ppt [\310\243\310\257 \270\360\265\345])
당뇨병환자에서항혈소판제사용 - 아스피린일차예방을중심으로 - 경희대학교강동경희대병원 황유철 말씀드릴내용 당뇨병및심혈관질환의역학 아스피린의심혈관질환 1차, 2차예방효과 아스피린부작용및용량에따른효과차이 당뇨병환자에서아스피린사용의적응증 사망원인순위, 2010 년 25.6% 통계청 심혈관질환에의한의료비추세 6 조 1400 억 국민건강보험공단, 2002-2009 Multidisciplinary
More informationTreatment and Role of Hormaonal Replaement Therapy
Treatment and Role of Hormone Replacement Therapy Chung-Ang University Hospital Chee Jeong Kim 7.2 5.3 6.4 5.6 7.3 5.5 1 1 2 3 4 10 11 7 34 49 122 123 1.0 - - 10. 2001 1998 1998 Improvement of postmenopausal
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information(Microsoft PowerPoint - S13-3_\261\350\273\363\307\366 [\310\243\310\257 \270\360\265\345])
Cardiovascular Disease in Metabolic Syndrome 김상현 보라매병원내과 서울대학교의과대학내과학교실 Contents Metabolic syndrome and Cardiovascular system CVD Mortality Coronary artery disease Heart failure Atrial fibrillation Management
More information저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
More information패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer
READY-TO-WEAR Fashionbiz 2010.1 패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 1 2 3 4 5 6 7 8 9 9 2010.1 Fashionbiz
More informationY 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More informationAbstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
More information노인정신의학회보14-1호
제14권 1호 통권 제23호 www.kagp.or.kr 발행인 : 정인과 / 편집인 : 이동우 / 발행처 : 정인과 (152-703) 서울특별시 구로구 구로동 80번지 고려대학교 구로병원 정신과 / TEL : 02-818-6608 / FAX : 02-852-1937 발행일 : 2008년 4월 30일 / 제 작 : (주)엠엘커뮤니케이션 140-846 서울특별시
More informationIL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) l l l α β α β β α β β α β 목적 (Background/Aims): 위암의가족력과 Helicobacter pylori 감염은각각위암발생의위험인자로알려져있으나,
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information노영남
Purpose: Delayed massive hemorrhages from pseudoaneurysm rupture of the peripancreatic large arteries, after pancreaticoduodenectomy, are fatal. We reviewed the clinical course and outcome of bleeding
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More information?
http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~ Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교
충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~5 2017 Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교의과대학마취통증의학교실, 의학연구소 (28644), happycat19@hanmail.net
More information590호(01-11)
T H E K O R E A N D O C T O R S W E E K L Y www.docdocdoc.co.kr I N S I D E 38 3 5 6 7 10 13 28 29 30 31 38 41 42 2 Advertisement Government & Medicine 3 Government & Medicine 4 Government & Medicine Government
More information44-4대지.07이영희532~
A Spatial Location Analysis of the First Shops of Foodservice Franchise in Seoul Metropolitan City Younghee Lee* 1 1 (R) 0 16 1 15 64 1 Abstract The foodservice franchise is preferred by the founders who
More information°ø±â¾Ð±â±â
20, 30, 40 20, 30, 40 1 2 3 4 5 6 7 8 9 10 3.1 6.3 9.4 12.6 15.7 18.8 22.0 25.1 28.3 31.4 2.4 4.7 7.1 9.4 11.8 14.1 16.5 18.8 21.2 23.6 7.1 14.1 21.2 28.3 35.3 42.4 49.5 56.5 63.6 70.7 5.9 11.9 17.8 23.7
More information<31312D30362D C2F7C0E7B0FC2DC1B6C8F1BFB D37342E687770>
원저 급성뇌경색환자에서 Atorvastatin 20 mg 투여후 high sensitive C-reactive protein 의변화 동아대학교의과대학신경과학교실 Hee-Young Jo, M.D., Min-Jung Park, M.D., Jae-Kwan Cha, M.D. Department Neurology, College of Medicine, Dong-A University
More information황지웅
Comparison of Laparoscopy and Exploration in the Distal Pancreatectomy BACKGROUND: To determine the benefits of laparoscopic surgery compared with exploration, the clinical outcomes of open and laparoscopic
More information2014_........pdf
1, 1, 2, 1 (1, 2 ) Jin Suk Suh 1, Jong In Kim 1, Ryeong Jae Park 2, Sang Bum Park 1 (1 Korea Forest Research Institute, 2 Korea Traditional Dye Institute) Introduction (2011-2013), (VOCs)., (7 ),,. Materials
More informationJkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More information???춍??숏
Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY
More information저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
More information433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
More informationuntitled
대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More informationJkafm093.hwp
가정의학회지 2004;25:721-739 비만은 심혈관 질환, 고혈압 및 당뇨병에 각각 위험요인이고 다양한 내과적, 심리적 장애와 연관이 있는 질병이다. 체중감소는 비만한 사람들에 있어 이런 위험을 감소시키고 이들 병발 질환을 호전시킨다고 알려져 있고 일반적으로 많은 사람들에게 건강을 호전시킬 것이라는 믿음이 있어 왔다. 그러나 이런 믿음을 지지하는 연구들은
More information(01) hwp
Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of
More informationFluoroscopic anatomy for supraventricular tachycardia ablation Hui-Nam Pak, MD, PhD Division of Cardiology, Yonsei Cariovascular Center and Cardiovascular Research Institute, Yonsei University College
More information00약제부봄호c03逞풚
경희대학교 동서신의학병원 약품 정보지 2 0 0 7. S P R I N G. V O L. 0 1 신약 소개 02 Journal Review 03 Special Subject 04 복약 지도 06 의약품 안전성 정보 07 약제부 알림 07 약제부 업무 소개 08 E A S T - W E S T N E O M E D I C A L C E N T E R 본 약품
More informationKbcs002.hwp
Does Real-time Compound Imaging Improve Evaluation of reast Cancer Compared to Conventional Sonography? o Kyoung Seo, M.D., Yu Whan Oh, M.D., Kyu Ran Cho, M.D., Young Hen Lee, M.D., Hyung Joon Noh, M.D.,
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information<31382D322D3420BDC5B1D4C8AF5FB3EDB9AE28C3D6C1BEBABB292E687770>
醫 史 學 제18권 제2호(통권 제35호) 2009년 12월 Korean J Med Hist 18ː57 72 18ː173-188 Dec. Dec. 2009 2009 C 大 韓 醫 史 學 會 ISSN ISSN 1225 505X 1225-505X 지방병 연구와 식민지배 : 1927년 영흥 및 해남지역 에메틴 중독사건을 중심으로 신 규 환* 1. 머리말 2. 일제의
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More information<313120B9DABFB5B1B82E687770>
한국민족문화 40, 2011. 7, 347~388쪽 1)중화학공업화선언과 1973년 공업교육제도 변화* 2)박 영 구** 1. 머리말 2. 1973년, 중화학공업화선언과 과학기술인력의 부족 3. 1973년 전반기의 교육제도 개편과 정비 1) 계획과 개편 2) 기술교육 개선안과 인력개발 시책 4. 1973년 후반기의 개편과 정비 5. 정비된 정규교육제도의 특징
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: * The
Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.243-268 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.243 * - 2001 2015 - The Research Trends on Peer Counseling in Elementary and
More information목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적
用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure
More informationKinematic analysis of success strategy of YANG Hak Seon technique Joo-Ho Song 1, Jong-Hoon Park 2, & Jin-Sun Kim 3 * 1 Korea Institute of Sport Scienc
Kinematic analysis of success strategy of technique JooHo Song 1, JongHoon Park 2, & JinSun Kim 3 * 1 Korea Institute of Sport Science, 2 Catholic Kwandong University, 3 Yonsei University [Purpose] [Methods]
More information( )Kjhps043.hwp
Difference of Fistula Maturation Degree and Physical Property by the Types of Tube Material: An Experimental Study Sang Koo Kang, M.D. 1, Hee Chul Yu, M.D. 1,4, Woo Sung Moon, M.D. 2,4, Ju Hyoung Lee,
More information서론
- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - -
More informationECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More information7.ƯÁýb71ÎÀ¯È« š
J KMA Special Issue Myelodysplastic Syndrome June Won Cheong, MD Yoo Hong Min, MD Department of Internal Medicine, Yonsei University College of Medicine E mail : jwcheong70@yumc.yonsei.ac.kr minbrmmd@yumc.yonsei.ac.kr
More informationAnalysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
More informationuntitled
대한마취과학회지 2008; 55: 190~6 Korean J Anesthesiol Vol. 55, No. 2, August, 2008 임상연구 대한민국의 마취통증의학 임상실습 현황 연세대학교 의과대학 마취통증의학교실 및 마취통증의학연구소 장동진ㆍ안소운ㆍ안지원ㆍ김종훈 The current status of anesthesiology clerkship in Korea
More information<31372DB9DABAB4C8A32E687770>
김경환 박병호 충북대학교 도시공학과 (2010. 5. 27. 접수 / 2011. 11. 23. 채택) Developing the Traffic Severity by Type Kyung-Hwan Kim Byung Ho Park Department of Urban Engineering, Chungbuk National University (Received May
More information±èÇ¥³â
533 Fig. 1. Dead zone. Nine echoes are positioned 2-10 mm below the scan surface with 1 mm distance. All nine echoes are clearly visualized. 534 Fig. 2. Vertical and horizontal measurement. 10 cm distance
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More informationAbstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
More information388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR
6 3 2000 ; 387-392 (3) Dysplastic Nodule Young Nyun Park, M.D., Chanil Park, M.D. Department of Pathology, Yonsei University College of Medicine BRIEF HISTORY 56. AST/ALT 72/73 IU/L, total bilirubin 0.7
More informationexample code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for
2003 Development of the Software Generation Method using Model Driven Software Engineering Tool,,,,, Hoon-Seon Chang, Jae-Cheon Jung, Jae-Hack Kim Hee-Hwan Han, Do-Yeon Kim, Young-Woo Chang Wang Sik, Moon
More information<C1A63534C8B820BCBCB9CCB3AA2DC6EDC1FD2E687770>
C-II. 안전하고 완전한 대장내시경을 위하여 Room C 김 지 원 서울대학교 의과대학 내과학교실, 서울특별시 보라매병원 내과 Difficult Colonoscopy: How to Overcome? Ji Won Kim Department of Internal Medicine, Seoul National University oramae Hospital, Seoul
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
More information<5BB0F8B0F8BFECC6ED5D20C3D6C1BEBAB8B0EDBCAD5F3132313628BFCF292E687770>
전국우편지부 노동자의 노동환경과 건강실태 연구보고서 2013년 12월 공공운수노조 전국우편지부 / 한국노동안전보건연구소 사회진보연대 부설 노동자운동연구소 제 출 문 공공운수노조 전국우편지부가 한국노동안전보건연구소와 사회진보연대 부설 노동자운동연구소에 의뢰한 전국우편지부 노동자의 노동환경과 건강실태 연구보고서 의 결과로 본 보고서를 제출합니다. 2013년 12월
More informationabstract.dvi
통계자료분석 강희모 2014년 5월 14일 목차 제 1장 여러가지평균비교 1 1.1. 단일표본검정.............................. 2 1.2. 독립인두표본검정........................... 4 1.3. 대응표본검정.............................. 9 제 2 장 분산분석(ANalysis Of VAriance)
More informationRisk of Developing Hypertension by Daily Intake of Alcohol
JNC 7 ESH/ESC (Guidelines) Guidelines 2003. 5 JNC 7 Guidelines ; The Seventh Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure JAMA. 2003;289:2560-2572.
More information表紙(化学)
수험 번호 성 명 2013년 일본 공과대학 학부 유학생 파견 선발 시험 화 학 (90분 100점) 주 의 1 시험시작의 지시가 있을 때까지 열지 마시오. 2 해답은 해답용지의 지정된 난 안에 알아보기 쉽게 기입하시오. 3 해답에 한글이 포함되면 채점되지 않습니다. 필요한 경우, 아래의 값을 사용하시오. 원자량 H 1.0, C 12, N 14, O 16, Cu
More information당뇨병 치료제 개발 연구 (무병장수를 위한 신약개발연구) Jin Hee Ahn 2008. 09. 26 한국화학연구원 KBS YTN TJB MBC 대덕 특구 기술 사업화 연구원부문 대상 2007년 12월 14일 당뇨병 치료제 개발 연구 (무병장수를 위한 신약개발연구) 생체기능조절물질개발사업단 신약연구단 화학연구원 신약연구단 글로벌 신약 글로벌 신약 전임상 후보물질의
More information歯14.양돈규.hwp
: The Korean Journal of Counseling and Psychotherapy 2003. Vol. 15, No. 3, 615-631. 1 2 3 1,410.,, ( ),., ( 69%),.,, ( ), ( ).,,.., ( ).,. :,,. :, (390-711) 21-1, : 043-649-1362 E-mail : ydk9498@hanmail.net
More information09구자용(489~500)
The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More information637
Peripheral Arterial Disease Yong Bok Koh, M.D. Department of General Surgery The Catholic University of Korea, College of Medicine, Kangnam St. Mary s Hospital E mail : ybkoh@catholic.ac.kr Abstract Peripheral
More informationV V V α Azam, M. Z. M. & Park, Dong-Ho (2012). The relationship between Digit Ratio(2D:4D) and Physical Fitness in Children. Journal of Korean Society of Living Environmental System, 19(1), 101-110.
More informationJkcs022(89-113).hwp
대한배뇨장애 및 요실금 학회지 J. Korean Continence Society 2004;8:89-113 Bristol Female Lower Urinary Tract Symptom 설문지의 한국어 번역 및 번역본의 언어 타당도 Seung-June Oh*, Hyung Geun Park*, Sung Hyun Paick, Won Hee Park and Myung-Soo
More information목원 한국화- 북경전을 준비하며 지난해부터 시작 된 한국의 목원대학교 한국화 전공의 해외미술체험은 제자와 스승의 동행 속에서 미술가로 성장하는 학생들의 지식에 샘을 채워주는 장학사업으로 진행되고 있으며, 한국의 우수한 창작인력 양성을 위해, 배움을 서로 나누는 스승들의
K o r e a n P a i n t i n g F i n e A r t s D e p t. A r t C o l l e g e M o k w o n U n i v e r s i t y 목원대학교 미술대학 한국화전공 우수창작인력양성 특성화장학생-제2차 해외미술체험 陌生的眼神看 展ː 望 목 원 한 국 화 -Beijing을 걷다- Korean Painting
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 4, pp DOI: * A Study on Teache
Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp.149-171 DOI: http://dx.doi.org/10.21024/pnuedi.27.4.201712.149 * A Study on Teachers and Parents Perceptions on the Introduction of Innovational
More informationEffects of baseball expertise and stimulus speeds on coincidence-anticipation timing accuracy of batting Jong-Hwa Lee, Seok-Jin Kim, & Seon-Jin Kim* Seoul National University [Purpose] [Methods] [Results]
More information진단, 표시・광고법 시행 1년
진단, 표시 광고법 시행 1년 표시 광고규제 법규는 통합되어야 한다! 정은종 호텔롯데 경영지원실/지적재산권법 석사 표시광고법 시행 1년 입법과정에서 많은 논란이 있었던 표시광고법이 제정되어 시행( 99년 7월)된지 벌써 1년이 지났다. 공정거래법 23조1항6호의 부 당표시광고 규정이 분가하여 탄생한 표시광고법은 기존 공정거래법이 부당표시광고(허위 과장, 기만,
More information심장2.PDF
(Treatment of Hypertension with Associated Diseases) 1.. (140/90 mmhg). 80 mmhg. ( ). (atenolol ), (amlodipine ) 1. -1 nitrate. ACE diltiazem, verapamil. ACE. ( )., ACE diltiazem,, diltiazem, verapamil.
More information16(1)-3(국문)(p.40-45).fm
w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University
More informationA Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
More informationÀå¾Ö¿Í°í¿ë ³»Áö
Disability & Employment 55 Disability & Employment 56 57 Disability & Employment 58 59 Disability & Employment 60 61 Disability & Employment 62 63 Disability & Employment 64 65 Disability & Employment
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI: 3 * Effects of 9th
Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp.357-378 DOI: http://dx.doi.org/10.21024/pnuedi.29.2.201906.357 3 * Effects of 9th Grade Students Participation in Career Curriculum Cluster
More information연구분야 ( 코드 ) 과제번호 과제성격 ( 기초, 응용, 개발 ) 응용실용화대상여부비실용화 연구과제명 과제책임자 세부과제 지원목적과제프로그램공개가능여부공개 ( 공개, 비공개 ) ( 국문 ) 전장유전체유전자다형데이터를이용한표적유전자의발굴 ( 영문 ) Ide
연구분야 ( 코드 ) 과제번호 1210360 과제성격 ( 기초, 응용, 개발 ) 응용실용화대상여부비실용화 연구과제명 과제책임자 세부과제 지원목적과제프로그램공개가능여부공개 ( 공개, 비공개 ) ( 국문 ) 전장유전체유전자다형데이터를이용한표적유전자의발굴 ( 영문 ) Identification of disease-related target genes through
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More informationKaes010.hwp
갑상선자극호르몬이갑상선암세포의 VEGF, 신생혈관형성, 성장, 침윤및전이에미치는영향 Effects of TSH on the Production of VEGF, Angiogenesis, Growth, Invasion and Metastasis in Thyroid Cancer Cells Euy Young Soh, M.D., Hee Boong Park, M.D.,
More information<BFACBCBCC0C7BBE7C7D02831302031203139292E687770>
延 世 醫 史 學 제12권 제2호: 29-40, 2009년 12월 Yonsei J Med Hist 12(2): 29-40, 2009 특집논문 3 한국사회의 낙태에 대한 인식변화 이 현 숙 이화여대 한국문화연구원 1. 들어가며 1998년 내가 나이 마흔에 예기치 않은 임신을 하게 되었을 때, 내 주변 사람들은 모두 들 너무나도 쉽게 나에게 임신중절을 권하였다.
More information<303720C7CFC1A4BCF86F6B2E687770>
1) < 論 文 > 라이프스타일 세분화를 통한 실버타운 수요자 분석 133 주택연구 제15권 4호 2007. 12/15(4) : 133~160 Housing Studies Review Vol. 15, No. 4 : 133~160 접수일 : 2007. 7. 9, 심사일 : 2007. 7. 16, 심사완료일 : 2007. 8. 29 라이프스타일 세분화를 통한 실버타운
More information12이문규
Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con
Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency
More informationJkbcs032.hwp
Clinical Correlation of HER-2/neu Overexpression in Patients with Breast Cancer Sung Yong Kim, Tae Yoon Kim, Jae Jun Kim, Chang Ho Kim, Ok Pyung Song, Min Hyuk Lee, Eui Han Kim 1, and Moo Sik Cho Departments
More information농림수산식품 연구개발사업 운영규정
- 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 - - 27 - - 28 - 1. - 29 - - 30 - - 31 - -
More information., (, 2000;, 1993;,,, 1994), () 65, 4 51, (,, ). 33, 4 30, 23 3 (, ) () () 25, (),,,, (,,, 2015b). 1 5,
* 4.,, 3,,, 3,, -., 3, 12, 27, 20. 9,,,,,,,,. 6,,,,,. 5,,,,.. * (2016),. (Corresponding Author): / / 303 Tel: 063-225-4496 / E-mail: jnj1015@jj.ac.kr ., (, 2000;, 1993;,,, 1994), 2000. 2015 () 65, 4 51,
More information석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
More informationuntitled
Korean J Fam Pract. 2014;4:315-320 ABO 혈액형과뇌경색간의관련성 Original Article 김동규, 방준호, 이준용, 전태희 *, 정영진, 김혜진, 문나연 중앙보훈병원가정의학과 An Association between ABO Blood Type and Ischemic Stroke Dong-Kyu Kim, Jun-Ho Bang,
More information