VHS 및 RSIVD 모니터링 177 al., 2001) (World Organization for Animal Health, OIE). VHSV Rhabdoviridae Novirhabdovirus RNA 6 gene nucleocapsid protein (N), p
|
|
- 광현 설
- 5 years ago
- Views:
Transcription
1 한수지 49(2), , 2016 Original Article Korean J Fish Aquat Sci 49(2), , 년제주도양식넙치 (Paralichthys olivaceus) 를대상으로한 VHS 및 RSIVD 모니터링 박현경 전려진 1 김승민 박명애 2 조미영 2 황성돈 2 박신후 2 정현도 3 정준범 * 제주대학교해양의생명과학부, 1 제주대학교수산백신연구센터, 2 국립수산과학원수산생물방역과, 3 부경대학교수산생명의학과 Monitoring of VHS and RSIVD in Cultured Paralichthys olivaceus of Jeju in 2015 Hyun Kyung Park, Lyu Jin Jun 1, Seung Min Kim, Myoung Ae Park 2, Mi Young Cho 2, Seong Don Hwang 2, Shin Hoo Park 2, Hyun Do Jeong 3 and Joon Bum Jeong* Faculty of Marine Biomedical Science, Jeju National University, Jeju 63243, Korea 1 Fish Vaccine Resarch Center, Jeju National University, Jeju 63333, Korea 2 Aquatic Life Disease Control Division, National Fisheries Research & Development Institute, Busan 46083, Korea 3 Department of Aquatic Life Medicine, Pukyong National University, Busan 48513, Korea In this study, disease surveillance was performed to monitor the prevalence of viral haemorrhagic septicaemia virus (VHSV) and red seabream iridovirus (RSIV) in olive flounder, Paralichthys olivaceus in The fish samples were collected in March (60 farms), May (55 farms) and July (52 farms) from different farms in Jeju. Reverse transcription polymerase chain reaction (RT-PCR) (VHSV) or PCR (RSIV) results showed that VHSV detected in 2 farms, but RSIV has not been detected in any farms. The sequences of the nucleocapsid protein (N) and glycoprotein (G) gene of the 2 VHSV isolates were successfully sequenced. Phylogenetic analysis was included VHSV isolates reported here together with a representative VHSV isolates available in GenBank. Phylogenetic analysis indicated that most of Korea VHSV isolates were closely related to the Japan and China genotype Ⅳa which is clearly distinct from the North American genotype Ⅳb. Key words: Paralichthys olivaceus, VHSV, RSIV, Nucleocapsid protein, Glycoprotein 서론 (Paralichthys olivaceus) 50%,. red seabream iridovirus (RSIV), lymphocystis disease virus (LCDV) DNA viral haemorrhagic septicaemia virus (VHSV), viral nervous necrosis virus (VNNV), hirame rhabdovirus (HRV), marine birnavirus (MABV) RNA, VHSV RSIV (Cho et al., 2010). VHSV (Oncorhynchus mykiss), (Mortensen et al., 1999) (Takano et al., 2000; Isshiki et Korean J Fish Aquat Sci 49(2) , April 2016 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial Licens ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Received 4 October 2015; Revised 27 January 2016; Accepted 19 March 2016 *Corresponding author: Tel: Fax: address: jeongjb@jejunu.ac.kr Copyright 2016 The Korean Society of Fisheries and Aquatic Science 176 pissn: , eissn:
2 VHS 및 RSIVD 모니터링 177 al., 2001) (World Organization for Animal Health, OIE). VHSV Rhabdoviridae Novirhabdovirus RNA 6 gene nucleocapsid protein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), non-structural protein (NV) RNA polymerase (L) (Schutze et al., 1999). Snow et al. (1999) Lumsden et al. (2007) VHSV N G 4 genotype, Genogroup (European freshwater and sea fish), Genogroup (British Isles), Genogroup (North Atalantic and North America), Genogroup (Pacific coast, Atlantic, Great Lakes, Japan and Korea) 4 (Einer- Jensen et al., 2004; Dale et al., 2009; Kim et al., 2011). RSIV 1990 (Pagrus major),,, (Inouye et al., 1992; Matsuoka et al., 1996). RSIV 1990 (Oplegnathus fasciatus), (Do et al., 2005). RSIV Megalocytivirus, 4 subgroups, subgroup RSIV, subgroup RBIV, subgroup (Siniperca scherzeri) ISKNV, subgroup (P. olivaceus) turbot(scophthalmus maximus) TRBIV (He et al., 2001; Do et al., 2004; Shi et al., 2004). VHS RSIVD. 실험어 재료및방법 ( / ) (60 ), 5 (55 ), 7 (52 ) (Paralichthys olivaceus), VHSV RSIV. Primer RSIV ( 84 ) RSIVD primer set PCR (Table 1). VHSV Primers N-gene 444 bp forward primer (5 -GAGAGA- ACTGGCCCTGACTG-3 ) reverse primer (5 -ATGATCC- GTCTGGCTGACTC-3 ) Cho et al. (2007), G-gene 1,340 bp forward primer (5 -ACAGAT- CACTCAACGACCTC-3 ) reverse primer (5 -ATAGTGA CGGCCAAAGA CTC-3 ) full length open reading frames (ORFs) PCR (Table 1). DNA 추출 RSIV, DNeasy Blood & Tissue Kit (Qiagen Hilden, Germany) total DNA. 10 mg ATL buffer 180 L proteinase K 20 L 56., AL buffer 200 L ethanol 200 L spin column 6,000 g 1. Column tube AW1 buffer 500 L AW2 buffer 500 L, AE buffer 50 L DNA. DNA -20. Table 1. PCR conditions and primer sequences for the detection of virus from the olive flounder Paralichthys olivaceus of Korea Target¹ Oligonucleotide sequence (5'-3') PCR condition Product size (bp) F GAGAGAACTGGCCCTGACTG N gene VHSV-N 94 (30")-55 (45")-72 (45") 444 R ATGATCCGTCTGGCTGACTC F ACAGATCACTCAACGACCTC G gene VHSV-G 94 (30")-52 (30")-72 (1') 1,340 R ATAGTGACGGCCAAAGACTC F CTCAAACACTCTGGCTCATC RSIV 94 (30")-58 (60")-72 (60") 570 R GCACCAACACATCTCCTATC ¹VHSV, viral haemorrhagic septicaemia virus; RSIV, red seabream iridovirus.
3 178 박현경ㆍ전려진ㆍ김승민ㆍ박명애ㆍ조미영ㆍ황성돈ㆍ박신후ㆍ정현도ㆍ정준범 RNA 추출및 cdna 합성 VHS, Viral RNA Mini kit (Qiagen Hilden, Germany) RNA. 10 mg nuclease freewater 140 L homogenizer. AVL buffer 560 L 15 10, ethanol 560 L spin column 6,000 g 1. Column tube AW1 buffer 500 L AW2 buffer 500 L, AE buffer 30 L Table 2. VHSV isolates used in this study for comparison of N gene Virus isolate Year Origin Host fish Genotype GenBank accession No. 15-E03(SW) 2015 Korea Olive flounder Ⅳa unpublished 15-E03(SD) 2015 Korea Olive flounder Ⅳa unpublished US-mak-wa USA Coho salmon Ⅳa X59241 JF00Ehil-JPN 2000 Japan Olive flounder Ⅳa AB KRRV9822-JPN 1998 Japan Olive flounder Ⅳa AB CA-NS Canada Brown trout Ⅳb HQ CA-NB04-01b 2007 Canada Brown trout Ⅳb HQ MI03GL 2006 USA Muskellunge Ⅳb DQ JUL USA Muskellunge Ⅳb GQ CA-NB Canada Brown trout Ⅳb EF ON USA Diporeia spp. Ⅳb HQ SE-SVA Sweden Rainbow trout Ⅰb GQ SE-SVA Sweden Rainbow trout Ⅰb FJ UKMLA98/6HE Britain Rainbow trout Ⅰb GQ DK-1p Denmark Rainbow trout Ⅰb GQ DK-5e Denmark Rainbow trout Ⅰb GQ Britain Atlantic herring Ⅰb AF Cod-Ulcus 1979 Denmark Atlantic cod Ⅰb Z93414 DK-4p North sea Rainbow trout Ⅰb FJ FR France Rainbow trout Ⅰa D France Rainbow trout Ⅰa AJ Fil Germany Rainbow trout Ⅰa Y18263 DE-Fil3-wt 1983 Germany Rainbow trout Ⅰa X73873 DK-3592B 1997 Denmark Rainbow trout Ⅰa AF KV Norway Rainbow trout Ⅲ FJ BV Norway Rainbow trout Ⅲ FJ FA Norway Rainbow trout Ⅲ EU FS V 2010 Norway Rainbow trout Ⅲ GU FS S 2010 Norway Rainbow trout Ⅲ GU V Norway Rainbow trout Ⅲ FJ / Scotland Turbot Ⅱ AJ F Ireland Turbot Ⅱ AJ p Skagerrak Whiting Ⅱ AJ H17/2/ North sea Haddock Ⅱ AJ H16/7/ North sea Cod Ⅱ AJ p Skagerrak Norway pout Ⅱ AJ130917
4 VHS 및 RSIVD 모니터링 179 RNA. RNA -20. RT-PCR 3 L viral RNA, 4 L 5 reaction buffer, 1 L reverse transcriptase, 1 L dntp, 1 L oligo (dt) primer 2.4 L MgCl 2 volume 20 L nuclease freewater, 25 5, 42 1, PCR 및 sequencing PCR microtube 1 M primer, 2.5 mm dntp, 10 G-Taq Buffer, 2.5 U G-Taq DNA polymerase (Gene Pro Themal Cycler Cosmo, Korea) template DNA distilled water PCR volume 20 L, PCR Table 1. PCR 1 TAE buffer (40 Mm Tris-acetate, 1 mm EDTA), 0.5 g/ L ethidium bromide 1% agarose gel, UV. PCR Gel purification kit (Bioneer, Korea), ToPo TA cloning kit (Invitrogen, USA) cloning, (Solgent, Korea). 계통학적분석 BioEdit program Clustal W (Thompson et al., 1994) GenBank N gene 34 (Table 2) G gene 19 (Table 3) alignment. Alignment MEGA program version 4.0 (Tamura et al., 2007) neighbor joining criteria. 결과및고찰 1980,,. VHS Table 3. VHSV isolates used in this study for comparison of G gene Virus isolate Year Origin Host fish Genotype GenBank accession No. 15-E03(SW) 2015 Korea Olive flounder Ⅳa unpublished 15-E03(SD) 2015 Korea Olive flounder Ⅳa unpublished CHN-PORV 2005 China Olive flounder Ⅳa KC JF00Ehil-JPN 2000 Japan Olive flounder Ⅳa AB JP990Obama Japan Olive flounder Ⅳa DQ Makah 1988 USA Coho salmon Ⅳa U28747 U Canada Drum Ⅳb HQ CA-NB Canada Mummichog Ⅳb EF CA-NS Canada Brown trout Ⅳb EF DK Denmark Rainbow trout Ⅰa AY DK Denmark Rainbow trout Ⅰa JF DK Denmark Rainbow trout Ⅰa JF DK Denmark Rainbow trout Ⅰa JF JP96KRRV Japan Rainbow trout Ⅰb DQ DK-6p Denmark Herring Ⅰb AY DK-1p Baltic sea Sprat Ⅱ AY DK-1p Baltic sea Herring Ⅱ AY DK-1p Baltic sea Sprat Ⅱ AY DK-4p Skagerrak Herring Ⅲ AY IR-F Ireland Turbot Ⅲ AY FR-L59X 1987 France Eel Ⅲ AY546618
5 180 박현경ㆍ전려진ㆍ김승민ㆍ박명애ㆍ조미영ㆍ황성돈ㆍ박신후ㆍ정현도ㆍ정준범 RSIVD,. 2 2, 3.3%., VHSV 3 2 (3.3%) (Fig. 1, Table 4), %. 15 cm, VHSV Kim et al. (2009). VHSV 3 15, (Kim et al., 2003). Fig. 1. Detection of the VHSV gene by RT-PCR using the N (lane 1-5) or G (lane 6-10) primer set. Lane 1 and 6, 15-E03(SW); Lane 2 and 7, 15-E03(SD); Lane 3 and 8, farm 1; Lane 4 and 9, farm 2; Lane 5 and 10, farm 3; M, 1 kb DNA ladder. Fig. 2. Phylogenetic tree showing the genetic relationships among 36 VHSVs based on the nucleotide sequences of the N gene. Phylogenetic analysis indicated that most of Korea VHSVs belong to the genotype Ⅳa. Bootstrap values were transferred to the original maximum likelihood tree derived from the actual data. The scale bar indicates the number of substitutions per nucleotide site. *indicates VHSV isolates in this study.
6 VHS 및 RSIVD 모니터링 181. RSIV (Cho et al., 2009), RSIV. RSIV, RSIV (Table 4), RSIV,, (data not shown). Park et al. (2015) Table 4. Distribution of virus infection in cultured olive flounder Paralichthys olivaceus in 2015 Virus Detection rate (%) (No. of positive / No. of farms) March May July VHSV 3.3(2/60) 0(0/55) 0(0/52) RSIV 0(0/60) 0(0/55) 0(0/52), RSIV 3,. Kim (2015) two-step RT-PCR VHSV a, VHSV N gene (444 bp) G gene (1,340 bp) primer set RT-PCR E03 (SW) 15-E03 (SD), N gene G gene N gene G gene primer set (Fig. 1). 2 VHSV GenBank 34 N gene 19 G gene. N gene, 2 Fig. 3. Phylogenetic tree showing the genetic relationships among 21 VHSVs based on the nucleotide sequences of the G gene. Phylogenetic analysis indicated that most of Korea VHSVs belong to the genotype Ⅳa. Bootstrap values were transferred to the original maximum likelihood tree derived from the actual data. The scale bar indicates the number of substitutions per nucleotide site. *indicates VHSV isolates in this study.
7 182 박현경ㆍ전려진ㆍ김승민ㆍ박명애ㆍ조미영ㆍ황성돈ㆍ박신후ㆍ정현도ㆍ정준범 genotype (Fig. 2). VHSV genotype a b subgroups, 2 VHSV genotype a (Snow et al., 1999; Einer-Jensen et al., 2004; Lumsden et al., 2007)., 2 (accession number: AB179621, AB490792) (Nishizawa et al., 2002), % (data not shown), genotype b (Fig. 2). G gene, 2 N gene (Fig. 3)., (accession number: KC685626) (accession number: AB490792, DQ401191) (Fig. 3),, % % (data not shown). VHS RSIVD, VHS.. 사사 2015 (R ),. References Cho MY, Kim MS, Kwon MG, Jee BY, Choi HS, Choi DL, Park GH, Lee CH, Kim JD, Lee JS, Oh YK, Lee DC, Park SH and Park MA Epidemiological study of bacterial diseases of cultured olive flounder, Paralichthys olivaceus from 2005 to 2006 in Korea. J Fish Pathol 20, Cho MY, Jee BY, Park GH, Lee CH, Lee DC, Kim JW, Park MS and Park MA Monitoring of fish pathogens in wild marine fish of Korean coastal offshore water in J Fish Pathol 22, Cho MY, Park GH, Jee BY and Kim JW Statistical data on fish virus of cultured olive flounder, Paralichthys olivaceus from 2005 to J Fish Pathol 23, Dale OB, Ørpetveit I, Lyngstad TM, Kahns S, Skall HF, Olesen NJ and Dannevig BH Outbreak of viral haemorrhagic septicaemia (VHSV) in seawater-farmed rainbow trout in Norway caused by VHS virus Genotype III. Dis Aquat Org 85, Do JW, Moon CH, Kim HJ, Ko MS, Kim SB, Son JH, Kim JS, An EJ, Kim MK, Lee SK, Han MS, Cha SJ, Park MS, Park MA, Kim YC, Kim JW and Park JW Complete genomic DNA sequence of rock bream iridovirus. Virol 325, j.virol Do JW, Cha SJ, Kim JS, An EJ, Lee NS, Choi JH, Lee CH, Park MS, Kim JW, Kim YC and Park JW Phylogenetic analysis of the major capsid protein gene of iridovirus isolates from cultured flounders Paralichthys olivaceus in Korea. Dis Aquat Org 64, Einer-Jensen K, Ahrens P, Forsberg R and Lorenzen N Evolution of the fish rhabdovirus viral haemorrhagic septicaemia virus. J Gen Virol 85, http;//dx.doi. org/ /vir He JG, Deng M, Weng SP, Li Z, Zhou SY, Long QX, Wang XZ and Chan SM Complete genome analysis of the mandarin fish infectious spleen and kidney necrosis iridovirus. Virology 291, viro Inouye K, Yamano K, Maeno Y, Nakajima K, Matsuoka M, Wada Y and Sorimachi M Inidovirus infection of cultured red seabream, Pagrus major. Fish Pathol 27, Isshiki T, Nishizawa T, Kobayashi T, Nagano T and Miyazaki T An outbreak VHSV (viral haemorrhagic septicaemia virus) infection in farmed Japanese flounder Paralichthys olivaceus in Japan. Dis Aquat Org 47, Kim HJ Validation of the sensitivities of one-step and two-step reverse-transcription PCR methods for detection of viral haemorrhagic cepticaemia virus (VHSV) Ⅳa isolates from cultured olive flounder in Korea. Aquaculture 448, /j.aquaculture Kim SM, Lee JI, Hong MJ, Park HS and Park SI Genetic relationship of the VHSV (viral haemorrhagic septicemia virus) isolated from cultured olive flounder, Paralichthys olivaceus in Korea. J Fish Pathol 16, Kim WS, Kim SR, Kim DW, Kim JO, Park MA, Kitamura SI, Kim HY, Kim DH, Han HJ, Jung SJ and Oh MJ An outbreak of VHSV (viral haemorrhagic septicaemia virus) infection in farmed olive flounder, Paralichthys olivaceus in Korea. Aquaculture 296, org/ /j.aquaculture Kim WS, Jung SJ, Kim JO, Kim DW, Kim JH and Oh MJ Genetic positioning of Korean viral haemorrhagic septicaemia virus (VHSV) from cultured and wild marine fishes. J Fish Pathol 24, jfp Lumsden JS, Morrison B, Yason C, Russell S, Yong K, Yaz-
8 danpanah A, Huber P, Al-Hussinee L, Stone D and Way K Mortality event in freshwater drum Aplodinotus grunniens from Lake Ontario, Canada, associated with viral haemorrhagic septicaemia virus, Type IV. Dis Aquat Org 76, Matsukoa S, Inonye K and Nakjima K Cultured fish species infected by red seabream iridoviral disease from 1991 to J Fish Pathol 31, Mortensen HF, Heuer OE, Lorenzen N, Otte L and Olesen NJ Isolation of viral haemorrhagic septicaemia virus (VHSV) from wild marine fish species in the Baltic Sea, Kattegat, Skagerrak and the North Sea. Virus Res 63, Nishizawa T, Iida H, Takano R, Isshiki T, Nakajima K and Muroga K Genetic relatedness among Japanese, American and European isolates of viral haemorrhagic septicaemia virus (VHSV) based on partial G and P genes. Dis Aquat Org 48, Park HK, Kim SM, Lee DW, Jun LJ and Jeong JB Monitoring of VHS and RSIVD in cultured Paralichthys olivaceus of Jeju in JFMSE 27, org/ /jfmse Schutze H, Mundt E and Mettenleiter TC. Complete genomic sequence of viral haemorrhagic septicaemia virus, a fish rhabdovirus. Virus Genes 19, Shi CY, Wang YG, Yang SL, Huang J and Wang QY The first report of an iridovirus-like agent infection in farmed turbot Scophthalmus maximus in China. Aquaculture 236, Snow M, Cunningham CO, Melvin WT and Kurath G Analysis of the nucleoprotein gene identifies distinct lineages of viral haemorrhagic septicaemia virus within the European marine environment. Virus Res 63, Takano R, Nishizawa T, Arimoto M and Muroga K Isolation of viral haemorragic septicaemia (VHSV) from wild Japanese flounder, Paralichthys olivaceus. Bull Eur Assoc Fish Pathol 20, Tamura K, Dudley J, Nei M and Kumar S Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24, Thompson JD, Higgins DG and Gibson TJ Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22, VHS 및 RSIVD 모니터링 183
338 김승민ㆍ전려진ㆍ박명애ㆍ정현도ㆍ정준범 viral hemorrhagic septicemia (VHS) Scuticocilate,, cm, 1-3.,,.,, cohabitation test. 실험어 재료및방법 2010 (E03), 2011 (E06),
한수지 48(3), 337-345, 2015 Original Article Korean J Fish Aquat Sci 48(3),337-345,2015 제주도여윔증상넙치 (Paralichthys olivaceus) 로부터분리한점액포자충의특성분석 김승민 전려진 1 박명애 2 정현도 3 정준범 * 제주대학교해양의생명과학부, 1 제주대학교수산백신연구센터, 2 국립수산과학원수산생물방역과,
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information한수지 47(5), , 2014 Original Article Kor J Fish Aquat Sci 47(5), ,2014 서해안천수만일대양식조피볼락 (Sebastes schlegeli) 의상피선충감염현황 서한길 서정수 류민경 이은혜 권세련 1
한수지 47(5), 603-610, 2014 Original Article Kor J Fish Aquat Sci 47(5),603-610,2014 서해안천수만일대양식조피볼락 (Sebastes schlegeli) 의상피선충감염현황 서한길 서정수 류민경 이은혜 권세련 1 강종순 2 노윤산 2 최혜승 정승희 한현자 * 국립수산과학원병리연구과, 1 선문대학교수산생명의학과,
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information42(3)-11(p ).fm
The Korean Journal of Microbiology, Vol. 42, No. 3, September 2006, p. 199-204 Copyright 2006, The Microbiological Society of Korea e ³ w ³ w Á Á½ Áx Á 1 Á 2, * w w w w w w e ³ ³ w p w. e ³ w ù š» 30 cm.
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information슬라이드 1
EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More information384 송해덕ㆍ박정수ㆍ권세련, (Groff et al., 1998).,. CyHV CyHV-2 primer,. 재료및방법 실험어 ( cm, g) 12 ( cm,
한수지 51(4), 383-388, 2018 Original Article Korean J Fish Aquat Sci 51(4),383-388,2018 국내양식금붕어 (Carassius auratus) 와수입진주린 (Carassius auratus) 에서 Cyprinid Herpesvirus 2 (CyHV-2) 의검출 송해덕 박정수 권세련 선문대학교수산생명과학과
More information°Ç°�°úÁúº´5-44È£ÃÖÁ¾
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More informationMain Title
2003 5140001 IMD WCY IMD 2003 (, 54 ), Competitiveness Valuation International, Inc. Korea Partner of IMD WCY jeong@cvikorea.net page 1 2003, Jin-Ho Jeong, CVI, Korea Partner of IMD +41-25-618-0251 Fax
More information한수지 51(1), 23-30, 2018 Original Article Korean J Fish Aquat Sci 51(1),23-30,2018 넙치 (Paralichthys olivaceus) 근육채취방법에따른 Kudoa septempunctata 진단효율비교 송준영
한수지 51(1), 23-30, 2018 Original Article Korean J Fish Aquat Sci 51(1),23-30,2018 넙치 (Paralichthys olivaceus) 근육채취방법에따른 Kudoa septempunctata 진단효율비교 송준영 정승희 1 최혜승 2 * 국립수산과학원남동해수산연구소, 1 국립수산과학원병리연구과, 2 국립수산과학원남해수산연구소
More information가자미식해의제조공정최적화 37., (Choi et al., 200).. 재료 재료및방법 (Verasper Jordan et Gilbert;, ), (, ), (, ) (, )., (, ), (, ), (, ), (, ), (, ), (, ). 가자미식해제조 (round
한수지 48(), 036-043, 205 Original Article Kor J Fish Aquat Sci 48(),036-043,205 반응표면분석법을이용한가자미 (Verasper moseri Jordan et Gilbert) 식해제조최적화 한대원 김덕기 한호준 조순영 2 * 강릉원주대학교식품과학과, 강릉원주대학교동해안해양생물자원연구센터, 2 강릉원주대학교식품가공유통학과
More information°Ç°�°úÁúº´6-2È£
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine
More informationAbstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
More information?
http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More informationDV690-N_KOR_110216.indd
P/NO : MFL63266772 3 1 4 1 5 7 1 2 3 4 5 6 7 6 1 7 7 r t y u i - - - -, 7 1, 8 1 1 3 6 8 10 11 13? 12 14 15 16 17 18 a 1 b B c d e f c/v g C/V h M i Z j z k l 2 4 5 7 9 m w/s/a/d n b o p x q [ ] } r?
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적
用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure
More informationDBPIA-NURIMEDIA
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic
More information패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer
READY-TO-WEAR Fashionbiz 2010.1 패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 1 2 3 4 5 6 7 8 9 9 2010.1 Fashionbiz
More informationK O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education
More information2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, )
Abstract Kim Dal-Rae, Kim Sun-Hyung* Dept. of Sasang Constitutional Medicine, College of Oriental Medicine, Kyung-Hee Univ. *Dept. of Sasang Constitutional Medicine, East-West Neo Medical Center, Kyung-Hee
More informationAbstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
More information82-01.fm
w y wz 8«( 2y) 57~61, 2005 J. of the Korean Society for Environmental Analysis p w w Á Á w w» y l Analysis of Influence Factors and Corrosion Characteristics of Water-pipe in Potable Water System Jae Seong
More information384 Research in Plant Disease Vol. 23 No. 4,, 1. (INSV),,, (vein clearing), (Tomato spotted wilt virus, TSWV),.,,,,,, (Brisco-McCann Hausbeck, 2016; S
식물병연구 Note Open Access Res. Plant Dis. 23(4) : 383-387 (2017) https://doi.org/10.5423/rpd.2017.23.4.383 First Report of Impatiens necrotic spot virus in Hoya carnosa in Korea 1 2 1 1 1 3 1 * 1, 2, 3 *Corresponding
More information<313430333033C6AFC1FD28C3E0B1B8292E687770>
스포츠와 물리학: 구기운동 안티-싸커 와 간접-축구 DOI: 10.3938/PhiT.23.005 이 인 호 Anti-soccer and Indirect Soccer 편성은 없다고 장담한다. 벨기에(FIFA 랭킹 11위), 러시아 (FIFA 랭킹 22위), 알제리(FIFA 랭킹 26위), 그리고 한국(FIFA 랭킹 61위)으로 이어지는 H조 편성 결과이다. 이
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More information<313630313032C6AFC1FD28B1C7C7F5C1DF292E687770>
양성자가속기연구센터 양성자가속기 개발 및 운영현황 DOI: 10.3938/PhiT.25.001 권혁중 김한성 Development and Operational Status of the Proton Linear Accelerator at the KOMAC Hyeok-Jung KWON and Han-Sung KIM A 100-MeV proton linear accelerator
More informationRheu-suppl hwp
Objective: This paper reviews the existing Korean medical and public health, and nursing academy articles on disease-specific and domain-specific quality of life, and provides recommendations for the universally
More information10(3)-09.fm
w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½
More information..........5-45..
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun
More information141(26) 20056 1930 19 () ( ( ) () () () ) 2) 1932 ()()3) 2 1) 1897519( ) ( ) () () () 4) ( ) 5) 6) 15-20 7) 191216 2) ( ) () 42 () 193111 12 1933 4 3)
141(26) 20056 Korean J Med Hist 14131 Jun 2005 ISSN 1225505X ( 1897-1982) * ** 1 ( 1897-1982) ( ) 1) 3 1 ( ) 1930 1930 1930 * () ** 1) ( 2000 p 13-15) 1 141(26) 20056 1930 19 () ( ( ) () () () ) 2) 1932
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More informationMicrosoft Word - 08-박귀성.doc
Journal of Bacteriology and Virology 2011. Vol. 41, No. 4 p.287 293 http://dx.doi.org/10.4167/jbv.2011.41.4.287 Original Article Genetic Characterization of Norovirus GII.3 Circulating in Korea JongIm
More informationDBPIA-NURIMEDIA
Mass-production of Four Specific Proteins Originated from Deformed Wing Virus, Honeybee-viral Pathogen Joo-seong Lee, Giang Thi Huong Luong and Byoung-Su Yoon* Department of Life Science, College of Natural
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More information01-15(3)-12(최장경).fm
Res. Plant Dis. 15(3) : 165-169 (2009) Research in Plant Disease The Korean Society of Plant Pathology GM s ü š w Cucumber mosaic virus v y 1 Á y Á»x 1 Á * w w, 1 w y w Comparative Analysis of Coat Protein
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More information1. 2. 2 1. 2 2. 2 3. 3. 3 3 1. 3 2. 3 3. 4. 4 1. : 4 2. : (KSVD) 4 3. : 88 5. 36
, 1965 1994: 3 1965 (Konstfackskolan). 1996. (, 2004) :, (, 2010), 20 (, 2005), :,, (, 2005), 02: (, 2008), (KDF, 2009), (, 2011), (, 2011). ( _, 2011 3 ), : ( 前 史 ) (, 102, 2012). 35 1. 2. 2 1. 2 2. 2
More information04김호걸(39~50)ok
Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More information歯5-2-13(전미희외).PDF
The Korean Journal of Counseling 2004, Vol. 5, No. 2, 423-434,. 4 5 18 9, 9.,,,,,.,,, t-.. :,,, (,, 1996),.,,. (, 2001),... 88 98 2000, 88 12.5%(250 )98 35.6%(712 )2.8 (,,, 2001) (Corresponding Author)
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More information1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
More information2040 2010 6 11 - - - - - - 03 - -,,, - 08 8 15 < > - - -,, - / 04 2040 100,, -, 05 - -- - - KOREA 2040, 06 - - - - - - - 69(2010) 88(2040) - 2.56 2.10, 65 7.6% 14.2% 18% 15%, 65 16% 25% - -,, 56.7(2010)
More information< DC1A4C3A5B5BFC7E22E666D>
¼ (Jeong, Jung Chae)*, ý (Kim, Yoon Soo), (Shin, Woo Young), Þ Ñ (Park, Jong Man) ò ý ƒ Ð (Korea Evaluation Institute of Industrial Technology) (Shin, Jae-Heyg) Š æ (Ministry of Knowledge Economy) 1. :
More information???춍??숏
Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con
Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More information<31325FB1E8B0E6BCBA2E687770>
88 / 한국전산유체공학회지 제15권, 제1호, pp.88-94, 2010. 3 관내 유동 해석을 위한 웹기반 자바 프로그램 개발 김 경 성, 1 박 종 천 *2 DEVELOPMENT OF WEB-BASED JAVA PROGRAM FOR NUMERICAL ANALYSIS OF PIPE FLOW K.S. Kim 1 and J.C. Park *2 In general,
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 16 Jul.; 27(7), 64662. http://dx.doi.org/./kjkiees.16.27.7.646 ISSN 1226-3133 (Print)ISSN 2288-226 (Online) 2D Microwave Image
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More information( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
More information398 이다원ㆍ전려진ㆍ김승민ㆍ정준범 (Lee and Kim, 2013)., Em (Lee et al., 2016) Korean statistical information service (KOSIS),,., Em (Han et al., 2012; Sung et
한수지 51(4), 397-403, 2018 Original Article Korean J Fish Aquat Sci 51(4),397-403,2018 제주지역양식넙치 (Paralichthys olivaceus) 에서분리한어병세균내 Erythromycin 내성유전자분석 이다원 전려진 김승민 1 정준범 * 제주대학교해양의생명과학부, 1 주식회사우진비앤지 Analysis
More information<30355FC1B6B9CCBFB D FC7D1B1DBB3EDB9AE2E687770>
한국어병학회지제26권제2호 (2013) www.ksfp.org J. Fish Pathol., 26(2) : 99~110 http://dx.doi.org/10.7847/jfp.2013.26.2.099 방류용수산종묘의수산생물병원체검출동향 (2009~2012) 조미영 원경미 * 한현자 ** 김현정 지보영 김석렬 이순정 김진우 ** 박명애 국립수산과학원수산생물방역과,
More informationStatistical Data of Dementia.
Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.
More information00º½Çмú-¾Õ
547-8( 307 ) TEL (02)458-3078, 3079 / FAX (02)458-3047, 3077 NICE , (),, ( 1) NICE 1. Biochemical Engineering in 21st Century in the era of Life Science and Technology 09:00 ~ 09:15 Opening Remarks: President
More information2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285
13 2 ( 25 ) 2004 12 Korean J Med Hist 13 284 296 Dec 2004 ISSN 1225 505X 1) * ** ** 1 1920 1930 40 ( 1896-1973) 80 * ** 1) 2003 284 2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: * The
Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.243-268 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.243 * - 2001 2015 - The Research Trends on Peer Counseling in Elementary and
More information보건사회연구-25일수정
30(1), 2010, 220-241 Health and Social Welfare Review...... * :, (slee@kangnam.ac.kr) 220 ( ) 5.. (, 2005;, 2006;, 2006;, 2007), (, 2004;, 2005;, 2007;, 2007), (, 2005, 2009;, 2005;, 2005;, 2008).....
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More information歯kjmh2004v13n1.PDF
13 1 ( 24 ) 2004 6 Korean J Med Hist 13 1 19 Jun 2004 ISSN 1225 505X 1) * * 1 ( ) 2) 3) 4) * 1) ( ) 3 2) 7 1 3) 2 1 13 1 ( 24 ) 2004 6 5) ( ) ( ) 2 1 ( ) 2 3 2 4) ( ) 6 7 5) - 2003 23 144-166 2 2 1) 6)
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More informationECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Sep.; 30(9), 712 717. http://dx.doi.org/10.5515/kjkiees.2019.30.9.712 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) MOS
More information노인정신의학회보14-1호
제14권 1호 통권 제23호 www.kagp.or.kr 발행인 : 정인과 / 편집인 : 이동우 / 발행처 : 정인과 (152-703) 서울특별시 구로구 구로동 80번지 고려대학교 구로병원 정신과 / TEL : 02-818-6608 / FAX : 02-852-1937 발행일 : 2008년 4월 30일 / 제 작 : (주)엠엘커뮤니케이션 140-846 서울특별시
More information제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상
6차 산업 수익모델 시범사업 농산물가공품개발 연구용역 최 종 보 고 서 영남대학교 식품공학과 연구책임자 : 한 기 동 제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김
More information16-15(3)-07(최장경).fm
Res. Plant Dis. 15(3) : 254-258 (2009) Research in Plant Disease The Korean Society of Plant Pathology t (Lagenaria leucantha var. gourda) w IB m Cucumber mosaic virus Áy 1 Á»x 1 Á t 2 Á * w w, 1 w y w,
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More information27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
More information자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr
Original Article pissn 1738-2637 J Korean Soc Radiol 2012;67(2):129-134 The Survey of Magnetic Resonance Imaging Quality according to in Korea 1 자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 1 Hyun-Hae
More information<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>
J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2
More information±èÇ¥³â
533 Fig. 1. Dead zone. Nine echoes are positioned 2-10 mm below the scan surface with 1 mm distance. All nine echoes are clearly visualized. 534 Fig. 2. Vertical and horizontal measurement. 10 cm distance
More information732 서한길ㆍ서정수ㆍ류민경ㆍ이은혜ㆍ정승희ㆍ한현자 (Moravec and Harrison, 1989; Moravec and Wang, 2002; Wijová et al., 2006).,,,., Philometridae., (Edward, 1996). Seo et al.
한수지 48(5), 731-738, 2015 Original Article Korean J Fish Aquat Sci 48(5),731-738,2015 조피볼락 (Sebastes schlegeli) 선충 (Nematode: Philometridae) 에대한분자생물학적동정및 PCR 검출법개발 서한길 서정수 류민경 이은혜 정승희 한현자 * 국립수산과학원병리연구과
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
More information2월1일자.hwp
제 26 권 2호 통권 570호 국가별 디지털 네이티브(digital natives) 현황과 IDI(ICT Development Index) 7) 고 흥 석 * 1. 개 요 2001년 마크 프렌스키(Marc Prensky)는 오늘날 학생들을 일컬어 컴퓨터와 비디오 게임, 각종 인터넷 등의 디지털 언어에 대해 네이티브 스피커(native speaker)와 같다
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More information