VHS 및 RSIVD 모니터링 177 al., 2001) (World Organization for Animal Health, OIE). VHSV Rhabdoviridae Novirhabdovirus RNA 6 gene nucleocapsid protein (N), p

Size: px

Start display at page:

Download "VHS 및 RSIVD 모니터링 177 al., 2001) (World Organization for Animal Health, OIE). VHSV Rhabdoviridae Novirhabdovirus RNA 6 gene nucleocapsid protein (N), p"

광현 설
6 years ago
Views:

1 한수지 49(2), , 2016 Original Article Korean J Fish Aquat Sci 49(2), , 년제주도양식넙치 (Paralichthys olivaceus) 를대상으로한 VHS 및 RSIVD 모니터링 박현경 전려진 1 김승민 박명애 2 조미영 2 황성돈 2 박신후 2 정현도 3 정준범 * 제주대학교해양의생명과학부, 1 제주대학교수산백신연구센터, 2 국립수산과학원수산생물방역과, 3 부경대학교수산생명의학과 Monitoring of VHS and RSIVD in Cultured Paralichthys olivaceus of Jeju in 2015 Hyun Kyung Park, Lyu Jin Jun 1, Seung Min Kim, Myoung Ae Park 2, Mi Young Cho 2, Seong Don Hwang 2, Shin Hoo Park 2, Hyun Do Jeong 3 and Joon Bum Jeong* Faculty of Marine Biomedical Science, Jeju National University, Jeju 63243, Korea 1 Fish Vaccine Resarch Center, Jeju National University, Jeju 63333, Korea 2 Aquatic Life Disease Control Division, National Fisheries Research & Development Institute, Busan 46083, Korea 3 Department of Aquatic Life Medicine, Pukyong National University, Busan 48513, Korea In this study, disease surveillance was performed to monitor the prevalence of viral haemorrhagic septicaemia virus (VHSV) and red seabream iridovirus (RSIV) in olive flounder, Paralichthys olivaceus in The fish samples were collected in March (60 farms), May (55 farms) and July (52 farms) from different farms in Jeju. Reverse transcription polymerase chain reaction (RT-PCR) (VHSV) or PCR (RSIV) results showed that VHSV detected in 2 farms, but RSIV has not been detected in any farms. The sequences of the nucleocapsid protein (N) and glycoprotein (G) gene of the 2 VHSV isolates were successfully sequenced. Phylogenetic analysis was included VHSV isolates reported here together with a representative VHSV isolates available in GenBank. Phylogenetic analysis indicated that most of Korea VHSV isolates were closely related to the Japan and China genotype Ⅳa which is clearly distinct from the North American genotype Ⅳb. Key words: Paralichthys olivaceus, VHSV, RSIV, Nucleocapsid protein, Glycoprotein 서론 (Paralichthys olivaceus) 50%,. red seabream iridovirus (RSIV), lymphocystis disease virus (LCDV) DNA viral haemorrhagic septicaemia virus (VHSV), viral nervous necrosis virus (VNNV), hirame rhabdovirus (HRV), marine birnavirus (MABV) RNA, VHSV RSIV (Cho et al., 2010). VHSV (Oncorhynchus mykiss), (Mortensen et al., 1999) (Takano et al., 2000; Isshiki et Korean J Fish Aquat Sci 49(2) , April 2016 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial Licens ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Received 4 October 2015; Revised 27 January 2016; Accepted 19 March 2016 *Corresponding author: Tel: Fax: address: jeongjb@jejunu.ac.kr Copyright 2016 The Korean Society of Fisheries and Aquatic Science 176 pissn: , eissn:

2 VHS 및 RSIVD 모니터링 177 al., 2001) (World Organization for Animal Health, OIE). VHSV Rhabdoviridae Novirhabdovirus RNA 6 gene nucleocapsid protein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), non-structural protein (NV) RNA polymerase (L) (Schutze et al., 1999). Snow et al. (1999) Lumsden et al. (2007) VHSV N G 4 genotype, Genogroup (European freshwater and sea fish), Genogroup (British Isles), Genogroup (North Atalantic and North America), Genogroup (Pacific coast, Atlantic, Great Lakes, Japan and Korea) 4 (Einer- Jensen et al., 2004; Dale et al., 2009; Kim et al., 2011). RSIV 1990 (Pagrus major),,, (Inouye et al., 1992; Matsuoka et al., 1996). RSIV 1990 (Oplegnathus fasciatus), (Do et al., 2005). RSIV Megalocytivirus, 4 subgroups, subgroup RSIV, subgroup RBIV, subgroup (Siniperca scherzeri) ISKNV, subgroup (P. olivaceus) turbot(scophthalmus maximus) TRBIV (He et al., 2001; Do et al., 2004; Shi et al., 2004). VHS RSIVD. 실험어 재료및방법 ( / ) (60 ), 5 (55 ), 7 (52 ) (Paralichthys olivaceus), VHSV RSIV. Primer RSIV ( 84 ) RSIVD primer set PCR (Table 1). VHSV Primers N-gene 444 bp forward primer (5 -GAGAGA- ACTGGCCCTGACTG-3 ) reverse primer (5 -ATGATCC- GTCTGGCTGACTC-3 ) Cho et al. (2007), G-gene 1,340 bp forward primer (5 -ACAGAT- CACTCAACGACCTC-3 ) reverse primer (5 -ATAGTGA CGGCCAAAGA CTC-3 ) full length open reading frames (ORFs) PCR (Table 1). DNA 추출 RSIV, DNeasy Blood & Tissue Kit (Qiagen Hilden, Germany) total DNA. 10 mg ATL buffer 180 L proteinase K 20 L 56., AL buffer 200 L ethanol 200 L spin column 6,000 g 1. Column tube AW1 buffer 500 L AW2 buffer 500 L, AE buffer 50 L DNA. DNA -20. Table 1. PCR conditions and primer sequences for the detection of virus from the olive flounder Paralichthys olivaceus of Korea Target¹ Oligonucleotide sequence (5'-3') PCR condition Product size (bp) F GAGAGAACTGGCCCTGACTG N gene VHSV-N 94 (30")-55 (45")-72 (45") 444 R ATGATCCGTCTGGCTGACTC F ACAGATCACTCAACGACCTC G gene VHSV-G 94 (30")-52 (30")-72 (1') 1,340 R ATAGTGACGGCCAAAGACTC F CTCAAACACTCTGGCTCATC RSIV 94 (30")-58 (60")-72 (60") 570 R GCACCAACACATCTCCTATC ¹VHSV, viral haemorrhagic septicaemia virus; RSIV, red seabream iridovirus.

3 178 박현경ㆍ전려진ㆍ김승민ㆍ박명애ㆍ조미영ㆍ황성돈ㆍ박신후ㆍ정현도ㆍ정준범 RNA 추출및 cdna 합성 VHS, Viral RNA Mini kit (Qiagen Hilden, Germany) RNA. 10 mg nuclease freewater 140 L homogenizer. AVL buffer 560 L 15 10, ethanol 560 L spin column 6,000 g 1. Column tube AW1 buffer 500 L AW2 buffer 500 L, AE buffer 30 L Table 2. VHSV isolates used in this study for comparison of N gene Virus isolate Year Origin Host fish Genotype GenBank accession No. 15-E03(SW) 2015 Korea Olive flounder Ⅳa unpublished 15-E03(SD) 2015 Korea Olive flounder Ⅳa unpublished US-mak-wa USA Coho salmon Ⅳa X59241 JF00Ehil-JPN 2000 Japan Olive flounder Ⅳa AB KRRV9822-JPN 1998 Japan Olive flounder Ⅳa AB CA-NS Canada Brown trout Ⅳb HQ CA-NB04-01b 2007 Canada Brown trout Ⅳb HQ MI03GL 2006 USA Muskellunge Ⅳb DQ JUL USA Muskellunge Ⅳb GQ CA-NB Canada Brown trout Ⅳb EF ON USA Diporeia spp. Ⅳb HQ SE-SVA Sweden Rainbow trout Ⅰb GQ SE-SVA Sweden Rainbow trout Ⅰb FJ UKMLA98/6HE Britain Rainbow trout Ⅰb GQ DK-1p Denmark Rainbow trout Ⅰb GQ DK-5e Denmark Rainbow trout Ⅰb GQ Britain Atlantic herring Ⅰb AF Cod-Ulcus 1979 Denmark Atlantic cod Ⅰb Z93414 DK-4p North sea Rainbow trout Ⅰb FJ FR France Rainbow trout Ⅰa D France Rainbow trout Ⅰa AJ Fil Germany Rainbow trout Ⅰa Y18263 DE-Fil3-wt 1983 Germany Rainbow trout Ⅰa X73873 DK-3592B 1997 Denmark Rainbow trout Ⅰa AF KV Norway Rainbow trout Ⅲ FJ BV Norway Rainbow trout Ⅲ FJ FA Norway Rainbow trout Ⅲ EU FS V 2010 Norway Rainbow trout Ⅲ GU FS S 2010 Norway Rainbow trout Ⅲ GU V Norway Rainbow trout Ⅲ FJ / Scotland Turbot Ⅱ AJ F Ireland Turbot Ⅱ AJ p Skagerrak Whiting Ⅱ AJ H17/2/ North sea Haddock Ⅱ AJ H16/7/ North sea Cod Ⅱ AJ p Skagerrak Norway pout Ⅱ AJ130917

4 VHS 및 RSIVD 모니터링 179 RNA. RNA -20. RT-PCR 3 L viral RNA, 4 L 5 reaction buffer, 1 L reverse transcriptase, 1 L dntp, 1 L oligo (dt) primer 2.4 L MgCl 2 volume 20 L nuclease freewater, 25 5, 42 1, PCR 및 sequencing PCR microtube 1 M primer, 2.5 mm dntp, 10 G-Taq Buffer, 2.5 U G-Taq DNA polymerase (Gene Pro Themal Cycler Cosmo, Korea) template DNA distilled water PCR volume 20 L, PCR Table 1. PCR 1 TAE buffer (40 Mm Tris-acetate, 1 mm EDTA), 0.5 g/ L ethidium bromide 1% agarose gel, UV. PCR Gel purification kit (Bioneer, Korea), ToPo TA cloning kit (Invitrogen, USA) cloning, (Solgent, Korea). 계통학적분석 BioEdit program Clustal W (Thompson et al., 1994) GenBank N gene 34 (Table 2) G gene 19 (Table 3) alignment. Alignment MEGA program version 4.0 (Tamura et al., 2007) neighbor joining criteria. 결과및고찰 1980,,. VHS Table 3. VHSV isolates used in this study for comparison of G gene Virus isolate Year Origin Host fish Genotype GenBank accession No. 15-E03(SW) 2015 Korea Olive flounder Ⅳa unpublished 15-E03(SD) 2015 Korea Olive flounder Ⅳa unpublished CHN-PORV 2005 China Olive flounder Ⅳa KC JF00Ehil-JPN 2000 Japan Olive flounder Ⅳa AB JP990Obama Japan Olive flounder Ⅳa DQ Makah 1988 USA Coho salmon Ⅳa U28747 U Canada Drum Ⅳb HQ CA-NB Canada Mummichog Ⅳb EF CA-NS Canada Brown trout Ⅳb EF DK Denmark Rainbow trout Ⅰa AY DK Denmark Rainbow trout Ⅰa JF DK Denmark Rainbow trout Ⅰa JF DK Denmark Rainbow trout Ⅰa JF JP96KRRV Japan Rainbow trout Ⅰb DQ DK-6p Denmark Herring Ⅰb AY DK-1p Baltic sea Sprat Ⅱ AY DK-1p Baltic sea Herring Ⅱ AY DK-1p Baltic sea Sprat Ⅱ AY DK-4p Skagerrak Herring Ⅲ AY IR-F Ireland Turbot Ⅲ AY FR-L59X 1987 France Eel Ⅲ AY546618

180 박현경ㆍ전려진ㆍ김승민ㆍ박명애ㆍ조미영ㆍ황성돈ㆍ박신후ㆍ정현도ㆍ정준범 RSIVD,. 2 2, 3.3%., VHSV 3 2 (3.3%) (Fig. 1, Table 4), 30 6.7%. 15 cm, VHSV Kim et al. (2009). VHSV 3 15, 10-15 (Kim et al., 2003). Fig. 1. Detection of the VHSV gene by RT-PCR using the N (lane 1-5) or G (lane 6-10) primer set.

5 180 박현경ㆍ전려진ㆍ김승민ㆍ박명애ㆍ조미영ㆍ황성돈ㆍ박신후ㆍ정현도ㆍ정준범 RSIVD,. 2 2, 3.3%., VHSV 3 2 (3.3%) (Fig. 1, Table 4), %. 15 cm, VHSV Kim et al. (2009). VHSV 3 15, (Kim et al., 2003). Fig. 1. Detection of the VHSV gene by RT-PCR using the N (lane 1-5) or G (lane 6-10) primer set. Lane 1 and 6, 15-E03(SW); Lane 2 and 7, 15-E03(SD); Lane 3 and 8, farm 1; Lane 4 and 9, farm 2; Lane 5 and 10, farm 3; M, 1 kb DNA ladder. Fig. 2. Phylogenetic tree showing the genetic relationships among 36 VHSVs based on the nucleotide sequences of the N gene. Phylogenetic analysis indicated that most of Korea VHSVs belong to the genotype Ⅳa. Bootstrap values were transferred to the original maximum likelihood tree derived from the actual data. The scale bar indicates the number of substitutions per nucleotide site. *indicates VHSV isolates in this study.

6 VHS 및 RSIVD 모니터링 181. RSIV (Cho et al., 2009), RSIV. RSIV, RSIV (Table 4), RSIV,, (data not shown). Park et al. (2015) Table 4. Distribution of virus infection in cultured olive flounder Paralichthys olivaceus in 2015 Virus Detection rate (%) (No. of positive / No. of farms) March May July VHSV 3.3(2/60) 0(0/55) 0(0/52) RSIV 0(0/60) 0(0/55) 0(0/52), RSIV 3,. Kim (2015) two-step RT-PCR VHSV a, VHSV N gene (444 bp) G gene (1,340 bp) primer set RT-PCR E03 (SW) 15-E03 (SD), N gene G gene N gene G gene primer set (Fig. 1). 2 VHSV GenBank 34 N gene 19 G gene. N gene, 2 Fig. 3. Phylogenetic tree showing the genetic relationships among 21 VHSVs based on the nucleotide sequences of the G gene. Phylogenetic analysis indicated that most of Korea VHSVs belong to the genotype Ⅳa. Bootstrap values were transferred to the original maximum likelihood tree derived from the actual data. The scale bar indicates the number of substitutions per nucleotide site. *indicates VHSV isolates in this study.

7 182 박현경ㆍ전려진ㆍ김승민ㆍ박명애ㆍ조미영ㆍ황성돈ㆍ박신후ㆍ정현도ㆍ정준범 genotype (Fig. 2). VHSV genotype a b subgroups, 2 VHSV genotype a (Snow et al., 1999; Einer-Jensen et al., 2004; Lumsden et al., 2007)., 2 (accession number: AB179621, AB490792) (Nishizawa et al., 2002), % (data not shown), genotype b (Fig. 2). G gene, 2 N gene (Fig. 3)., (accession number: KC685626) (accession number: AB490792, DQ401191) (Fig. 3),, % % (data not shown). VHS RSIVD, VHS.. 사사 2015 (R ),. References Cho MY, Kim MS, Kwon MG, Jee BY, Choi HS, Choi DL, Park GH, Lee CH, Kim JD, Lee JS, Oh YK, Lee DC, Park SH and Park MA Epidemiological study of bacterial diseases of cultured olive flounder, Paralichthys olivaceus from 2005 to 2006 in Korea. J Fish Pathol 20, Cho MY, Jee BY, Park GH, Lee CH, Lee DC, Kim JW, Park MS and Park MA Monitoring of fish pathogens in wild marine fish of Korean coastal offshore water in J Fish Pathol 22, Cho MY, Park GH, Jee BY and Kim JW Statistical data on fish virus of cultured olive flounder, Paralichthys olivaceus from 2005 to J Fish Pathol 23, Dale OB, Ørpetveit I, Lyngstad TM, Kahns S, Skall HF, Olesen NJ and Dannevig BH Outbreak of viral haemorrhagic septicaemia (VHSV) in seawater-farmed rainbow trout in Norway caused by VHS virus Genotype III. Dis Aquat Org 85, Do JW, Moon CH, Kim HJ, Ko MS, Kim SB, Son JH, Kim JS, An EJ, Kim MK, Lee SK, Han MS, Cha SJ, Park MS, Park MA, Kim YC, Kim JW and Park JW Complete genomic DNA sequence of rock bream iridovirus. Virol 325, j.virol Do JW, Cha SJ, Kim JS, An EJ, Lee NS, Choi JH, Lee CH, Park MS, Kim JW, Kim YC and Park JW Phylogenetic analysis of the major capsid protein gene of iridovirus isolates from cultured flounders Paralichthys olivaceus in Korea. Dis Aquat Org 64, Einer-Jensen K, Ahrens P, Forsberg R and Lorenzen N Evolution of the fish rhabdovirus viral haemorrhagic septicaemia virus. J Gen Virol 85, http;//dx.doi. org/ /vir He JG, Deng M, Weng SP, Li Z, Zhou SY, Long QX, Wang XZ and Chan SM Complete genome analysis of the mandarin fish infectious spleen and kidney necrosis iridovirus. Virology 291, viro Inouye K, Yamano K, Maeno Y, Nakajima K, Matsuoka M, Wada Y and Sorimachi M Inidovirus infection of cultured red seabream, Pagrus major. Fish Pathol 27, Isshiki T, Nishizawa T, Kobayashi T, Nagano T and Miyazaki T An outbreak VHSV (viral haemorrhagic septicaemia virus) infection in farmed Japanese flounder Paralichthys olivaceus in Japan. Dis Aquat Org 47, Kim HJ Validation of the sensitivities of one-step and two-step reverse-transcription PCR methods for detection of viral haemorrhagic cepticaemia virus (VHSV) Ⅳa isolates from cultured olive flounder in Korea. Aquaculture 448, /j.aquaculture Kim SM, Lee JI, Hong MJ, Park HS and Park SI Genetic relationship of the VHSV (viral haemorrhagic septicemia virus) isolated from cultured olive flounder, Paralichthys olivaceus in Korea. J Fish Pathol 16, Kim WS, Kim SR, Kim DW, Kim JO, Park MA, Kitamura SI, Kim HY, Kim DH, Han HJ, Jung SJ and Oh MJ An outbreak of VHSV (viral haemorrhagic septicaemia virus) infection in farmed olive flounder, Paralichthys olivaceus in Korea. Aquaculture 296, org/ /j.aquaculture Kim WS, Jung SJ, Kim JO, Kim DW, Kim JH and Oh MJ Genetic positioning of Korean viral haemorrhagic septicaemia virus (VHSV) from cultured and wild marine fishes. J Fish Pathol 24, jfp Lumsden JS, Morrison B, Yason C, Russell S, Yong K, Yaz-

8 danpanah A, Huber P, Al-Hussinee L, Stone D and Way K Mortality event in freshwater drum Aplodinotus grunniens from Lake Ontario, Canada, associated with viral haemorrhagic septicaemia virus, Type IV. Dis Aquat Org 76, Matsukoa S, Inonye K and Nakjima K Cultured fish species infected by red seabream iridoviral disease from 1991 to J Fish Pathol 31, Mortensen HF, Heuer OE, Lorenzen N, Otte L and Olesen NJ Isolation of viral haemorrhagic septicaemia virus (VHSV) from wild marine fish species in the Baltic Sea, Kattegat, Skagerrak and the North Sea. Virus Res 63, Nishizawa T, Iida H, Takano R, Isshiki T, Nakajima K and Muroga K Genetic relatedness among Japanese, American and European isolates of viral haemorrhagic septicaemia virus (VHSV) based on partial G and P genes. Dis Aquat Org 48, Park HK, Kim SM, Lee DW, Jun LJ and Jeong JB Monitoring of VHS and RSIVD in cultured Paralichthys olivaceus of Jeju in JFMSE 27, org/ /jfmse Schutze H, Mundt E and Mettenleiter TC. Complete genomic sequence of viral haemorrhagic septicaemia virus, a fish rhabdovirus. Virus Genes 19, Shi CY, Wang YG, Yang SL, Huang J and Wang QY The first report of an iridovirus-like agent infection in farmed turbot Scophthalmus maximus in China. Aquaculture 236, Snow M, Cunningham CO, Melvin WT and Kurath G Analysis of the nucleoprotein gene identifies distinct lineages of viral haemorrhagic septicaemia virus within the European marine environment. Virus Res 63, Takano R, Nishizawa T, Arimoto M and Muroga K Isolation of viral haemorragic septicaemia (VHSV) from wild Japanese flounder, Paralichthys olivaceus. Bull Eur Assoc Fish Pathol 20, Tamura K, Dudley J, Nei M and Kumar S Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24, Thompson JD, Higgins DG and Gibson TJ Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22, VHS 및 RSIVD 모니터링 183

338 김승민ㆍ전려진ㆍ박명애ㆍ정현도ㆍ정준범 viral hemorrhagic septicemia (VHS) Scuticocilate,, cm, 1-3.,,.,, cohabitation test. 실험어 재료및방법 2010 (E03), 2011 (E06),

338 김승민ㆍ전려진ㆍ박명애ㆍ정현도ㆍ정준범 viral hemorrhagic septicemia (VHS) Scuticocilate,, cm, 1-3.,,.,, cohabitation test. 실험어 재료및방법 2010 (E03), 2011 (E06), 한수지 48(3), 337-345, 2015 Original Article Korean J Fish Aquat Sci 48(3),337-345,2015 제주도여윔증상넙치 (Paralichthys olivaceus) 로부터분리한점액포자충의특성분석 김승민 전려진 1 박명애 2 정현도 3 정준범 * 제주대학교해양의생명과학부, 1 제주대학교수산백신연구센터, 2 국립수산과학원수산생물방역과,