732 서한길ㆍ서정수ㆍ류민경ㆍ이은혜ㆍ정승희ㆍ한현자 (Moravec and Harrison, 1989; Moravec and Wang, 2002; Wijová et al., 2006).,,,., Philometridae., (Edward, 1996). Seo et al.
|
|
- 범식 구
- 6 years ago
- Views:
Transcription
1 한수지 48(5), , 2015 Original Article Korean J Fish Aquat Sci 48(5), ,2015 조피볼락 (Sebastes schlegeli) 선충 (Nematode: Philometridae) 에대한분자생물학적동정및 PCR 검출법개발 서한길 서정수 류민경 이은혜 정승희 한현자 * 국립수산과학원병리연구과 Molecular Identification and Development of a PCR Assay for the Detection of a Philometrid Nematode in Rockfish Sebastes schlegeli Han-Gill Seo, Jung Soo Seo, Min Kyung Ryu, Eun Hye Lee, Sung Hee Jung and Hyun-Ja Han* Pathology Research Division, National Fisheries Research and Development Institute, Busan 46083, Korea Nematode infection in the epithelial tissue of cultured rockfish Sebastes schlegeli was first reported in Since then, nematode infections have caused serious economic losses in rockfish aquaculture on the west coast of Korea. Taxonomic and life cycle information for this parasite are currently unknown. In this study, 18S rrna and cytochrome c oxidase subunit I (COI) genes were used for molecular identification and polymerase chain reaction (PCR) to detect the invisible stages of this parasite. Nucleotide sequences of the 18S rrna of the rockfish nematode showed 98% identity with that of Philometra morii. Therefore, this rockfish nematode was classified to the Philometridae family. However, we could not identify it to genus level using 18S rrna. Its COI nucleotide sequences shared 85% and 82% identities with those of Bursaphelenchus sinensis and Philometra overstreeti, respectively. In addition, two gene-specific primer sets were designed based on the 18S rrna gene to detect the intermediate host and nematode larvae. These primers were specific to this rockfish nematode without cross-reacting to other pathogens. The detection limit of the PCR assay using these primers was 1,000 copies of nematoda plasmid DNA. Therefore, the PCR assay described here is suitable for the detection of nematode DNA within rockfish. In addition, this PCR assay could be used to detect nematode larvae and the intermediate host. Key words: Philometrid nematode, Rockfish, 18S rrna gene, Cytochrome c oxidase subunit I gene, PCR 서론 (Sebastes schlegeli), ,598 30% (KOSIS, 2015). 2012, %. 2014,, 2. (Seo et al., 2014). Nematode (phylum) Secernentea (class) Camallanida (order) Philometridae (family), 650. Philometridae Afrophilometra, Alinema, Buckleyella, Caranginema, Clavinema, Dentiphilometra, Margolisianum, Nilonema, Philometra, Philometroides, Philonema, Phlyctainophora, Rumai Spirophilometra (genus) Korean J Fish Aquat Sci 48(5) , October 2015 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial Licens ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Received 17 August 2015; Revised 25 September 2015; Accepted 7 October 2015 *Corresponding author: Tel: Fax: address: hjhan77@korea.kr Copyright 2015 The Korean Society of Fisheries and Aquatic Science 731 pissn: , eissn:
2 732 서한길ㆍ서정수ㆍ류민경ㆍ이은혜ㆍ정승희ㆍ한현자 (Moravec and Harrison, 1989; Moravec and Wang, 2002; Wijová et al., 2006).,,,., Philometridae., (Edward, 1996). Seo et al. (2014).. Stephanie et al. (2011) South Carolina philometrids Polymerase Chain Reaction (PCR). Kang et al. (2008) Polymerase Chain Reaction-Restriction Fragment Length Polmorphism (PCR-RFLP).,. PCR,. ribosomal RNA (rrna), mitochondrial DNA (mtdna) microsatellite DNA. ribosomal DNA rrna code 18S, 5.8S 28S internal external transcribed spacers (ITS and ETS). 18S rrna (Nyaku et al., 2013). mtdna, cytochrome c oxidase subunit I (COI) (Edmands et al., 1996). Cytochrome,,. Cytochrome, a, b, c d 4, cytochrome c. Cytochrome c oxidase cytochrome c COI. Herbert (2003) DNA barcoding COI, COI (Han et al., 2014). 18S rrna COI primer,. 18S rrna primer, PCR. 재료및방법 선충시료채취및 DNA 추출 , 100% ET-OH DNA. 50 mg E-tube PBS, (8,000 rpm, 10 min). DNA High pure template preparation kit(roche, Germany),. 분자생물학적동정 18S rrna COI. PCR Emerald Taq (Takara, Japan), primer sequence PCR Table 1. PCR product 1.5% agarose gel (Bioneer, Korea) band, PCR sequencing. BioEdit Ver , MEGA Ver. 6, National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST). BioEdit Ver program MEGA Ver. 6 program (NJ; neighbor-joining analysis, 1000 rounds of bootstrap)
3 조피볼락선충의분자생물학적동정 733 Table 1. Primer information and PCR condition for this study Purpose Target gene Primer Nucleotide sequence (5 to3 ) PCR Condition (annealing temp. o C, / PCR cycles) PCR size (bp) References Molecular identification Specific detection 18S rrna Cytochrome oxidase subunit I 18S rrna nema35f TATAATGGTGAAACCGCGAACGGC 61/ 30 1,694 Qiazon (2009) nema18gm GGAAACCTTGTTACGACTTTTGCC NemCOI 5P NemCOI 3P RN-18S 1F RN-18S 1R RN-18S 2F RN-18S 2R CATTTRTTTTGRTTTTTTGG ACYACATRATAAGTATCRTG TAGTCGGCGAATAATGAACCTT GTTACCTTTGCCTTTCGACAAC GCAATTATTTCCCTTGAACGAG AAGGCGGTTTCTACCCTCTATC 55/ / 30 Stephanie et al. (2011) 183 This study 206 This study (phylogenetic tree). 18S rrna (1,695 bp) GenBank Philometridae 8 18S rrna (Philometra morii, Philometra sp., Philometroides sanguineus, Philometroides seriolae, Clavinema parasiluri, Dentiphilometra monopteri, Nilonema senticosum, Rumai rumai, Philonema oncorhynchi) Anisakidae 4 18S rrna (Anisakis sp., A. pegreffi, A. simplex) (Fig. 2A). COI (389 bp) Philometra overstreeti, Philometroides paralichthydis, A. pegreffii, A. simplex (Fig. 2B). 조피볼락선충검출 PCR 법개발 18S rrna Philometridae 18S rrna 2 primer set PCR. PCR Table 1, PCR annealing. primer DNA PCR.,, Edwardsiella tarda Streptococcus iniae. CHSE % ET-OH, DNA PCR. 1.5% NaCl Brain Heart Infusion (BHI, Gibco, USA) broth DNA PCR. PCR product 1.5% agarose gel (Bioneer, Korea) band. PCR primer. PCR product 1.5% agarose gel, PCR product purification kit (Roche, Germany) Gel Purification. PCR product pgem T- Easy vector (Promega, USA) cloning, Plasmid Mini Extraction kit (Bioneer, Korea) plasmid DNA. plasmid copy Nuclease-free water (Bioneer, Korea) copy copy 10 template PCR. PCR product 1.5% agarose gel band. 결과및고찰 18S rrna COI universal primer PCR. 18S rrna Quiazon (2009) PCR, PCR PCR (Table 1). genomic DNA template 18S rrna 1,695 bp (GenBank accession no. LC071530), NCBI BLAST Philometra morii 18S rrna gene (JF803933) 98% (Fig. 1). 18S rrna
4 734 서한길ㆍ서정수ㆍ류민경ㆍ이은혜ㆍ정승희ㆍ한현자 Fig. 1. Partial 18S rrna gene sequences (position 1,173 through 1,695) of philometrid nematode from rockfish Sebastes schlegeli of Korea, indicating position of primer (boxes) used for detection PCR. nematode Philometridae (family), Philometrodae Philometra, Philometroides, Clavinema (genus) (Fig. 2A). Nyaku et al. (2013) 18S rrna (order). 18S rrna (family), (species) (genus). COI (PCR product size 389bp; GenBank accession no. LC073304) NCBI BLAST Bursaphelenchus sinensis cytochrome c oxidase subunit I (mtcoi) gene (GenBank accession no. AB232163) 84%, Philometra overstreeti COI (GenBank accession no. HM ) 82%
5 조피볼락선충의분자생물학적동정 735. COI phylogentic tree (Fig. 2B), Philometra, Philometroides (genus), COI (Stephanie et al., 2011), GenBank Philometra overstreeti Philometroides (A) (B) Fig. 2. Neighbor-joining analysis of philometrid nematode from rockfish Sebastes schlegeli (A) 18S rrna and (B) cytochrome c oxidase subunit I sequences from GenBank.
6 736 서한길ㆍ서정수ㆍ류민경ㆍ이은혜ㆍ정승희ㆍ한현자 paralichthydis (species). COI, COI. PCR 18S rrna 2 primer set (Fig. 1). Primer, 18S rrna Philometrodae 18S rrna primer. DNA PCR 2 primer set, agarose gel bp band. PCR BIO-RAD Peltier Thermal Cycler (PTC-0220) gradient PCR. annealing temp primer 55 (data not shown). primer 5 (,, ) 2 (Edwardsiella tarda, Streptococcus iniae) PCR DNA (Fig. 3A, B). RN-18S 1 2 primer sets. (data not shown), Philometrid nematodes. primer plasmid DNA,. 18S rrna plasmid DNA copy copy band primer (Fig. 4A, 4B). Philometrid nematodes,. (copepodes) (Wang, 2002).., (Gonzalez et al., 2007). Seo et al. (2014) , Fig. 3. PCR results obtained using (A) RN-18S1 primer and (B) RN-18S2 primer sets, with lanes M to 7 as follows: 100 bp DNA ladder, Nematode with rockfish Sebastes schlegeli, Scutica with flounder Paralichthys olivaceus, Kudoa with flounder, Anisakis with rockfish, Anisakis with flounder, Edwardsiella tarda and Streptococcus iniae , 1,.. Seo et al. (2014),,
7 조피볼락선충의분자생물학적동정 737 Fig. 4. Analytical sensitivity of PCR for detection of philometrid nematode from rockfish Sebastes schlegeli. Plasmid DNA composing 18S rrna gene of philometrid nematode was serially diluted from to 10 0 was used for PCR. Lanes 1 to 11: DNA ladder, 10 10, 10 9, 10 8, 10 7, 10 6, 10 5, 10 4, 10 3, 10 2, 10 1 and 10 0 copy of plasmid DNA/tube. A, RN-18S1; B, RN-18S2.. PCR. 18S rrna Philometridae Philometra,,., PCR,. 사사 2015 (R ). References Edmands S, Moberg PE and Burton RS Allozyme and mitochondrial DNA evidence of population subdivision in the purple sea urchin Strongylocentrotus purpuratus. Mar Biol 126, Edward JN Diagnosis and Treatment, Fish Disease. Blackwell, Iowa State University Press, Iowa, U.S.A., González-Solís D, Moravec F and Paredes VM A new species of Dentiphilometra (Nematoda: Philometridae) from the musculature of the gray snapper Lutjanus griseus (osteichthyes) off the Caribbean coast of Mexico. J Parasitol 93, Han SH, Lee YD, Baek HJ, Oh HS and Noh CH Genetic structure and phylogenetic relationship of red spotted grouper (Epinephelus akaara) based on the haplotypes and polymorphisms of mitochondrial COI gene sequences. J Life Sci 24, Herbert PDN, Cywinska A, Ball SL and dewaard JR Biological identifications through DNA barcodes. Proc Biol Sci 270, Kang JH, Lee MH, Lee KB and Choi CS Comparison of macroscopic inspection and polymerase chain reactionrestriction fragment length polymorphism (PCR-RFLP) for the detection of Anisakis simplex complex. J Fd Hyg Safety 23, KOSIS. Korean Statistical Information Service. Retrived from blid=dt_1ez0008&vw_cd=mt_ztitle&list_ id=f38&seqno=&lang_mode=ko&language=kor&obj_ var_id=&itm_id=&conn_path=e1# on July Moravec F and Harrison FS Paraphilometroides nemipteri gen. et sp. N. (nematoda:philometridae) from the marine fish nemipterus peronei (valenciennes) from Malaysia. Folia Parasitol 36, Moravec F and Wang GT Dentiphilometra monopteri n. gen., n. sp. (nematoda: philometridae) from the abdominal cavity of the ricefield eel monopterus albus in china. J Parasitol 88, Nyaku ST, Sripathi VR, Kantety RV, Gu YQ, Lawrence K and Sharma GC Characterization of the two intra-individual sequence variants in the 18S rrna gene in the plant parasitic nematode, Rotylenchulus reniformis. PLoS ONE 8,e Quiazon KMA Studies on philometrid and anisakid nematodes infecting marine fishes in Japanese waters. Ph.D. Thesis, The University of Tokyo, Tokyo, Japan. Seo HG, Seo JS, Ryu MK, Lee EH, Kwon SR, Kang JS, No YS, Choi HS, Jung SH and Han HJ A nematoda infection in the Epithelial Tissue of Cultured Rockfish Sebastes schlegeli in Cheonsu Bay, Western Korea. Korean J Fish Aquat Sci 47, KFAS Stephanie P, Weatherly AM, Isaure DB, William AR and Allan ES Use of molecular tools in identification of philometrid larvae in fishes: technical limitations parallel
8 738 서한길ㆍ서정수ㆍ류민경ㆍ이은혜ㆍ정승희ㆍ한현자 our poor assessment of their biodiversity. Parasitol Res 109, Wang GT Seasonal dynamics and distribution of Philometroides fulvidraconi (Philometridae) in the bullhead catfish, Pseudobagrus fulvidraco (Richardson). J Fish Dis 25, Wijová M, Moravec F, Horák A and Lukeś J Evolutionary relationships of Spirurina (Nematoda: Chromadorea: Rhabditida) with special emphasis on dracunculoid nematodes inferred from SSU rrna gene sequences. Int J Parasitol 36,
한수지 47(5), , 2014 Original Article Kor J Fish Aquat Sci 47(5), ,2014 서해안천수만일대양식조피볼락 (Sebastes schlegeli) 의상피선충감염현황 서한길 서정수 류민경 이은혜 권세련 1
한수지 47(5), 603-610, 2014 Original Article Kor J Fish Aquat Sci 47(5),603-610,2014 서해안천수만일대양식조피볼락 (Sebastes schlegeli) 의상피선충감염현황 서한길 서정수 류민경 이은혜 권세련 1 강종순 2 노윤산 2 최혜승 정승희 한현자 * 국립수산과학원병리연구과, 1 선문대학교수산생명의학과,
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More information한수지 51(1), 23-30, 2018 Original Article Korean J Fish Aquat Sci 51(1),23-30,2018 넙치 (Paralichthys olivaceus) 근육채취방법에따른 Kudoa septempunctata 진단효율비교 송준영
한수지 51(1), 23-30, 2018 Original Article Korean J Fish Aquat Sci 51(1),23-30,2018 넙치 (Paralichthys olivaceus) 근육채취방법에따른 Kudoa septempunctata 진단효율비교 송준영 정승희 1 최혜승 2 * 국립수산과학원남동해수산연구소, 1 국립수산과학원병리연구과, 2 국립수산과학원남해수산연구소
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More informationRheu-suppl hwp
Objective: This paper reviews the existing Korean medical and public health, and nursing academy articles on disease-specific and domain-specific quality of life, and provides recommendations for the universally
More information<5B313132385D32303039B3E220C1A634B1C720C1A632C8A320B3EDB9AEC1F628C3D6C1BE292E687770>
디지털 영상에서의 자막추출을 이용한 자막 특성 분석에 관한 연구 이세열 * 요약 본 연구는 방송 프로그램 제작에 있어서 중요한 역할을 담당하고 있는 영상 자막의 특성과 영상 커 뮤니케이션 기능적인 관점에서 나타나고 있는 현상을 살펴본다. 다양한 방송 프로그램에서 활용되고 있는 디지털 영상 자막의 기능은 단순하게 간략한 정보를 전달하는 기능적인 역할을 수행하였다.
More information06_ÀÌÀçÈÆ¿Ü0926
182 183 184 / 1) IT 2) 3) IT Video Cassette Recorder VCR Personal Video Recorder PVR VCR 4) 185 5) 6) 7) Cloud Computing 8) 186 VCR P P Torrent 9) avi wmv 10) VCR 187 VCR 11) 12) VCR 13) 14) 188 VTR %
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 32(2) : 119~131 (217) DOI: 1.17519/apiculture.217.6.32.2.119 Development of Rapid Detection System for Small Hive Beetle (Aethina tumida) by using Ultra-Rapid PCR
More information<35BFCFBCBA2E687770>
주요개념 : 컴퓨터음란물 접촉자, 성지식, 성태도 남자중학생의 컴퓨터음란물 접촉자와 비접촉자간의 성지식과 태도의 차이 김 영 혜* 이 화 자** 정 향 미*** 1. 연구의 필요성 한국은 I. 서 론 1960 년대 이후부터 시작된 돌진적 산업화 ( 한 상진, 1996) 로 인하여 경제적 부흥을 이루어 집집마다 TV 수상기를 가질 수 있게 되었고 최근에는 PC보급율
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More informationCloning
Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More information뉴스레터6호F?2??訝
February 2009 No.06 Roche Diagnostics Korea Co., Ltd. Focus Tech EDITORIAL February 2009 No.06 Contents Editorial 03 Focus 04 Product 10 Talk 12 Tech 14 Activity 19 Style 22 February 2009 No.06 02 03 FOCUS
More information-07-......
A Depth Interview on Qualification, Role, and Professionalism of Infant/Toddler Teachers Department of Child & Family Studies, Kyung Hee University Associate Professor : Ahn, Sun Hee Department of Early
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
More informationA Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More informationJournal of Educational Innovation Research 2016, Vol. 26, No. 3, pp DOI: Awareness, Supports
Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp.335-363 DOI: http://dx.doi.org/10.21024/pnuedi.26.3.201612.335 Awareness, Supports in Need, and Actual Situation on the Curriculum Reconstruction
More information384 송해덕ㆍ박정수ㆍ권세련, (Groff et al., 1998).,. CyHV CyHV-2 primer,. 재료및방법 실험어 ( cm, g) 12 ( cm,
한수지 51(4), 383-388, 2018 Original Article Korean J Fish Aquat Sci 51(4),383-388,2018 국내양식금붕어 (Carassius auratus) 와수입진주린 (Carassius auratus) 에서 Cyprinid Herpesvirus 2 (CyHV-2) 의검출 송해덕 박정수 권세련 선문대학교수산생명과학과
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jun.; 27(6),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Jun.; 27(6), 495 503. http://dx.doi.org/10.5515/kjkiees.2016.27.6.495 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Design
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
More informationCrt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information<C7D1B1B9B1B3C0B0B0B3B9DFBFF85FC7D1B1B9B1B3C0B05F3430B1C733C8A35FC5EBC7D5BABB28C3D6C1BE292DC7A5C1F6C6F7C7D42E687770>
기혼 여성이 사이버대학에서 상담을 전공하면서 겪는 경험 방기연 (고려사이버대학교 상담심리학과 부교수) * 요 약 본 연구는 기혼 여성의 사이버대학 상담전공 학과 입학에서 졸업까지의 경험을 이해하는 것을 목적으로 한 다. 이를 위해 연구참여자 10명을 대상으로 심층면접을 하고, 합의적 질적 분석 방법으로 분석하였다. 입학 전 에 연구참여자들은 고등교육의 기회를
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More information182 동북아역사논총 42호 금융정책이 조선에 어떤 영향을 미쳤는지를 살펴보고자 한다. 일제 대외금융 정책의 기본원칙은 각 식민지와 점령지마다 별도의 발권은행을 수립하여 일본 은행권이 아닌 각 지역 통화를 발행케 한 점에 있다. 이들 통화는 일본은행권 과 等 價 로 연
越 境 하는 화폐, 분열되는 제국 - 滿 洲 國 幣 의 조선 유입 실태를 중심으로 181 越 境 하는 화폐, 분열되는 제국 - 滿 洲 國 幣 의 조선 유입 실태를 중심으로 - 조명근 고려대학교 BK21+ 한국사학 미래인재 양성사업단 연구교수 Ⅰ. 머리말 근대 국민국가는 대내적으로는 특정하게 구획된 영토에 대한 배타적 지배와 대외적 자주성을 본질로 하는데, 그
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More information338 김승민ㆍ전려진ㆍ박명애ㆍ정현도ㆍ정준범 viral hemorrhagic septicemia (VHS) Scuticocilate,, cm, 1-3.,,.,, cohabitation test. 실험어 재료및방법 2010 (E03), 2011 (E06),
한수지 48(3), 337-345, 2015 Original Article Korean J Fish Aquat Sci 48(3),337-345,2015 제주도여윔증상넙치 (Paralichthys olivaceus) 로부터분리한점액포자충의특성분석 김승민 전려진 1 박명애 2 정현도 3 정준범 * 제주대학교해양의생명과학부, 1 제주대학교수산백신연구센터, 2 국립수산과학원수산생물방역과,
More information230 한국교육학연구 제20권 제3호 I. 서 론 청소년의 언어가 거칠어지고 있다. 개ㅅㄲ, ㅆㅂ놈(년), 미친ㅆㄲ, 닥쳐, 엠창, 뒤져 등과 같은 말은 주위에서 쉽게 들을 수 있다. 말과 글이 점차 된소리나 거센소리로 바뀌고, 외 국어 남용과 사이버 문화의 익명성 등
청소년의 개인, 가정, 학교변인에 따른 비교육적 언어 사용의 차이 229 한국교육학연구 제20권 제3호 The Korea Educational Review 2014. 10. Vol.20. No.3. pp.229-251. 1) 청소년의 개인, 가정, 학교변인에 따른 비교육적 언어 사용의 차이* 강기수 조규판(동아대학교) [요 약] 본 연구의 목적은 청소년의 개인변인인
More information08김현휘_ok.hwp
(Regular Paper) 21 3, 2016 5 (JBE Vol. 21, No. 3, May 2016) http://dx.doi.org/10.5909/jbe.2016.21.3.369 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a), a) An Audio Coding Technique Employing the Inter-channel
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: * The
Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.243-268 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.243 * - 2001 2015 - The Research Trends on Peer Counseling in Elementary and
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More informationAutomated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets
PCR FlashGel System 2013. 04. 24 PCR 2013. 04. 24 순서 1. PCR 이란 2. PCR 실험의기본조건 3. PCR 효소선택가이드 4. Hot Start PCR의원리 5. PCR 실험시 Troubleshooting 6. PCR 장비 _TP350 소개 PCR(Polymerase Chain Reaction) PCR 이란? -
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con
Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency
More information<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
More information<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>
J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2
More information한수지 47(6), , 2014 Original Article Kor J Fish Aquat Sci 47(6), ,2014 한국남해연안에분포하는눈볼대 (Doederleinia berycoides) 의자원생태학적특성치 최정화 최승희 1 * 이동우
한수지 47(6, 901-907, 014 Original Article Kor J Fish Aquat Sci 47(6,901-907,014 한국남해연안에분포하는눈볼대 (Doederleinia berycoides 의자원생태학적특성치 최정화 최승희 1 * 이동우 류동기 국립수산과학원, 1 한국해양수산연구원, 군산대학교 Population Ecology of Blackthroat
More informationKor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More informationDBPIA-NURIMEDIA
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic
More informationDBPIA-NURIMEDIA
무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 901 무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 (A Effective Sinkhole Attack Detection Mechanism for LQI based Routing in WSN) 최병구 조응준 (Byung
More information뉴스지14호-칼라
2 3 4 5 6 TaKaRa Taq TM / TaKaRa Ex Taq TM / TaKaRa LA Taq TM / Pyrobest TM DNA Polymerase/ TaKaRa Z -Taq TM TaKaRa Taq TM TaKaRa Ex Taq TM TaKaRa LA Taq TM TaKaRa Z-Taq TM Pyrobest TM DNA Polymerase 7
More information상담학연구,, SPSS 21.0., t,.,,,..,.,.. (Corresponding Author): / / / Tel: /
,,. 164 -. SPSS 21.0., t,.,,,..,.,.. (Corresponding Author): / / 1 11 404 / Tel: 02-880-7636 / E-mail: dikimedu@snu.ac.kr ...,,, (, 2012),, (,,, 2012a, 2012b;,, 2011;, 2011;,, 2010). (, 2013;, 2012;, ;
More informationSpecial Issue Food borne Parasitic Diseases Jong Yil Chai, M.D. Department of Parasitology and Tropical Medicine Seoul National University College of
Special Issue Food borne Parasitic Diseases Jong Yil Chai, M.D. Department of Parasitology and Tropical Medicine Seoul National University College of Medicine E mail : cjy@snu.ac.kr Abstract This article
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI: * Suggestions of Ways
Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp.65-89 DOI: http://dx.doi.org/10.21024/pnuedi.29.1.201903.65 * Suggestions of Ways to Improve Teaching Practicum Based on the Experiences
More informationAnalysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Feb.; 29(2), 93 98. http://dx.doi.org/10.5515/kjkiees.2018.29.2.93 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) UHF-HF
More informationJournal of Educational Innovation Research 2016, Vol. 26, No. 3, pp DOI: * The Grounds and Cons
Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp.63-81 DOI: http://dx.doi.org/10.21024/pnuedi.26.3.201612.63 * The Grounds and Consequences of the Elementary School Teachers' Trust Formation
More information<28C3D6C1BE29312DC0CCBDC2BEC62E687770>
한국패션디자인학회지 제9권3호 The Korean Society of Fashion Design Vol. 9 No. 3 (2009) pp.1~12 소니아 리키엘 컬렉션에 나타난 니트웨어 색채 특성 The Color Characteristics of Knit Wear Shown in Sonia Rykiel s Collections 이 승 아ㆍ조 주 연ㆍ이 연
More information232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특
한국도시행정학회 도시행정학보 제25집 제4호 2012. 12 : pp.231~251 생활지향형 요소의 근린주거공간 분포특성 연구: 경기도 시 군을 중심으로* Spatial Distribution of Daily Life-Oriented Features in the Neighborhood: Focused on Municipalities of Gyeonggi Province
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 25(3),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2014 Mar.; 25(3), 304310. http://dx.doi.org/10.5515/kjkiees.2014.25.3.304 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More information¼Ò³ª¹«Àç¼±-³»Áö1~41
KOREA FOREST RESEARCH INSTITUTE C o n t e n t s 3 5 8 11 13 25 31 43 61 67 69 74 78 Ⅰ 소나무재선충병 3 4 KOREA FOREST RESEARCH INSTITUTE 5 6 KOREA FOREST RESEARCH INSTITUTE 7 8 KOREA FOREST RESEARCH INSTITUTE
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Sep.; 30(9), 712 717. http://dx.doi.org/10.5515/kjkiees.2019.30.9.712 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) MOS
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: NCS : * A Study on
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.157-176 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.157 NCS : * A Study on the NCS Learning Module Problem Analysis and Effective
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More informationDBPIA-NURIMEDIA
박건수 *, 서태영 **, 김종욱 *** ". 요약 Abstract The induction melting furnace using electric generator has been introduced since 1920s, and it began to be widely applied to industrial applications due to increasing
More information384 Research in Plant Disease Vol. 23 No. 4,, 1. (INSV),,, (vein clearing), (Tomato spotted wilt virus, TSWV),.,,,,,, (Brisco-McCann Hausbeck, 2016; S
식물병연구 Note Open Access Res. Plant Dis. 23(4) : 383-387 (2017) https://doi.org/10.5423/rpd.2017.23.4.383 First Report of Impatiens necrotic spot virus in Hoya carnosa in Korea 1 2 1 1 1 3 1 * 1, 2, 3 *Corresponding
More informationOutput file
240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 An Application for Calculation and Visualization of Narrative Relevance of Films Using Keyword Tags Choi Jin-Won (KAIST) Film making
More information?
http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ
More information44-4대지.07이영희532~
A Spatial Location Analysis of the First Shops of Foodservice Franchise in Seoul Metropolitan City Younghee Lee* 1 1 (R) 0 16 1 15 64 1 Abstract The foodservice franchise is preferred by the founders who
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: A study on Characte
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.381-404 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.381 A study on Characteristics of Action Learning by Analyzing Learners Experiences
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun
More informationMain Title
2003 5140001 IMD WCY IMD 2003 (, 54 ), Competitiveness Valuation International, Inc. Korea Partner of IMD WCY jeong@cvikorea.net page 1 2003, Jin-Ho Jeong, CVI, Korea Partner of IMD +41-25-618-0251 Fax
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information<31325FB1E8B0E6BCBA2E687770>
88 / 한국전산유체공학회지 제15권, 제1호, pp.88-94, 2010. 3 관내 유동 해석을 위한 웹기반 자바 프로그램 개발 김 경 성, 1 박 종 천 *2 DEVELOPMENT OF WEB-BASED JAVA PROGRAM FOR NUMERICAL ANALYSIS OF PIPE FLOW K.S. Kim 1 and J.C. Park *2 In general,
More information<353420B1C7B9CCB6F52DC1F5B0ADC7F6BDC7C0BB20C0CCBFEBC7D120BEC6B5BFB1B3C0B0C7C1B7CEB1D7B7A52E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 13, No. 2 pp. 866-871, 2012 http://dx.doi.org/10.5762/kais.2012.13.2.866 증강현실을 이용한 아동교육프로그램 모델제안 권미란 1*, 김정일 2 1 나사렛대학교 아동학과, 2 한세대학교 e-비즈니스학과
More information구로구민체육센터 여성전용 기구필라테스 강좌 신설 구로구시설관리공단은 신도림생활체육관에서 2014년도부터 시행하여 주민의 큰 호응을 얻고있는 기구필라 테스 강좌를 2015.12.01일자로 구로구민체육센터에 확대 시행하게 되었습니다. 구로구 관내 고객들의 니즈를 반영한 기
01 2015년도 공단의 이모저모 소식을 전해드려요~ 구로구시설관리공단 구로구시설관리공단 제5대 김완호이사장 취임 구로구시설관리공단 제5대 김완호 신임 이사장이 2015.11.02(월) 취임하였습니다. 취임식에서 소통, 배려, 화합의 구정 방침과 공기업의 경영목표인 공익성과 기업성 양면의 조화로운 경영을 위해 모든 분야의 3% 업그레이드, 3% 절약, 경영환경의
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
More information........pdf 16..
Abstract Prospects of and Tasks Involving the Policy of Revitalization of Traditional Korean Performing Arts Yong-Shik, Lee National Center for Korean Traditional Performing Arts In the 21st century, the
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 28(3),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2017 Mar.; 28(3), 163 169. http://dx.doi.org/10.5515/kjkiees.2017.28.3.163 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) PCB
More information<C7D1B9CEC1B7BEEEB9AEC7D03631C1FD28C3D6C1BE292E687770>
설화에 나타난 사회구조와 그 의미 23) 박유미 * 차례 Ⅰ. 문제제기 Ⅱ. 서사 내부의 사회구조 Ⅲ. 사회문제의 해결방식과 그 의미 Ⅳ. 설화와 후대전승과의 상관관계 Ⅴ. 결론 국문초록 삼국유사 의 조에는 왕거인 이야기와 거타지 이야기가 하나의 설화에 묶여 전하고 있는데, 두 이야기는 해결구조에서 차이를
More information09김정식.PDF
00-09 2000. 12 ,,,,.,.,.,,,,,,.,,..... . 1 1 7 2 9 1. 9 2. 13 3. 14 3 16 1. 16 2. 21 3. 39 4 43 1. 43 2. 52 3. 56 4. 66 5. 74 5 78 1. 78 2. 80 3. 86 6 88 90 Ex e cu t iv e Su m m a r y 92 < 3-1> 22 < 3-2>
More information01이정훈(113~127)ok
The Role of Historical Relativity in International Exchange of Culture and Tourism at the Regional Level: A Case of Gyeonggi and Shandong Province Jung-hoon Lee** Kyung-Eun Choi*** Eun-Ja Lee****,.,,.,,.,,.,.,.,,,
More information272 石 堂 論 叢 49집 기꾼이 많이 확인된 결과라 할 수 있다. 그리고 이야기의 유형이 가족 담, 도깨비담, 동물담, 지명유래담 등으로 한정되어 있음도 확인하였 다. 전국적인 광포성을 보이는 이인담이나 저승담, 지혜담 등이 많이 조사되지 않은 점도 특징이다. 아울
271 부산지역 구비설화 이야기꾼의 현황과 특징 정 규 식* 1) - 목 차 - Ⅰ. 서론 Ⅱ. 부산지역 구비설화 이야기꾼의 전반적 현황 1. 이야기꾼의 여성 편중성 2. 구연 자료의 민요 편중성 3. 이야기꾼의 가변적 구연력 4. 이야기 유형의 제한성 5. 이야기꾼 출생지의 비부산권 강세 Ⅲ. 부산지역 구비설화 이야기꾼의 특징 Ⅳ. 결론 개 요 본고의 목적은
More information( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
More information01-15(3)-12(최장경).fm
Res. Plant Dis. 15(3) : 165-169 (2009) Research in Plant Disease The Korean Society of Plant Pathology GM s ü š w Cucumber mosaic virus v y 1 Á y Á»x 1 Á * w w, 1 w y w Comparative Analysis of Coat Protein
More information42(3)-11(p ).fm
The Korean Journal of Microbiology, Vol. 42, No. 3, September 2006, p. 199-204 Copyright 2006, The Microbiological Society of Korea e ³ w ³ w Á Á½ Áx Á 1 Á 2, * w w w w w w e ³ ³ w p w. e ³ w ù š» 30 cm.
More informationDBPIA-NURIMEDIA
냉전적 이산과 탈냉전적 공존의 전망: 교토( 京 都 ) 재일코리안의 구술을 중심으로*1) 김귀옥 국문요약 이 글은 1년 가까운 기간 교토를 현지답사하고 교토 재일코리안의 다양한 사회 적 관계나 삶을 관찰한 후 10명의 구술생애사를 조사한 자료를 통해 작성되었다. 주로 교토 재일코리안 2세대(1명의 1세대와 1명의 3세대 포함)들의 재현적 기억과 생활 속에서
More informationWIDIN - Toolholding Catalogue.pdf
T CH CHUC UCK K 60 ER Strong Torque Power ER Chuck have strong torque power. Slim designed ER Nut were minimized an interruption to workpiece. If using Carbide Drill and coated drill, it can be improve
More informationAbstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
More informationJournal of Educational Innovation Research 2016, Vol. 26, No. 2, pp DOI: * Experiences of Af
Journal of Educational Innovation Research 2016, Vol. 26, No. 2, pp.201-229 DOI: http://dx.doi.org/10.21024/pnuedi.26.2.201608.201 * Experiences of After-school Class Caring by Married Early Childhood
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More information