338 김승민ㆍ전려진ㆍ박명애ㆍ정현도ㆍ정준범 viral hemorrhagic septicemia (VHS) Scuticocilate,, cm, 1-3.,,.,, cohabitation test. 실험어 재료및방법 2010 (E03), 2011 (E06),
|
|
- 종옥 조
- 5 years ago
- Views:
Transcription
1 한수지 48(3), , 2015 Original Article Korean J Fish Aquat Sci 48(3), ,2015 제주도여윔증상넙치 (Paralichthys olivaceus) 로부터분리한점액포자충의특성분석 김승민 전려진 1 박명애 2 정현도 3 정준범 * 제주대학교해양의생명과학부, 1 제주대학교수산백신연구센터, 2 국립수산과학원수산생물방역과, 3 부경대학교수산생명의학과 Characterization of the Myxosporean Parasite Isolated from Emaciated Olive Flounders Paralichthys olivaceus on Jeju Island Seung Min Kim, Lyu Jin Jun 1, Myoung Ae Park 2, Hyun Do Jeong 3 and Joon Bum Jeong* Faculty of Marine Biomedical Science, Jeju National University, Jeju , Korea 1 Fish Vaccine Resarch Center, Jeju National University, Jeju , Korea 2 Aquatic Life Disease Control Division, National Fisheries Research and Development Institute, Busan , Korea 3 Department of Aquatic Life Medicine, Pukyong National University, Busan , Korea To investigate the causes of emaciation in cultured olive flounder Paralichthys olivaceus in Korea. We performed histological examinations and polymerase chain reaction (PCR) with a new primer set. In most cases, the most severe emaciation was observed in the abdominal area Using PCR on extracted livers, kidneys, spleens, gills, brains, and intestines, we found that areas around the kidneys and intestines were as almost always positive. In significantly emaciated fish, PCR was positive in all internal organs except the gills. In addition, the homology of 812-bp nucleotide sequences of the 28S rrna gene was more than 99% in emaciated fish. Partial homology with Myxobolus spp. and Cystodiscus axonis, whose data were obtained from GenBank was 86% and 88%, respectively. Histological examinations detected spores in kidneys and intestines but not in other organs. We also performed cohabitation experiments to determine whether infections could be exchanged among species or only within species. Uninfected olive flounder and red sea bream, Pagrus major, cohabitating with emaciated olive flounder showed 100% and 0% cumulative mortality, respectively. Thus the cause of emaciation in cultured olive flounder of Korea is likely due to a new parasite. Key words: Emaciation disease, Olive flounder, PCR, Spore, Cohabitation experiment 서론 1990 (Takifugu rubripes), (Pagrus major), (Oplegnathus fasciatus), (Paralichthys olivaceus),., (Tun et al., 2000). Tun et al. (2002), 3, Enteromyxum fugu, Enteromyxum leei Leptotheca fugu., (Ogawa and Yokoyama, 2001). Yasuda et al. (2005),, 3 primers PCR. 50% 95% Korean J Fish Aquat Sci 48(3) , June 2015 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial Licens ( permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Received 23 February 2015; Revised 1 June 2015; Accepted 8 June 2015 *Corresponding author: Tel: Fax: address: jeongjb@jejunu.ac.kr Copyright 2014 The Korean Society of Fisheries and Aquatic Science 337 pissn: , eissn:
2 338 김승민ㆍ전려진ㆍ박명애ㆍ정현도ㆍ정준범 viral hemorrhagic septicemia (VHS) Scuticocilate,, cm, 1-3.,,.,, cohabitation test. 실험어 재료및방법 2010 (E03), 2011 (E06), 2012 (E03) 2013 (E12)., tryptic soy agar (Difco Co., USA), thiosulfate citrate bile salts sucrose agar (Difco), Salmonella-Shigella (Difco),,, 25. Cho et al. (2007) viral hemorrhagic septicemia virus (VHSV), viral nervous necrosis virus (VNNV), hirame rhabdovirus (HRV) red seabream iridovirus (RSIV) 4 PCR. DNA 추출,,,,, DNA DNeasy Blood & Tissue Kit (Qiagen Hilden, Germany). 10 mg ATL buffer 180 L proteinase K 20 L 56., AL buffer 200 L ethanol 200 L spin column 6,000 g 1. Column tube AW1 buffer 500 L AW2 buffer 500 L, AE buffer 50 L DNA. DNA -20. Primer 제작, E. leei small subunit ribosomal DNA gene (SSU rdna) MM18Sf/MM18Sr primer set (1,589 bp) (Table 1) DNA PCR, PCR. GenBank (NCBI, USA) (Myxidium sp.) degenerated primers, DNA PCR, DNA sequencing EM-F/EM-R primer set (Table 1). PCR 및 DNA sequencing PCR microtube 1 M primer, 2.5 mm dntp, 10 G-Taq Buffer, 2.5 U G-Taq DNA polymerase (Gene Pro Themal Cycler Cosmo, Korea) template DNA distilled water PCR volume 20 L. PCR 95 3 predenaturation, denaturation, annealing, extension 1 cycle, 35 cycles., 72 7 postextension. PCR 1 TAE buffer (40 Mm Tris-acetate, 1 mm EDTA), 0.5 g/ L ethidium bromide 1% agarose gel, UV band. PCR gel purification kit (Bioneer, Korea) Table 1. PCR primers used for the detection of new pathogen MM18S-F MM18S-R 28S-F 28S-R EM-F EM-R Primer Oligonucleotide sequence (5'-3') Expected sizes Function CTGGTTGATTCTGCCAGTGGTC CGGTACTAGCGACGGGCG CTAGGGGAATCCGACTGT ATCAAACTAGAGTCAAGC CAACCGCAATGTGTTTACTC CCAAACAACCTGCCACAATG 1,589 bp 313 bp 812 bp Detection of E. leei (Palenzuela et al., 2002) House keeping gene (28S ribosomal RNA) Detection of new pathogen (in this study)
3 원인불명여윔증진단 339, ToPo TA cloning kit (Invitrogen, USA) cloning (Solgent, Korea). 조직병리학적분석, Edwardsiella tarda, Vibrio harveyi Streptococcus sp.. Viral hemorrhagic septicemia virus (VHSV), viral nervous,,,,, Bouin's solution 24 70% EtOH. (Leica EG 1150HC, Germany) (Leica Jung 820, Germany). 4-5 m. haematoxylin eosin (H&E) (Zeiss LT60, Germany). 어류간의전이실험 Ishimatsu et al., (2007) cohabitation. PCR donor group, recipient group. ( cm, g) 15 ( cm, g) 15 cohabitation. 100 L recipient group L, 10 ( cm, g) 10 cohabitation ,., PCR. Fig. 1. The external (A) and internal (B) signs of the emaciated olive flounder Paralichthys olivaceus. 결과 여윔증의원인체검출,, (Tun et al., 2000) (Fig. 1A, 1B)., 5-8 m, 7-9 m (Fig. 2), Fig. 2. The spore from the intestine of emaciated olive flounder Paralichthys olivaceus. Bar=10 μm.
4 340 김승민ㆍ전려진ㆍ박명애ㆍ정현도ㆍ정준범 necrosis virus (VNNV), hirame rhabdovirus (HRV) red seabream iridovirus (RSIV) 4 viruses (data not shown). EM-F/EM-R primer set PCR (Table 1),, (Fig. 3). PCR,,,,., PCR (Fig. 3). PCR products, 99%, (Fig. 4). GenBank database, 150 bp Myxobolus sp. (Accession No. JN ) Cystodiscus axonis (Accession No. JN ) 86% 88%, GenBank. 조직병리학적검사,, Fig. 3. PCR amplification from nucleic acids of internal organs from the emaciated olive flounder Paralichthys olivaceus in the level stages of infection. Lanes 1, 7, 13 and 19, Kidney; lanes 2, 8, 14 and 20, Intestine; lanes 3, 9, 15 and 21, Spleen; lanes 4, 10, 16 and 22, Liver; lanes 5, 11, 17 and 23, Brain ; lanes 6, 12, 18 and 24, Gill; M, 1 kb DNA ladder.
5 원인불명여윔증진단 341 Fig. 4. Comparison analysis of the DNA nucleotide sequences of pathogens detected from the emaciated olive flounder Paralichthys olivaceus. Primers used in PCR are in boxes.
6 342 김승민ㆍ전려진ㆍ박명애ㆍ정현도ㆍ정준범,,, (plasmodium) (Fig. 5A and 5B)., (Fig. 5C and 5D)., (data not shown). 어류간의전이실험 PCR, 2 groups donor 3 100%, recipient % (Fig. 6A). recipient group donor group 7, recipient group PCR, 73.3% (Table 2),, donor fish (Fig. 7)., 3 donor group 100%, recipient group (Fig. 6B), PCR (Table 2). (data not shown). 고찰,, Fig. 5. Histological findings of kidney (A, 200 and B, 400) and intestine (C, 200 and D, 400) from the emaciated olive flounder Paralichthys olivaceus. H & E stain. Bar = 20 μm.
7 원인불명여윔증진단 343 (A) (B) Cumulative mortality (%) Cumulative mortality (%) Day Day Fig. 6. Cumulative mortality (%) of olive flounder Paralichthys olivaceus (A) and red seabream Pagrus major (B) after cohabitated with the emaciated olive flounder., emaciated olive flounder; and, cohabitated olive flounder and red sea bream, respectively. Fig. 7. Histological findings of kidney (A, 200 and B, 400) and intestine (C, 200 and D, 400) from the recipient olive flounder Paralichthys olivaceus cohabitated with the emaciated olive flounder. H & E stain. Bar=20 μm. Table 2. Infection rate (%) of olive flounder Paralichthys olivaceus and red seabream Pagrus major after cohabitated with the emaciated olive flounder Donor fish (olive flounder) Recipient fish (olive flounder) Donor fish (olive flounder) Recipient fish (red seabream) PCR Positive 100% (15/15) 73.3% (11/15) 100% (10/10) 0% (0/10)
8 344 김승민ㆍ전려진ㆍ박명애ㆍ정현도ㆍ정준범.,, 30-40% (data not shown),. Choi et al. (2012) E. tarda, V. harveyi,., 5-8 m, 7-9 m (Fig. 2), (Tetsuza et al., 2004). Tun et al. (2002) E. fugu, E. leei L. fugu. SSU rdna gene MM18Sf/MM18Sr primer set (Palenzuela et al., 2002; Yasuda et al., 2005) PCR. Choi et al. (2012), primer set PCR. primer set (EM-F/EM-R) (Table 1), PCR band (Fig. 3),,., DNA nucleotide sequences 99% (Fig. 4)., GenBank Myxobolus sp. Cystodiscus axonis 80% GenBank database., DNA walking. sharpsnout sea bream Puntazzo puntazzo, red sea bream Pagrus major, red drum Sciaenops ocellatus Myxidium leei (Le Breton and Marques, 1995; Diamant, 1998; Athanassopoulou et al., 1999)., Myxosporea turbot, Scophthalmus maximus turbot (Beaman et al., 1999). Bartholomew et al. (1989) Ceratomyxa shasta., (Tun et al., 2002).,,,,.,,,. E. leei donor fish cohabitaiton, E. leei (Diamant, 1997; Yasuda et al., 2002). (Table 2), PCR.,,, cohabitation, GenBank.,,,. 사사 ( ). References Athanassopoulou F, Prapas T and Rodger H Diseases of Puntazzo puntazzo cuvier in marine aquaculture systems in Greece. J Fish Dis 22, Bartholomew JL, Smith CH, Rohovec JS and Fryer JL Characterization of a host response to the myxosporean parasite, Ceratomyxa shasta (Noble), by histology, scanning electron microscopy and immunological techniques.
9 원인불명여윔증진단 345 J Fish Dis 12, tb00561.x. Beaman HJ, Speare DJ, Brimacombe M and Daley J Evaluating protection against Loma salmonae generated from primary exposure of rainbow trout, Oncorhynchus mykiss (Walbaum), outside of the xenoma-expression temperature boundaries. J Fish Dis 22, 445, org/ /j x. Cho MY, Kim MS, Kwon MG, Jee BY, Choi HS, Choi DL, Park GH, Lee CH, Kim JD, Lee JS, Oh YK, Lee DC, Park SH and Park MA Epidemiological study of bacterial diseases of cultured olive flounder, Paralichthys olivaceus from 2005 to 2006 in Korea. J Fish Pathol 20, Choi HS, Jun LJ, Kim SM, Jeong HD, Kim YK, Lim H, Yeo Ik and Jeong JB Clinical features of fish with pathogens isolated from emaciated olive flounder Paralichthys oliveaceus. J Fish Pathol 25, Diamant A Fish-to-fish transrmission of a marine myxosporean. Dis Aquat Org 30, Diamant A Red drum Sciaenops ocellatus (Sciaenidae), a recent introduction to Mediterranean mariculture, is susceptible to Myxidium leei (Myxosporea). Aquaculture 162, Ishimatsu A, Hayashi M, Nakane M and Sameshima M Pathophysiology of cultrured tiger puffer Takifugu rubripes suffering from the myxosporean emaciation disease. Fish Pathol 42, Le Breton A and Marques A Occurrence of a histozoic Myxidium infection in two marine cultured species: Puntazzo puntazzo C and Pagrus major. Bull Fish Pathol 15, Ogawa K and Yokoyama H Emaciation disease of cultured tiger puffer Takifugu rubripes. Bull Aquacult Suppl 5, Palenzuela O, Redondo MJ and Alvarez-Pellitero P Description of Enteromyxum scophthalmi gen. nov., sp. nov. (Myxozoa), an intestinal patasite of turbot (Scophthalmus maximus L.) using morphological and ribosomal RNA sequence data. Parasitology 124, org/ /s Tetsuya Y, Yoshinori N, Takeshi K, Yutaka F, Hiroshi Y and Kazuo O Molecular and Morphological Redescriptions of Enteric Myxozoans, Enteromyxum leei (formerly Myxidium sp. TP) and Enteromyxum fugu comb.n.(syn, Myxidium fugu) from cultrured Tiger puffer. J Fish Pathol 39, Tun T, Yokoyama H, Ogawa K and Wakabayashi H Myxosporeans and their hyperparasitic microsporeans in the intestine of emaciated tiger puffer. J Fish Pathol 35, Tun T, Ogawa K and Wakabayashi H Pathological changes induced by three myxosporeans in the intestine of cultured tiger puffer, Takifugu rubripes (Temminck and Schlegel). J Fish Pathol 25, j x. Yasuda H, Ooyama T, lwata K, Tun T, Yokoyama H and Ogawa K Fish-to-fish transmission of Myxidium sp. (Myxozoa) in cultured tiger puffer suffering from emaciation disease. J Fish Pathol 37, jsfp Yasuda H, Ooyama T, Nakamura A, lwata K, Palenzuela O and Yokoyama H Occurrence of the myxosporean emaciation disease caused by Enteromyxum leei in cultured Japanese flounder Paralichthys olivaceus. Fish Pathol, 40,
VHS 및 RSIVD 모니터링 177 al., 2001) (World Organization for Animal Health, OIE). VHSV Rhabdoviridae Novirhabdovirus RNA 6 gene nucleocapsid protein (N), p
한수지 49(2), 176-183, 2016 Original Article Korean J Fish Aquat Sci 49(2),176-183,2016 2015 년제주도양식넙치 (Paralichthys olivaceus) 를대상으로한 VHS 및 RSIVD 모니터링 박현경 전려진 1 김승민 박명애 2 조미영 2 황성돈 2 박신후 2 정현도 3 정준범 * 제주대학교해양의생명과학부,
More information한수지 51(1), 23-30, 2018 Original Article Korean J Fish Aquat Sci 51(1),23-30,2018 넙치 (Paralichthys olivaceus) 근육채취방법에따른 Kudoa septempunctata 진단효율비교 송준영
한수지 51(1), 23-30, 2018 Original Article Korean J Fish Aquat Sci 51(1),23-30,2018 넙치 (Paralichthys olivaceus) 근육채취방법에따른 Kudoa septempunctata 진단효율비교 송준영 정승희 1 최혜승 2 * 국립수산과학원남동해수산연구소, 1 국립수산과학원병리연구과, 2 국립수산과학원남해수산연구소
More information한수지 47(5), , 2014 Original Article Kor J Fish Aquat Sci 47(5), ,2014 서해안천수만일대양식조피볼락 (Sebastes schlegeli) 의상피선충감염현황 서한길 서정수 류민경 이은혜 권세련 1
한수지 47(5), 603-610, 2014 Original Article Kor J Fish Aquat Sci 47(5),603-610,2014 서해안천수만일대양식조피볼락 (Sebastes schlegeli) 의상피선충감염현황 서한길 서정수 류민경 이은혜 권세련 1 강종순 2 노윤산 2 최혜승 정승희 한현자 * 국립수산과학원병리연구과, 1 선문대학교수산생명의학과,
More information<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한
More information398 이다원ㆍ전려진ㆍ김승민ㆍ정준범 (Lee and Kim, 2013)., Em (Lee et al., 2016) Korean statistical information service (KOSIS),,., Em (Han et al., 2012; Sung et
한수지 51(4), 397-403, 2018 Original Article Korean J Fish Aquat Sci 51(4),397-403,2018 제주지역양식넙치 (Paralichthys olivaceus) 에서분리한어병세균내 Erythromycin 내성유전자분석 이다원 전려진 김승민 1 정준범 * 제주대학교해양의생명과학부, 1 주식회사우진비앤지 Analysis
More information42(3)-11(p ).fm
The Korean Journal of Microbiology, Vol. 42, No. 3, September 2006, p. 199-204 Copyright 2006, The Microbiological Society of Korea e ³ w ³ w Á Á½ Áx Á 1 Á 2, * w w w w w w e ³ ³ w p w. e ³ w ù š» 30 cm.
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information384 송해덕ㆍ박정수ㆍ권세련, (Groff et al., 1998).,. CyHV CyHV-2 primer,. 재료및방법 실험어 ( cm, g) 12 ( cm,
한수지 51(4), 383-388, 2018 Original Article Korean J Fish Aquat Sci 51(4),383-388,2018 국내양식금붕어 (Carassius auratus) 와수입진주린 (Carassius auratus) 에서 Cyprinid Herpesvirus 2 (CyHV-2) 의검출 송해덕 박정수 권세련 선문대학교수산생명과학과
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More information10(3)-09.fm
w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½
More information135 Jeong Ji-yeon 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 머리말 협저불상( 夾 紵 佛 像 )이라는 것은 불상을 제작하는 기법의 하나로써 삼베( 麻 ), 모시( 苧 ), 갈포( 葛 ) 등의 인피섬유( 靭 皮 纖 維 )와 칠( 漆 )을 주된 재료
MUNHWAJAE Korean Journal of Cultural Heritage Studies Vol. 47. No. 1, March 2014, pp.134~151. Copyright 2014, National Research Institute of Cultural Heritage 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 정지연 a 明 珍 素 也
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information732 서한길ㆍ서정수ㆍ류민경ㆍ이은혜ㆍ정승희ㆍ한현자 (Moravec and Harrison, 1989; Moravec and Wang, 2002; Wijová et al., 2006).,,,., Philometridae., (Edward, 1996). Seo et al.
한수지 48(5), 731-738, 2015 Original Article Korean J Fish Aquat Sci 48(5),731-738,2015 조피볼락 (Sebastes schlegeli) 선충 (Nematode: Philometridae) 에대한분자생물학적동정및 PCR 검출법개발 서한길 서정수 류민경 이은혜 정승희 한현자 * 국립수산과학원병리연구과
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More information2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285
13 2 ( 25 ) 2004 12 Korean J Med Hist 13 284 296 Dec 2004 ISSN 1225 505X 1) * ** ** 1 1920 1930 40 ( 1896-1973) 80 * ** 1) 2003 284 2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914
More information22(3)-07.fm
J. Fd Hyg. Safety Vol. 22, No. 3, pp. 179~191 (2007),QWTPCN QH (QQF *[IKGPG CPF 5CHGV[ Available online at http://www.foodhygiene.or.kr Î ÜôÚ ò Ù Â 1 Â 2 Âú äâ Ö 3 Â Ùý* w w w, 1 w tœw, 2 w yw, 3 w yl
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More information<35BFCFBCBA2E687770>
주요개념 : 컴퓨터음란물 접촉자, 성지식, 성태도 남자중학생의 컴퓨터음란물 접촉자와 비접촉자간의 성지식과 태도의 차이 김 영 혜* 이 화 자** 정 향 미*** 1. 연구의 필요성 한국은 I. 서 론 1960 년대 이후부터 시작된 돌진적 산업화 ( 한 상진, 1996) 로 인하여 경제적 부흥을 이루어 집집마다 TV 수상기를 가질 수 있게 되었고 최근에는 PC보급율
More information<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>
J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2
More information00약제부봄호c03逞풚
경희대학교 동서신의학병원 약품 정보지 2 0 0 7. S P R I N G. V O L. 0 1 신약 소개 02 Journal Review 03 Special Subject 04 복약 지도 06 의약품 안전성 정보 07 약제부 알림 07 약제부 업무 소개 08 E A S T - W E S T N E O M E D I C A L C E N T E R 본 약품
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
More informationDBPIA-NURIMEDIA
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More information[ 영어영문학 ] 제 55 권 4 호 (2010) ( ) ( ) ( ) 1) Kyuchul Yoon, Ji-Yeon Oh & Sang-Cheol Ahn. Teaching English prosody through English poems with clon
[ 영어영문학 ] 제 55 권 4 호 (2010) 775-794 ( ) ( ) ( ) 1) Kyuchul Yoon, Ji-Yeon Oh & Sang-Cheol Ahn. Teaching English prosody through English poems with cloned native intonation. The purpose of this work is to
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 32(2) : 119~131 (217) DOI: 1.17519/apiculture.217.6.32.2.119 Development of Rapid Detection System for Small Hive Beetle (Aethina tumida) by using Ultra-Rapid PCR
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information°Ç°�°úÁúº´6-2È£
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information13장문현(541~556)ok
A Study on the Spatial Distribution of Local Foods and Regional Products in the Seomjin River Area* Jeong-ok Kim**Mal-shick Shin***Jeong-rock Lee****Mun-hyun Jang*****,,,,,,,,,. 36, 15, 14, 5, 19. 32,
More information슬라이드 1
EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase
More information가자미식해의제조공정최적화 37., (Choi et al., 200).. 재료 재료및방법 (Verasper Jordan et Gilbert;, ), (, ), (, ) (, )., (, ), (, ), (, ), (, ), (, ), (, ). 가자미식해제조 (round
한수지 48(), 036-043, 205 Original Article Kor J Fish Aquat Sci 48(),036-043,205 반응표면분석법을이용한가자미 (Verasper moseri Jordan et Gilbert) 식해제조최적화 한대원 김덕기 한호준 조순영 2 * 강릉원주대학교식품과학과, 강릉원주대학교동해안해양생물자원연구센터, 2 강릉원주대학교식품가공유통학과
More information°Ç°�°úÁúº´5-44È£ÃÖÁ¾
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis
More information현대패션의 로맨틱 이미지에 관한 연구
한지닥섬유제품의인체생리반응및쾌적성평가 임순 Evaluation of Thermal Physiological Responses and Comfort in Dox Fabric Soon Im Professor, Dept. of Fashion Industry, Incheon National University This study performed the evaluation
More information???? 1
The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More informationDBPIA-NURIMEDIA
Mass-production of Four Specific Proteins Originated from Deformed Wing Virus, Honeybee-viral Pathogen Joo-seong Lee, Giang Thi Huong Luong and Byoung-Su Yoon* Department of Life Science, College of Natural
More information한수지 49(6), , 2016 Original Article Korean J Fish Aquat Sci 49(6), ,2016 Photobacterium damselae 의디스크확산법결과에대한 Epidemiological Cut-off Valu
한수지 49(6), 838-844, 2016 Original Article Korean J Fish Aquat Sci 49(6),838-844,2016 Photobacterium damselae 의디스크확산법결과에대한 Epidemiological Cut-off Value 의결정 권문경 임윤진 1 김명석 2 서정수 김도형 1 * 국립수산과학원방역과, 1 부경대학교수산생명의학과,
More information433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
More information04김호걸(39~50)ok
Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More informationDBPIA-NURIMEDIA
JFM SE, 29(3), pp. 834~846, 2017. www.ksfme.or.kr 수산해양교육연구, 제29권제3 호, 통권87 호, 2017. http://dx.doi.org/10.13000/jfmse.2017.29.3.834 2016 년도제주지역양식넙치(Paralichthys olivaceus ) 에서분리된어병세균의 tetracycline 내성유전자분포
More information1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More informationAutomated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets
PCR FlashGel System 2013. 04. 24 PCR 2013. 04. 24 순서 1. PCR 이란 2. PCR 실험의기본조건 3. PCR 효소선택가이드 4. Hot Start PCR의원리 5. PCR 실험시 Troubleshooting 6. PCR 장비 _TP350 소개 PCR(Polymerase Chain Reaction) PCR 이란? -
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More information<313430333033C6AFC1FD28C3E0B1B8292E687770>
스포츠와 물리학: 구기운동 안티-싸커 와 간접-축구 DOI: 10.3938/PhiT.23.005 이 인 호 Anti-soccer and Indirect Soccer 편성은 없다고 장담한다. 벨기에(FIFA 랭킹 11위), 러시아 (FIFA 랭킹 22위), 알제리(FIFA 랭킹 26위), 그리고 한국(FIFA 랭킹 61위)으로 이어지는 H조 편성 결과이다. 이
More information황지웅
Comparison of Laparoscopy and Exploration in the Distal Pancreatectomy BACKGROUND: To determine the benefits of laparoscopic surgery compared with exploration, the clinical outcomes of open and laparoscopic
More informationDBPIA-NURIMEDIA
무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 901 무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 (A Effective Sinkhole Attack Detection Mechanism for LQI based Routing in WSN) 최병구 조응준 (Byung
More information27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)
More informationAbstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
More information05052유식안101.hwp
제 출 문 식품의약품안전청장 귀 하 이 보고서를 유전자재조합식품 모니터링(부산광역시보건환경연구원/정구영) 과제의 연구 결과보고서로 제출합니다. 2005. 11. 30 주관연구기관명 : 부산광역시보건환경연구원 주관연구책임자 : 정구영 목 차 Ⅰ. 연구개발결과 요약문----------------------------------- 1 (한글)------------------------------------------
More information04조남훈
Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache
More information서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소
2012 년도기초과학연구소 대학중점연구소심포지엄 마이크로파센서를이용한 혈당측정연구 일시 : 2012 년 3 월 20 일 ( 화 ) 14:00~17:30 장소 : 서강대학교과학관 1010 호 주최 : 서강대학교기초과학연구소 Contents Program of Symposium 2 Non-invasive in vitro sensing of D-glucose in
More information16(2)-7(p ).fm
w wz 16«2y Kor. J. Clin. Pharm., Vol. 16, No. 2. 2006 ü t xy y w tœ ½ BÁ x BC B y w w w C y w w w Current Status and Expectations of Orphan Drugs in Korea -In point of supplying medicines for the rare
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More information아니라 일본 지리지, 수로지 5, 지도 6 등을 함께 검토해야 하지만 여기서는 근대기 일본이 편찬한 조선 지리지와 부속지도만으로 연구대상을 한정하 기로 한다. Ⅱ. 1876~1905년 울릉도 독도 서술의 추이 1. 울릉도 독도 호칭의 혼란과 지도상의 불일치 일본이 조선
근대기 조선 지리지에 보이는 일본의 울릉도 독도 인식 호칭의 혼란을 중심으로 Ⅰ. 머리말 이 글은 근대기 일본인 편찬 조선 지리지에 나타난 울릉도 독도 관련 인식을 호칭의 변화에 초점을 맞춰 고찰한 것이다. 일본은 메이지유신 이후 부국강병을 기도하는 과정에서 수집된 정보에 의존하여 지리지를 펴냈고, 이를 제국주의 확장에 원용하였다. 특히 일본이 제국주의 확장을
More information..........5-45..
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals
More informationA Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
More information제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상
6차 산업 수익모델 시범사업 농산물가공품개발 연구용역 최 종 보 고 서 영남대학교 식품공학과 연구책임자 : 한 기 동 제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김
More information한수지 47(6), , 2014 Original Article Kor J Fish Aquat Sci 47(6), ,2014 배합사료및습사료공급에따른넙치 (Paralichthys olivaceus) 의성장및어체성분비교 김강웅 이진혁 배기민 김경덕
한수지 47(6), 810-817, 2014 Original Article Kor J Fish Aquat Sci 47(6),810-817,2014 배합사료및습사료공급에따른넙치 (Paralichthys olivaceus) 의성장및어체성분비교 김강웅 이진혁 배기민 김경덕 이봉주 한현섭 김성삼 * 국립수산과학원사료연구센터 Comparison of Extruded
More information°í¼®ÁÖ Ãâ·Â
Performance Optimization of SCTP in Wireless Internet Environments The existing works on Stream Control Transmission Protocol (SCTP) was focused on the fixed network environment. However, the number of
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More informationDBPIA-NURIMEDIA
27(2), 2007, 96-121 S ij k i POP j a i SEXR j i AGER j i BEDDAT j ij i j S ij S ij POP j SEXR j AGER j BEDDAT j k i a i i i L ij = S ij - S ij ---------- S ij S ij = k i POP j a i SEXR j i AGER j i BEDDAT
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More information2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, )
Abstract Kim Dal-Rae, Kim Sun-Hyung* Dept. of Sasang Constitutional Medicine, College of Oriental Medicine, Kyung-Hee Univ. *Dept. of Sasang Constitutional Medicine, East-West Neo Medical Center, Kyung-Hee
More information<C7A5C1F620BEE7BDC4>
연세대학교 상경대학 경제연구소 Economic Research Institute Yonsei Universit 서울시 서대문구 연세로 50 50 Yonsei-ro, Seodaemun-gS gu, Seoul, Korea TEL: (+82-2) 2123-4065 FAX: (+82- -2) 364-9149 E-mail: yeri4065@yonsei.ac. kr http://yeri.yonsei.ac.kr/new
More information182 동북아역사논총 42호 금융정책이 조선에 어떤 영향을 미쳤는지를 살펴보고자 한다. 일제 대외금융 정책의 기본원칙은 각 식민지와 점령지마다 별도의 발권은행을 수립하여 일본 은행권이 아닌 각 지역 통화를 발행케 한 점에 있다. 이들 통화는 일본은행권 과 等 價 로 연
越 境 하는 화폐, 분열되는 제국 - 滿 洲 國 幣 의 조선 유입 실태를 중심으로 181 越 境 하는 화폐, 분열되는 제국 - 滿 洲 國 幣 의 조선 유입 실태를 중심으로 - 조명근 고려대학교 BK21+ 한국사학 미래인재 양성사업단 연구교수 Ⅰ. 머리말 근대 국민국가는 대내적으로는 특정하게 구획된 영토에 대한 배타적 지배와 대외적 자주성을 본질로 하는데, 그
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Sep.; 30(9), 712 717. http://dx.doi.org/10.5515/kjkiees.2019.30.9.712 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) MOS
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con
Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency
More information2 佛敎學報 第 48 輯 서도 이 목적을 준수하였다. 즉 석문의범 에는 승가의 일상의례 보다는 각종의 재 의식에 역점을 두었다. 재의식은 승가와 재가가 함께 호흡하는 공동의 場이므로 포 교와 대중화에 무엇보다 중요한 역할을 수행할 수 있다는 믿음을 지니고 있었다. 둘째
한국 근대불교의 대중화와 석문의범* 29)韓 相 吉 ** 차 례 Ⅰ. 머리말 1. 불자필람 의 구성 Ⅱ. 석문의범의 간행 배경 2. 석문의범 의 구성과 내용 1. 조선후기 의례집의 성행 Ⅳ. 근대불교 대중화와 석문의범 2. 근대불교 개혁론과 의례 Ⅲ. 석문의범의 체재와 내용 간행의 의미 Ⅴ. 맺음말 한글요약 釋門儀範 은 조선시대에 편찬된 각종 의례서와 의식집을
More informationCrt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 30(3),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Mar.; 30(3), 223 228. http://dx.doi.org/10.5515/kjkiees.2019.30.3.223 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Analysis
More information(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re
EMF Health Effect 2003 10 20 21-29 2-10 - - ( ) area spot measurement - - 1 (Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jun.; 27(6),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Jun.; 27(6), 495 503. http://dx.doi.org/10.5515/kjkiees.2016.27.6.495 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Design
More informationDevelopment of culture technic for practical cultivation under structure in Gastrodia elate Blume
Development of culture technic for practical cultivation under structure in Gastrodia elate Blume 1996. : 1. 8 2. 1 1998. 12. : : ( ) : . 1998. 12 : : : : : : : : : : - 1 - .. 1.... 2.. 3.... 1..,,.,,
More information<BFA9BAD02DB0A1BBF3B1A4B0ED28C0CCBCF6B9FC2920B3BBC1F62E706466>
001 002 003 004 005 006 008 009 010 011 2010 013 I II III 014 IV V 2010 015 016 017 018 I. 019 020 021 022 023 024 025 026 027 028 029 030 031 032 033 034 035 036 037 038 039 040 III. 041 042 III. 043
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More informationDBPIA-NURIMEDIA
박건수 *, 서태영 **, 김종욱 *** ". 요약 Abstract The induction melting furnace using electric generator has been introduced since 1920s, and it began to be widely applied to industrial applications due to increasing
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 16 Jul.; 27(7), 64662. http://dx.doi.org/./kjkiees.16.27.7.646 ISSN 1226-3133 (Print)ISSN 2288-226 (Online) 2D Microwave Image
More information< FC7D0C8B832C2F7BCF6C1A45FC7D1B1B9BEEEBAB4C7D0C8B D335F5F5F D B9DABCBABFEC20B1D7B8B2312E B0ADC7FDB9CE D D33C0FCBACEC4AEB6F32E687770>
한국어병학회지제26권제3호 (2013) www.ksfp.org J. Fish Pathol., 26(3) : 129~137 http://dx.doi.org/10.7847/jfp.2013.26.3.129 2012 년제주의양식넙치및자연산어류의 Kudoa septempunctata 감염조사 송준영 최준호 최혜승 정승희 박명애 *1) 국립수산과학원병리연구과 수산생물방역과
More information( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More information