DBPIA-NURIMEDIA

Size: px
Start display at page:

Download "DBPIA-NURIMEDIA"

Transcription

1 JFM SE, 29(3), pp. 834~846, 수산해양교육연구, 제29권제3 호, 통권87 호, 년도제주지역양식넙치(Paralichthys olivaceus ) 에서분리된어병세균의 tetracycline 내성유전자분포 이다원ㆍ전려진ㆍ정준범 ( 제주대학교 ) Distribution of Tetracycline Resistance Genes in Pathogenic Bacteria Isolated from Cultured Olive Flounder (Paralichthys olivaceus) in Jeju in 2016 Da-Won LEEㆍLyu-Jin JUNㆍJoon-Bum JEONG (Jeju National University) Abstract Aquaculture practices to ensure greater production, such as high density breeding and excessive feeding, are become stressors that raise the prevalence of diseases. Accordingly, increasingly large volumes of antibiotics are used more frequently each year. Long term use antibiotics can generate resistant bacteria, which interrupt treatments and cause a potential transfer to human bodies. Thus, antibiotic resistance is of importance in public health. Tetracycline (Tc) is one of the typical medicines used in the aquaculture drugs, which has a wide range of application including gram-positive and gram-negative bacteria. In the examination of 153 strains isolated from olive flounder (Paralichthys olivaceus) farms located in Jeju in 2016, it turned out that a total of 84 strains were resistant to Tc or oxytetracycline (OTC). The extent to which the strains are resistant to Tc and OTC was confirmed through MIC test, mostly within the range of 25 to 100 μg/ ml. Twelve different types of tet genes were detected using single and multiplex PCR in the 84 Tc-resistant strains. The PCR was used to find tet(k), tet(m), tet(o), and tet(s), which are known to exist primarily in gram positive strains. According to the results, tet(s) is the most dominant gene in 49 strains of Streptococcus parauberis, accounting for 63.2%. And there were two strains that have two different types of resistant genes. The multiplex PCR was used to detect tet(a), tet(b), tet(c), tet(d), tet(e), and tet(g), which are commonly found in gram-negative strains. Each of tet(b), tet(d), and tet(b)&(m) was found in a strain presumed to be Vibrio sp., and only tet(d) was found in 10 Edwardsiella tarda strains. Key words : Olive flounder, Resistance, Tetracycline, Oxytetracycline, Streptococcus parauberis Ⅰ. 서론 우리나라의어류양식산업은 1980년대부터시 작하여지속적으로성장해왔으며, 제주도내넙 치양식은 2015년 27,142톤으로우리나라넙치 생산량의절반이상을차지하고있는대표적양 식대상어종이다 (KOSIS, 2016). 지속적인양식산 업의성장으로인해수산생물의생산량이증가하 Corresponding author : ,

2 면서고밀도사육등의이유로수산생물의질병 발생률도함께증가하고있으며, 양식현장에서 생산성향상과감염증치료등의목적으로수산 용의약품의사용량및사용빈도는매년증가하고 있다(Kim et al., 2014). 이러한항생제의사용은 항생제내성균발생, 다제내성균의출현, 약물 잔류에의한안전성및약물의유실로인한환경 오염등의문제를야기할수있다. 수년간항생 제의오 남용으로인해발생한내성균으로감염 증치료의어려움이있어최근에는예방대책으로 백신의개발및천연물질을사용하여어체내생 리활성증가시키는등의방법이나오고있으나, 아직까지많은양식현장에서항생제가사용되고 있다 (Kim et al., 2009; Jee et al., 2014). 테트라사이클린 (Tc) 은대표적인수산용의약품 중하나로, 호기성그람양성및그람음성균, Richettsia, Mycoplasma, Chlamydia, 말라리아등 여러감염증에작용하는광범위항생제로알려져 있다. 테트라사이클린, 옥시테트라사이클린, 클로 르테트라사이클린등은구조적으로유사하고약 리작용및독성이거의동일하여테트라사이클린 계항생제로통합하여평가및관리되며, 테트라 사이클린계열항생제의세포벽합성억제작용기 작은세균 ribosome 의 30S subunit 에결합하여, acceptor 부위에 aminoacyl trna 가 mrna 와결합 하는것을방해하는방법으로단백질합성을억 제시켜정균작용을나타낸다. 테트라사이클린에 대해내성을갖는세균은 1950 년대처음으로확 인된이후현재다양한세균에서내성이증가하 여감염증치료에사용하기어려운경우가많아 졌다. 테트라사이클린계항생제의내성발생기 작은 3 가지로구분할수있으며, (1) 세포내로 침투한 tetracycline 을에너지의존성유출 (efflux) 을통해세포외로배출하여 ribosome 에축적되 지않게하는기작 (efflux pump), (2) 단백질합성 을위해 ribosome 에결합하는것을돕는보호단 백질을생산하는기작 (ribosomal protection), (3) 대사효소를활성화시켜 tetracycline 을불활성화 시키는기작 (enzymatic activation) 으로 tet(a), tet(b), tet(c), tet(d), tet(e), tet(g), tet(h), tet(i), tet(j), tet(k), tet(l) 및 tet(z) 는 efflux pump 에관 여하며, tet(m), tet(o), tet(s), tet(t) 및 tet(w) 는 ribosomal protection, tet(x) 는효소적기능에관여 하는것으로알려져있다 (Chopra and Roberts, 2001; Levy et al., 1999). 항생제내성균의증가는질병치료의어려움뿐 아니라축산물이나수산물을통해항생제내성균 이사람으로전달될위험이높은것으로알려져 항생제내성문제는공중보건학적으로중요하게 대두되고있으며, 항생제사용및세균의항생제 내성현황조사는치료용항생제의선택과내성 균의증가를막기위한대책수립의기초자료로 필요하나최근국내의항생제내성경향및내성 유전자조사는축산위주로이루어지고있다 (Kim et al., 2013; Lee et al., 2009). 어류의항생제내 성경향과내성유전자의분포에대한최근의연 구는이루어지지않고있는실정이며, 특히우리 나라넙치생산량의대부분을차지하고있는제 주지역에대한항생제내성경향및내성유전자 연구역시부족한실정이다. 따라서본연구에서 는제주도양식넙치에서분리한세균들을대상 으로항생제내성현황과테트라사이클린의내성 정도및 PCR을통한 Tc 내성유전자의분포및 종류를살펴보고자하였다. Ⅱ. 1. 균분리및동정 재료및방법 2016 년제주도내넙치양식장에서질병에감 염된것으로추정되는넙치로부터균을분리하 여, 실험균주로사용하였다. 분리균은 tryptic soy agar (TSA, Difco, USA) agar (BHIA, Difco, USA) 또는 brain heart infusion 배지상에서증식되었으 며, 균의동정을위해선택배지인 thiosulfate citrate bile salts sucrose (TCBS) agar (Difco, USA),

3 ㆍ ㆍ Salmonella Shigella (SS) agar (MB cell, Korea), glutamate starch phenol-red agar (GSP, Sigma-Aldrich, Korea), Blood agar 배지에시료의 내부장기를도말하고, 27 에서 18~24시간배양 하였다. Vibrio 선택배지인 sp. TCBS 균주의구분을위해비브리오 평판배지상에서초록색또는 노란색집락의집락을형성한것으로규정하였으 며, Edwardsiella tarda 균은선택배지인 SS 배지 에서검은색집락을형성하는것으로규정하였 다. 또한, 균주의세부적인종동정은 PCR 방법 을사용하여확인하였다. 종동정에사용한 PCR primer sets 는 <Table 1> 에나타내었다. 순수분리 된균주는 20% glycerol (Sigma, USA) 을첨가한 후실험에사용하기전까지 다. 2. 항생제감수성시험 80 에서보관하였 분리된균주는증균을위해 tryptic soy broth (TSB, Difco, USA) 를사용하였으며, 27 에서 18~24 시간동안배양하여실험에사용하였다. 배 양액은멸균한면봉을이용하여 mueller hinton agar (MHA, Difco, USA) 제디스크를평판에고착시켰다. 평판에도말한후항생 실험에사용된 항생제디스크는 amoxicillin, ampicillin, amoxicillin/clavulanic acid, ciprofloxacin, doxycycline, norfloxacin, ofloxacin, gentamycin, minocycline, nalidixic acid, oxolinic acid, oxytetracycline, tetracycline, chloramphenicol, erythoromycin, kanamycin, neomycin, penicilline, streptomycin 으로총 19종을대상으로실험을실 시하였으며, 모두 Liofilchem 로부터구입하여사 용하였다. 디스크를고착시킨 MHA는 27 에서 18~24 시간배양후균의증식억제대를확인하였 다. 3. MIC (Minimum inhibitory concentration) 균주들의 tetracycline과 oxytetracycline 에대한 내성정도는 broth dilution 방법을적용하여 MIC 값으로나타냈다. MIC 값측정을위하여, 96 well plate에 mueller hinton broth (MHB, Difco, USA) 160 μl, 단계별로희석한항생제 20 μl, 10 ⁵~10⁶ 으로희석시킨균배양액 20 μl를넣고, positive control에는 MHB 180 μl과균배양액 20 μl를넣 었으며, negative control에는 MHB 200 μl만넣었 다. Plate를 27 에서 18~24 시간배양한후, 균의 증식여부에따른액체배지의혼탁도를육안으로 확인하여균이자라지않은최소농도를 로결정하였다. MIC값으 <Table 1> Primers used for the detection of bacteria in this study Primer psp-1 psp-2 Oligonucleotide Sequences (5' to 3') 5'-TCCAGTCTTTCGACCTTCTT-3' 5 -CAAAGAGATGTTCGGCTTG-3' Amplicon size (bp) 220 bp Pathogen Streptococcus parauberis Reference psi-1 psi-2 5'-AAGAGACGCAGTGTCAAAAG-3' 5 -CGTTTCTTATCTTGTTACTC bp Streptococcus iniae Woo et al., 2006 plg-1 plg-2 5 -AAGCAGTCTTTTGATGCAAG-3 5 -ACTGTGCGCCCTTATTAACT bp Lactococcus garvieae E-1 5'-CGGTAAAGTTGAGTTTACGGGTG-3' E-2 5 -TGTAACCGTGTTGGCGTAAG bp Edwardsiella tarda Sakai et al.,

4 4. DNA 추출 PCR을위한 template DNA는 Higene Genomic DNA prep kit (BIOFACT, Korea) 를사용 하였다. 먼저 DNA 의추출을위하여, 균을 TSB 에접종하고 27 에서 18~24시간배양한후배 양액 1.5 ml를 1.5 ml microtube 에넣고, 10,000 rpm에서 1분간원심분리하여 pellet을수집하였 다. Cell Re-Suspension Solution 300 μl를넣어 pellet 을현탁시킨후, lysozyme 2 μl를첨가하여 37 에서 1 시간반응시켰다. 반응후 13,000 rpm 에서 1 분간원심분리하고, Cell Lysis Solution 300 μl를넣어 pellet 을현탁시키고, RNase A 1.5 μl를첨가하여 37 에서 30 분간반응시켰다. 반 응후실온에서식힌후 Protein Precipitation Solution 100 μl를넣고, 강하게 vortex하여 13,000 rpm에서 5 분간원심분리하였다. 상층액을 100% Isopropanol 300 μl가들어있는새 microtube에넣고 50회 inverting하여 13,000 rpm 에서 1 분간원심분리하였다. 상층액을제거한후 80% ethanol로 2 번세척하고, 15분간상온에서 건조시킨후, DNA Hydration Solution 50 μl를 넣고 5초간 vortex하여 DNA 를추출하였다. 분리 된 DNA는실험에사용하기전까지 20 에서 보관하였다. 5. PCR 및 Multiplex PCR 하여 본연구에서는 12종류의 Tc 내성유전자에대 PCR 방법으로분석하였으며, 사용된 primer sets 는 <Table 2> 에나타내었다. <Table 2> Primers and expected sizes of PCR amplicons of various tet genes Gene tet(a) to Primer TETF Oligonucleotide Sequences (5' to 3') GCGCTNTATGCGTTGATGCA Amplicon size tet(g) tet(a) TAR2 ACAGCCCGTCAGGAAATT 387 bp tet(b) TBR TGAAAGCAAACGGCCTAA 171 bp tet(c) TCR3 CGTGCAAGATTCCGAATA 631 bp tet(d) TDR3 CCAGAGGTTTAAGCAGTGT 489 bp tet(e) TER ATGTGTCCTGGATTCCT 246 bp tet(g) TGR3 ATGCCAACACCCCCGGCG 803 bp tet(k) TKF GTAATGGTACCTGGTAAATC TKR CTATTACCTATTGTCGCTAC 329 bp tet(l) TLF GATCGATAGTAGCCATGG TLR CTTCTATCAACAAGTATC 480 bp tet(m) TMF GAATCTGAACAATGGGAT TMR CTAACAATTCTGTTCCAGC 1,099 bp tet(o) TOF AGACGGAGCAGTATTAG TOR CTGCCCAACCTTTTGCTTCAC 200 bp tet(q) TQF GACTCTATGGATATAGAG TQR CCATATCCTCTACAATCG 835 bp tet(s) TSF CATAGACAAGCCGTTGACC TSR ATGTTTTTGGAACGCCAGAG 667 bp (bp) Reference Jun, 2003 Kim, 2004 Jun,

5 ㆍ ㆍ 이전의연구에서 efflux 기능을수행하는 tet(a), tet(b), tet(c), tet(d), tet(e), tet(g) 를검출하 기위해제작된 1개의 forward primer와각 tet gene에따른여섯개의 2003), tet(k), tet(l) 을검출하기위한 (Kim, 2004), 그리고 reverse primers (Jun, primer sets ribosomal protection의기능 을수행하는 tet(m), tet(o), tet(q) 및 tet(s) 를검 출하기위한 다 <Table 2>. primer sets (Jun, 2010) 를사용하였 Multiplex PCR 분석을위하여, 0.2 ml microtube에 1 µm의각 primer, 2.5 µm의각 dntp, 10x G-Taq Buffer, 2.5 U G-Taq DNA polymerase (Gene Pro Themal Cycler Cosmo, Korea) 및세균의 template DNA 를첨가한후, distilled water로최종 volume이 20 μl가되도록 하였고, 이전에보고된각각의 Tc 내성유전자에 대해특이적으로반응하는단일 forward primer 와 6개의 reverse primers 를넣어실시하였다. PCR 분석을위하여, 0.2 ml microtube에 1 µm 의각 primer, 2.5 µm의각 dntp, 10x G-Taq Buffer, 2.5 U G-Taq DNA polymerase (Gene Pro Themal Cycler Cosmo, Korea) 및 template DNA를 첨가한후 distilled water로 PCR 혼합물의최종 volume이 20 μl가되도록하였다. PCR 조건은 94 에서 3분간 pre-denaturation 시 킨후, 94 에서 30초 denaturation, 55 에서 30 초 annealing, 72 에서 30초 extension의반응을 1 cycle 로하여, 30 cycles 를반응시켰다. 그리고 72 에서 7분간 post-extension 시켰다. 증폭산물은 1x TAE buffer (40 mm Tris-acetate, 1 mm EDTA) 를전기영동을위한완 충액으로하여, 0.5 μg/ ml ethidium bromide가첨 가된 1% agarose gel 상에서전기영동후, UV 검 출기에서 band의크기를확인하여 Tc 내성유전 자의종류를확인하였다. Ⅲ. 결과 1. 균분리및동정 2016 년제주지역넙치양식장에서질병에감 염된것으로추정되는넙치로부터총 153 균주 를분리하여실험에사용하였다. 분리균은 TSA 와 BHIA 배지상에서증식되었으며, 선택배지인 TCBS, SS, GSP, Blood agar 를사용하여분류하 였다. Vibrioceae 는 TCBS 배지상에서초록색혹 은노란색집락을형성하는것으로규정하였으 며, E. tarda 균주는 SS 배지에서검은색집락을 형성하는것으로규정하였다. 또한, Streptococcus sp. 에대한세부적인동정을위하여, 특이적인 primer sets 를사용하여 PCR 을실시하였다 <Table 1>. Streptococcus sp. 균주의동정결과, S. parauberis 86 균주, S. iniae 1 균주가분리되었으 며, Lactococcus garvieae는검출되지않았다. 그 리고 Vibrio sp. 로추정되는 20 균주, E. tarda 16 균주, 미동정된 30 균주를분리하여실험에사 용하였다 [Fig. 1 & 2]. 2. 항생제감수성 제주도내넙치양식장에서분리한 S. parauberis 86 균주, S. iniae 1 균주, Vibrio sp. 20 균주, E. tarda 16 균주및동정되지않은 30 균주 [Fig. 1] 에대한항생제내성경향을알아보기 위한약제감수성결과는 [Fig. 3] 에나타내었다. S. parauberis 86 균주는 nalidixic acid 에 88.4%, oxolinic acid 에 82.6%, tetracycline 과 oxytetracycline 에각각 55.8% 로퀴놀론계항생제 와테트라사이클린계항생제에대해높은내성 률을보였으며, erythromycin, streptomycin 에는 30.2% 와 44.2% 의내성률을나타내었다. amoxicillin, ampicillin, amoxicillin/clavulanic acid, ciprofloxacin, norfloxacin, ofloxacin, minocycline, chloramphenicol, kanamycin 서는 등의항생제에대해 10% 이하의낮은내성률을보였으며, 86 균주의 95.3% 에해당하는 82균주가 2종류이상

6 [Fig. 1] Number of bacterial isolates from cultured fish in Jeju [Fig. 2] Amplification of bacterial DNA by PCR with psp-1/psp-2 primer set for Streptococcus parauberis (Lane 1, 2, 3, 4, 5, 6, 7 and 8), psi-1/psi-2 primer set for S. iniae (Lane 9) and E-1/E-2 primer set for Edwardsiella tarda (Lane 10, 11, 12, 13, 14 and 15), respectively. M, 100 bp DNA ladder. 의항생제에대해내성을가지는다제내성균임 을확인하였다. Vibrio sp. 로추정되는 20 균주에서의내성률은 amoxicillin 65%, ampicillin 70%, penicillin 65% 로 페니실린계항생제에대해 50% 이상의내성률을 나타내었고, 다른계열항생제에대한내성률은 5~20% 였으며, ciprofloxacin, norfloxacin, minocycline, gentamycin, neomycin 의항생제에는감수성이있 었다. 또한, 20 균주중 90% 가페니실린계항생 제를포함해다른항생제에대해내성을가지는 다제내성균이었다. E. tarda 16 균주에대한내성비율은 Vibrio sp. 와유사하게 penicillin, amoxicillin, ampicillin 등 페니실린계항생제에서 68.8~100% 였으며, erythromycin, tetracycline, oxytetracycline 에대해서 도 50% 이상의높은내성비율을확인할수

7 ㆍ ㆍ [Fig. 3] Antimicrobial resistance pattern of bacteria isolated from cultured fish in Jeju. *AML, amoxicillin; AMP, ampicillin; AUG, amoxicillin/clavulanic acid; CIP, ciprofloxacin; DXT, doxycycline; NOR, norfloxacin; OFX, ofloxacin; CN, gentamycin; MN, minocycline; NA, nalidixic acid; OA, oxolinic acid; OT, oxytetracycline; TE, tetracycline; C, chloramphenicol; E, erythromycin; K, kanamycin; N, neomycin; P, penicillin; S, streptomycin 있었다. 실험에사용된 E. tarda 16 균주모두 2 종류이상의항생제에내성을나타내는다제내 성균이었고, 실험에사용된모든균주들은 gentamycin 과 neomycin 에대해감수성이있었다. 3. MIC 약제감수성결과에서 tetracycline 이나 oxytetracycline 에대해내성이관찰된균주는 S. parauberis 57 균주, Vibrio sp. 3 균주, E. tarda 11 균주, 미동정 13 균주로, Tc 내성균주들과 감수성있는균주들의내성수준은 MIC 값으로확 인하였다. 그결과, tetracycline과 oxytetracycline 에 대해감수성있는실험균주들의 MIC 값은 0.78~1.56 μg/ ml의범위의값을나타내었으며 (data not shown), 내성을보이는 S. parauberis 57 균주 중 7 균주가 tetracycline 에대해 100 μg/ ml이상,

8 29 균주가 50 μg/ ml, 20균주는 25 μg/ ml그리고 1 균주가 6.25 μg/ ml의 MIC값을나타내었으며, oxytetracycline 에대해서는 6 균주가 100 μg/ ml이 상, 29 균주는 50 μg/ ml, 18 균주에서 25 μg/ ml, 4 균주가 12.5 μg/ ml의 MIC값을나타내었고, 두항 생제에대한 S. parauberis 균주의 MIC 값은대부 분 25~100 μg/ ml의범위에속하였다 <Table 3>. Vibrio sp. 3 균주중 1 균주는 tetracycline 과 oxytetracycline 에대해 100 μg/ ml이상의 MIC값을 나타내었고, 2 균주는각각의항생제에대해 25 μg/ ml, 50 μg/ ml의값을나타내었다. E. tarda 10 균주는 tetracycline 과 oxytetracycline 에대하여 100 μg/ ml이상의 MIC값을나타내었 고, 1 균주는 tetracycline 에대해 25 μg/ ml, oxytetracycline 에대해서는 50 μg/ ml의값을가졌 으며, 대부분의 E. tarda 균주는 100 μg/ ml이상의 높은내성수준을지니고있었다. 또한, 미동정된 13 균주에서는 tetracycline 에 대해 10 균주가 25~100 μg/ ml의 MIC값을나타내 었으며, 나머지균주는 3.125~12.5 μg/ ml의범위에 속하였다. oxytetracycline 에대해서는 13 균주모 두 25~100 μg/ ml의 MIC값을나타내었으며, tetracycline 보다좁은범위의내성수준을확인할 수있었다. 4. Tetracycline 내성유전자 2016년제주지역양식장의병어로부터분리된 총 153 균주에서 tetracycline 과 oxytetracycline 에대 해내성을보이는총 84 균주의 total nucleic acid 를사용하여 Tc 내성유전자의유무와그종류 및분포를조사하였다. 대부분그람음성세균에서 나타난다고보고된 tet(a), tet(b), tet(c), tet(d), tet(e) 및 tet(g) 6종류의 tet gene을검출하기위한 multiplex PCR 결과, E. tarda 10 균주에서 500 bp 에근접한 band를확인할수있었다 [Fig. 4]. 즉, 6 종류의 tet gene 중 tet(d) 가많이존재하였으며, tet(a), tet(b), tet(c), tet(e), tet(g) 는검출되지않 았다 <Table 4>. Vibrio sp. 로추정되는균주에서는 tet(b), tet(d), tet(b)&(m) 이각각 1균주씩검출되 었으며, 각각의 tet gene에대해서는 multiplex PCR 뿐만아니라단독으로 PCR 을실시하였을때 에도동일한결과를얻을수있었다. 그람양성균에서주로존재한다고알려져있는 tet(k), tet(l), tet(m), tet(o), tet(q), tet(s) 를검출하 기위한 PCR 결과, S. parauberis에서는 tet(s) 가 63.2% 로가장많이존재하였고, tet(m)&(s), tet(k)&(s) 같이 2종류의내성유전자를가지는 균주는각각 1 균주였으며, 나머지 tet(l), tet(o), tet(q) 는검출되지않았다. 미동정균주에서는 tet(s) 가 21.4% 로나타났으 며, 나머지균주들은본연구에서사용한 primer sets 로는확인할수없었다. <Table 3> Minimum inhibitory concentrations (MICs) of tetracycline and oxytetracycline against bacteria isolated from cultured fish in Jeju ( μg/ ml) Isolates Concentration of Tc / OTC S. parauberis (n=57) 7 / 6 29 / / 18 0 / 4 1 / 0 0 / 0 0 / 0 0 / 0 Vibrio sp. (n=3) 1 / 1 0 / 2 2 / 0 0 / 0 0 / 0 0 / 0 0 / 0 0 / 0 E. tarda (n=11) 10 / 10 0 / 1 1 / 0 0 / 0 0 / 0 0 / 0 0 / 0 0 / 0 Unknown (n=13) 7 / 10 1 / 2 2 / 1 1 / 0 1 / 0 1 / 0 0 / 0 0 /

9 ㆍ ㆍ [Fig. 4] DNA amplication of tet genes in tetracycline resistant isolates from cultured fish in Jeju. Lane 1, 2, 3, 4 and 5, tet(s) in Streptococcus parauberis; Lane 6, tet(m) in S. parauberis; Lane 7, tet(k) in S. parauberis; Lane 8, tet(b) in Vibrio sp.; Lane 9, tet(d) in Vibrio sp.; Lane 10, tet(m) in Vibrio sp.; Lane 11, 12 and 13, tet(d) in Edwardsiella tarda; Lane 14 and 15, tet(s) in unidentified bacteria; M, 100 bp DNA ladder. <Table 4> Detection of various tet genes in tetracycline resistant isolates from cultured fish in Jeju Isolates No. of isolates tet genes 49 tet(s) S. parauberis 1 tet(m)&(s) (n=57) 1 tet(k)&(s) 1 tet(b) Vibrio sp. 1 tet(d) (n=3) 1 tet(b)&(m) E. tarda (n=11) 10 tet(d) Unknown (n=13) 3 tet(s) total 67 Ⅳ. 고찰 항생제는양식현장에서생산성증가와감염증 치료의목적으로사용되어지고있으며, 항생제의 사용은최근내성균의발생과축산물이나수산물 을통해사람으로내성이전이되는등의문제가 제기되고있어공중보건학적측면에서중요하게 대두되고있다. 2016년제주지역넙치양식장의병어로부터 S. parauberis 86 균주, S. iniae 1 균주, Vibrio sp. 20 균주, E. tarda 16 균주, 미동정 30 균주총 153 균주를분리하였다. 연쇄구균병의원인체는 S. parauberis, S. iniae, Lactococcus garvieae 등으로 알려져있으나, 최근에는주로 S. parauberis의검 출빈도가뚜렷하게증가하는추세이다. 분리된균주들의 ampicillin, amoxicillin, ciprofloxacin, gentamycin, nalidixic acid, oxolinic acid, tetracycline, oxytetracycline, chloramphenicol,

10 erythromycin, kanamycin, streptomycin, penicillin 을포함한 등 19종의항생제에대한약제감수성결 과, S. parauberis는 nalidixic acid, tetracycline 등의 항생제에대해내성률이높았으며, 이는 S. parauberis 균주중 67% 가 oxolinic acid에내성이 있었고, tetracycline에대해서는 46.4% 의내성을 보였다는보고 (Kim et al., 2014; Kim et al., 2010) 와유사한결과를나타내었다. S. parauberis 균주 는 minocycline 과 doxycycline에대해 tetracycline보 다낮은내성률을보였는데, 이는 minocycline 이 나 doxycycline 이 tetracycline 에비해사용된시기 가짧고, 누적사용량이적어낮은내성비율이 나타난것으로생각된다. Vibrioceae는종이다양 하여 TCBS 배지에서초록색또는노란색 를형성하는것을분리해 colony Vibrio sp. 로분류하였 다. 이들은 ampicillin, amoxicillin 등의페니실린계 항생제에대해높은내성을보였고, 페니실린계 이외의항생제에대해서는대체적으로낮은내성 률을보였다. 이전 Son et al.(2005) 과 Kim et al.(2010) 이다양한 Vibrio sp. 가 ampicillin에대해 90% 가넘는높은내성률을보였다는보고와일 치하였으며, tetracycline에대한내성비율은종마 다차이가있는것으로보고되어이후세부적인 종동정과함께조사가더필요할것으로여겨진 다. E. tarda 에서는 penicillin, ampicillin, erythromycin, tetracycline 등다양한계열의항생제에높은내 성률을나타내었고, ampicillin에 38.8%, tetracycline에 84.4% 의내성을나타내었다는이전 의보고(Kim et al., 2010; Kim et al., 2012) 보다 본연구에서의 ampicillin과 tetracycline에대한내 성률이높게확인된것은항생제의사용량이감 소하였을때내성률또한감소하는양상을보였 다는이전의연구(Song et al., 2009) 로미뤄보았 을때, 양식현장에서항생제의사용량이줄어들 지않고여전히지속적으로사용되어짐을시사하 고있다. 그리고실험에사용된모든균주들은 chloramphenicol, ciprofloxacin, norfloxacin, ofloxacin 등의항생제에대해감수성이있거나 매우낮은내성률을보였는데, 이와같은결과는 chloramphenicol, fluoroquinolone 계열의항생제가 동물에투여되는것이금지되면서항생제의사용 량이감소하여균주들의내성빈도역시낮아진 것으로보인다. 또한, 모든균주들이 gentamycin 과 neomycin 에대해감수성이있었는데, 이는대 부분의세균에서 neomycin의내성비율이높이 나타난이전의보고(Heo et al., 2002) 와차이가 있었다. 실험에사용된 153 균주중대부분의균주들이 2 종류이상의항생제에대해내성을가지는다제 내성균이었다. S. parauberis 와 E. tarda 균주에대 해이전의보고들은 (Kim et al., 2006; Kim et al., 2010) 다제내성균의비율이 90% 이상이었으며, 본연구에서도그와유사한결과를확인할수있 었다. Kim et al.(2010) 은 Vibrio sp. 의다제내성률 이 57.9% 라보고하였으나, 본연구에서는 70% 로 다제내성균의비율이증가하는것을확인할수 있었다. Tetracycline 계, penicillin 계, quinolone계항 생제에대한높은내성률은이전의연구들에서 보고된바가있으나제주지역의항생제내성현 황연구는제대로이루어지지않았었으며, 따라 서본연구가제주도내항생제내성경향에대한 기초자료로활용될것으로사료된다. 양식현장에서장기간 tetracycline계항생제의 사용으로내성균이출현하였으며, 그로인한감 염증치료의어려움및적절한약제선택의부재 등의문제가발생하였다. 제주도내양식장에서 분리한 153 균주중 tetracycline 내성균주는 84 균주였으며, MIC test를통해내성수준과균주들 이지니고있는내성유전자의분포및종류를 PCR 및 multiplex PCR 을통해살펴보았다. Chopra and Roberts(2001), Roberts(2005) 는 tet(m) 이가장일반적이며, 다양한그람양성세균 과음성세균뿐만아니라 mycoplasma 에서도발견 된다고보고하였고, 이전 Park et al.(2009) 의보고

11 ㆍ ㆍ 는 S. parauberis 내 tet gene의분포를살펴보았으 며, 그결과 tet(m) 을가지는균주는 42 균주, tet(s) 를가지는균주는 15 균주로, tet(s) 보다 tet(m) 의검출빈도가더높은것을확인하였다. 그러나본연구에서는 tet(s) 가가장 dominant한 gene 이었으며, tet(m) 은 2종류의내성유전자를 가지는 2 균주에서만검출되어이전의보고와다 소차이가있었다. 본연구에서 tet(m) 을가지는 내성균의비율이낮은이유는제주도에서분리된 균주의지역적특성으로분류할지는더지속적 인연구가필요할것으로여겨진다. S. parauberis 내 tet gene을지니는균주들의 tetracycline 이나 oxytetracycline 에대한 MIC값은대부분 25~100 μg / ml이상의범위에속하였으며, tet gene이확인되 지않은균주들은본연구에서의 primers가적용 되지않는다른내성유전자를지닐가능성이있 는것으로추정하였다. Vibrio sp. 에서확인된내성유전자는각각 tet(b), tet(d), 그리고 tet(b)&(m) 으로, Vibrio sp. 에 서모두 tet(b) 가검출되었다는보고(Jun, 2003) 및 tet(b)&(m) 이검출되었다는이전의보고(Kim, 2004) 와일치하였으나, tet(d) 의검출은이전과다 른내성유전자의분포를확인할수있었다. 하 지만, 실험에사용된 Vibrio sp. 균주의수가이전 의연구에서사용된수보다부족하기때문에향 후보다많은균주를채집하여추가적인연구가 필요할것으로사료된다. Vibrio sp. 내 tet gene을 지니는균주들의 tetracycline과 oxytetracycline 에 대한내성정도를확인한결과, 2종류의내성유 전자를지니는균주에서의 MIC값은 100 μg/ ml 이상이었으며, tet(b) 와 tet(d) 를지니는균주들의 MIC값은 25~50 μg/ ml이었다. 이전 Roberts(1996) 는 E. tarda 균주에서는 tet(a) 와 tet(d) 가발견된다고보고하였으며, 본연 구에서분리한 E. tarda 10 균주모두 tet(d) 를지 니고있는것을확인하여이전에보고된결과와 일치하였다. tet gene을가지는 E. tarda 균주들의 MIC 값을확인해보았더니, 100 μg/ ml이상의 MIC 값을가진 E. tarda 10 균주는 tet(d) 를가지고있 었으나 tetracycline과 oxytetracycline 에대해각각 25 μg/ ml, 50 μg/ ml의 MIC값을가진 1 균주에서 는 tet gene 을확인할수없었다. E. tarda의 tetracycline 에대한 MIC값이 25 μg/ ml이상이었을 때 tet gene 이확인되었다는이전의보고(Jun, 2003) 와상이한결과를보였다. 한편, S. parauberis 6 균주, E. tarda 1 균주, 미 동정 10 균주는 tetracycline이나 oxytetracycline 에 대해내성이있었으나 본연구에서사용한 primer sets 로는내성유전자를확인할수없었으 며, 이러한결과는본연구에서사용하지않은 tet(i), tet(t) 및 tet(w) 같이다른종류의내성유 전자이거나, 새로운 tet gene의출현에의한결과 로해석할수있다. 따라서이후에는본연구에 서사용되지않은 primer sets를통해확인을하 는등의추가적인연구가필요할것으로생각된 다. References Chopra, I. and Roberts, M. C.(2001). Tetracycline Antibiotics: Mode of Action, Applications, Molecular Biology, and Epidemiology of Bacterial Resistance. Microbiology and Molecular Biology Reviews 65(2), 232~260. Heo, J. H. Jung, M. H. Cho, M. H. Kim, G. H. Lee, K. C. Kim, J. H. and Jung, T. S.(2002). The study on fish diseases with reference to bacterial susceptibility to antibiotics in the southern area of Kyeognam. Journal of Veterinary Clinics 19(1), 19~22 Jee, B. Y. Shin, K. W. Lee, D. W. Kim, Y. J. and Lee, M. K.(2014). Monitoring of the mortalities and medications in the inland farms of olive flounder, Paralichthys olivaceus, in South Korea. Journal of Fish Pathology 27(1), 77~83. Jun, L. J.(2003). Characterization of tet genes in fish pathogenic bacteria from Korea. Master's Thesis, Department of Fish Pathology, Pukyong National University, Busan, South Korea

12 Jun, L. J.(2010). Characterization of antibiotic resistant genes carried by fish pathogens in Korea. Ph.D. Thesis, Department of Fish Pathology, Pukyong National University, Busan, South Korea. Kim, J. H. Kim, S. G. Kim, S. S. Kim, J. H. Park, S. H. Nam, K. H. Kim, H. B.(2013). Analysis of the antibiotic resistance gene in Salmonella Typhimurium isolates from diseased pigs in Gyeongbuk province. Korean Journal of Veterinary Service 36(2), 73~78. Kim, J. H. Lee, C. H. and Kim, E. H.(2006). Transferable R plasmid of Streptococci isolated from diseased olive flounder (Paralichthys olivaceus) in Jeju. Journal of Fish Pathology 19(3), 267~276. Kim, J. W. Cho, M. Y. Jee, B. Y. Park, M. A. and Kim, N. Y.(2014). Administration and use of aquaculture drugs in Korea. Journal of Fish Pathology 27(1), 67~75. Kim, M. S. Cho, J. Y. Seo, J. S. Jung, S. H. Choi, H. S. and Park, M. A.(2012). Distribution of MIC value of antibiotics against Edwardsiella tarda isolated from olive flounder (Paralichthys olivaceus). Journal of Fish Pathology 25(3), 181~188. Kim, M. S. Seo, J. S. Park, M. A. Cho, J. Y. Hwang, J. Y. Kwon, M. G. and Jung, S. H.(2010). Antimicrobial resistance of Edwardsiella tarda, Vibrio spp., and Streptococcus spp. isolated from olive flounder (Paralichthys olivaceus). Journal of Fish Pathology 23(1), 37~45. Kim, S. S. Jang, J. W. Song, J. W. Lim, S. J. Jeong, J. B. Lee, S. M. Kim, K. W. Son, M. H. and Lee, K. J.(2009). Effects of dietary supplementation of alga mixtures (Hizikia fusiformis and Ecklonia cava) on innate immunity and disease resistance against Edwardsiella tarda in olive flounder (Paralichthys olivaceus). Korean Journal of Fisheries and Aquatic Science 42(6), 614~620. Kim, S. Y. Kim, Y. C. Jeong, S. K. Jun, L. J. Jin, J. W. and Jeong, H. D.(2014). Increased resistance to Quinolones in Streptococcus parauberis and development of a rapid assay for detecting mutations in topoisomerase genes. Korean Journal of Fisheries and Aquatic Science 47(3), 247~254. Kim, Y. H.(2004). Characterization of tetracycline resistance genes in Vibrio spp. isolated from marine fishes. Master's Thesis, Department of Fish Pathology, Pukyong National University, Busan, South Korea. KOSIS.(2016). Korean Statistical Information Service. Lee, H. W. Lim, S. K. and Kim, M. N.(2009). Characteristics of Ampicillin-Resistant Vibrio spp. isolated from a west coastal area of Korean peninsula. Korean Journal of Fisheries and Aquatic Science 42(1), 20~25. Levy, S. B. MuMurry L. M. Barbosa, T. M. Burdett, V. Courvalin, P. Hillen, W. Roberts, M. C. Rood, J. I. & Taylor, D. E.(1999). Nomenclature for new tetracycline resistance determinants. Antimicrobial Agents and Chemotherapy 43(6), 1523~1524. Park, Y. K. Nho, S. W. Shin, G. W. Park, S. B. Jang, H. B. Cha, I. S. Ha, M. A. Kim, Y. R. Dalvi, R. S. Kang, B. J. Jung, T. S.(2009). Antibiotic susceptibility and resistance of Streptococcus iniae and Streptococcus parauberis isolated from olive flounder (Paralichthys olivaceus). Veterinary Microbiology 136, 76~81. Roberts, M. C.(2005). Update on acquired tetracycline resistance genes. FEMS Microbiology Letters 245, 195~203. Roberts, M. C.(1996). Tetracycline resistance determinants: mechanisms of action, regulation of expression, genetic mobility, and distribution. FEMS Microbiology Reviews 19, 1~24. Sakai, T. Iida, T. Osatomi, K. and Kanai, K.(2007). Detection of Type 1 Fimbrial genes in fish pathogenic and non-pathogenic Edwardsiella tarda strains by PCR. Fish Pathology 42(2), 115~117. Son, K. T. Oh, E. G. Lee, T. S. Lee, H. J. Kim, P. H. and Kim J. H.(2005). Antimicrobial susceptibility of Vibrio parahaemolyticus and Vibrio alginolyticus from fish farms on the southern coast of Korea. Korean Journal of Fisheries and Aquatic Science 38(6), 365~371. Song, J. H.(2009). Current status and future strategies of antimicrobial resistance in Korea. Korean Journal of Medicine 77(2), 143~

13 ㆍ ㆍ Woo, S. H. Kim, H. J. Lee, J. S. Kim, J. W. and Park, S. I.(2006). Pathogenicity and classification of streptococci isolated from cultured marine fishes. Journal of Fish Pathology 19(1), 17~33. Received : 24 March, 2017 Revised : 26 April, 2017 Accepted : 12 April,

398 이다원ㆍ전려진ㆍ김승민ㆍ정준범 (Lee and Kim, 2013)., Em (Lee et al., 2016) Korean statistical information service (KOSIS),,., Em (Han et al., 2012; Sung et

398 이다원ㆍ전려진ㆍ김승민ㆍ정준범 (Lee and Kim, 2013)., Em (Lee et al., 2016) Korean statistical information service (KOSIS),,., Em (Han et al., 2012; Sung et 한수지 51(4), 397-403, 2018 Original Article Korean J Fish Aquat Sci 51(4),397-403,2018 제주지역양식넙치 (Paralichthys olivaceus) 에서분리한어병세균내 Erythromycin 내성유전자분석 이다원 전려진 김승민 1 정준범 * 제주대학교해양의생명과학부, 1 주식회사우진비앤지 Analysis

More information

42(3)-11(p ).fm

42(3)-11(p ).fm The Korean Journal of Microbiology, Vol. 42, No. 3, September 2006, p. 199-204 Copyright 2006, The Microbiological Society of Korea e ³ w ³ w Á Á½ Áx Á 1 Á 2, * w w w w w w e ³ ³ w p w. e ³ w ù š» 30 cm.

More information

Microsoft PowerPoint - PDFCoTemp.PPT

Microsoft PowerPoint - PDFCoTemp.PPT 주요유방염세균의검출및 항생제감수성검사 임숙경 1. 검사시료 1. 시료채취 유방염우유 2. 체세포수측정 3. 대상세균 - Staphylococcus aureus - Coagulase negative staphylococci -Escherichia coli 3. 균분리방법 E. coli CHEC Agar 직접도말 (37 18-24h) 보라색집락 EMB Agar

More information

레이아웃 1

레이아웃 1 2014 의약품 제품 요약 해설집 National Fisheries Research & Development Institute 정 부 간 행 물 등 록 번 호 11-1192266-000040-01 과학원간행물 등록번호 S P - 2 0 1 4 - A Q - 0 0 2 2014 의약품 제품 요약 해설집 National Fisheries Research & Development

More information

1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus

More information

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법

More information

MBL fm

MBL fm Microbiol. Biotechnol. Lett. (2017), 45(3), 250 256 pissn 1598-642X eissn 2234-7305 Microbiology and Biotechnology Letters 해양유래미생물을이용한어류질병세균에대한항균활성탐색 김동휘, 박소현, 김지현, 이해리, 허문수 * 제주대학교해양과학대학수산생명의학과 Received:

More information

<B8F1C2F72E687770>

<B8F1C2F72E687770> 제1장 제17장 성홍열 및 사슬알균 감염증 사슬알균 (Streptococci)은 증식 중의 특징적으로 쌍 또는 사슬모양의 그람양성 알균 으로 catalase 음성, 통성혐기성균이며, 보통 한천배지에서는 발육이 어렵고 혈액이나 혈청 등을 첨가한 배지에서 잘 발육한다. 포도당이나 다른 탄수화물을 분해하나 포도당 을 분해하여 가스를 생성하지 않는다. 이들은 최소

More information

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를 Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

433대지05박창용

433대지05박창용 Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This

More information

( )Kju225.hwp

( )Kju225.hwp 비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin

More information

한수지 52(4), , 2019 Original Article Korean J Fish Aquat Sci 52(4), ,2019 Streptococcus parauberis 의디스크확산법결과에대한 Epidemiological Cut-off Val

한수지 52(4), , 2019 Original Article Korean J Fish Aquat Sci 52(4), ,2019 Streptococcus parauberis 의디스크확산법결과에대한 Epidemiological Cut-off Val 한수지 52(4), 382-388, 2019 Original Article Korean J Fish Aquat Sci 52(4),382-388,2019 Streptococcus parauberis 의디스크확산법결과에대한 Epidemiological Cut-off Value 의설정 천원경 이윤항 김윤재 노형진 김아란 김남은 서정수 1 권문경 1 이지훈 1 김도형

More information

γ

γ 경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical

More information

<4D F736F F F696E74202D20B3D2C4A1BFACBCE2B1B8B1D5C1F528BEC6C4EDBEC6C0CEC6F7292E >

<4D F736F F F696E74202D20B3D2C4A1BFACBCE2B1B8B1D5C1F528BEC6C4EDBEC6C0CEC6F7292E > 넙치연쇄구균증의발생현황및대책 1. 서론 병리연구과권문경 우리나라의넙치양식은 1970년대후반부터종묘생산이시작되어 1986년도에제주도에서종묘생산기술개발을계기로육상양식이시작되었다. 1997년도에는 5,500톤을생산하였으며 ( 허등, 2001), 이후급속도로발전하여 2008년에는 46,432톤을생산함으로서 11년만에약10 배의생산량증가를이루었다. 양식산업이발전함에따라시설규모도소규모에서대규모로전환되고사육방법또한고밀도로사육하는경우가많아사육관리부주의등으로각종질병이발생되고있으며,

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4) THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

22(3)-07.fm

22(3)-07.fm J. Fd Hyg. Safety Vol. 22, No. 3, pp. 179~191 (2007),QWTPCN QH (QQF *[IKGPG CPF 5CHGV[ Available online at http://www.foodhygiene.or.kr Î ÜôÚ ò Ù Â 1 Â 2 Âú äâ Ö 3 Â Ùý* w w w, 1 w tœw, 2 w yw, 3 w yl

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

한수지 49(6), , 2016 Original Article Korean J Fish Aquat Sci 49(6), ,2016 Photobacterium damselae 의디스크확산법결과에대한 Epidemiological Cut-off Valu

한수지 49(6), , 2016 Original Article Korean J Fish Aquat Sci 49(6), ,2016 Photobacterium damselae 의디스크확산법결과에대한 Epidemiological Cut-off Valu 한수지 49(6), 838-844, 2016 Original Article Korean J Fish Aquat Sci 49(6),838-844,2016 Photobacterium damselae 의디스크확산법결과에대한 Epidemiological Cut-off Value 의결정 권문경 임윤진 1 김명석 2 서정수 김도형 1 * 국립수산과학원방역과, 1 부경대학교수산생명의학과,

More information

한수지 49(5), , 2016 Original Article Korean J Fish Aquat Sci 49(5), ,2016 곰소만해역해수에서분리한장염비브리오 (Vibrio parahaemolyticus) 의항균제내성및최소발육억제농도의구명 김

한수지 49(5), , 2016 Original Article Korean J Fish Aquat Sci 49(5), ,2016 곰소만해역해수에서분리한장염비브리오 (Vibrio parahaemolyticus) 의항균제내성및최소발육억제농도의구명 김 한수지 49(5), 582-588, 206 Original Article Korean J Fish Aquat Sci 49(5),582-588,206 곰소만해역해수에서분리한장염비브리오 (Vibrio parahaemolyticus) 의항균제내성및최소발육억제농도의구명 김태옥 엄인선 김희대 박권삼 * 군산대학교식품생명공학과, 충북도립대학바이오생명의약과 Antimicrobial

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici

학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici 학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

한수지 49(5), , 2016 Original Article Korean J Fish Aquat Sci 49(5), ,2016 창선해역의지중해담치 (Mytilus galloprovincialis) 양식장및육상오염원에서분리한대장균 (Escheri

한수지 49(5), , 2016 Original Article Korean J Fish Aquat Sci 49(5), ,2016 창선해역의지중해담치 (Mytilus galloprovincialis) 양식장및육상오염원에서분리한대장균 (Escheri 한수지 49(5), 564-572, 2016 Original Article Korean J Fish Aquat Sci 49(5),564-572,2016 창선해역의지중해담치 (Mytilus galloprovincialis) 양식장및육상오염원에서분리한대장균 (Escherichia coli) 의항생제내성 권순재 이가정 * 정연중 박상기 고경리 양지혜 목종수 국립수산과학원남동해수산연구소

More information

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF. 1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -

More information

α α α α α

α α α α α α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를

More information

( )Kju269.hwp

( )Kju269.hwp 만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

338 김승민ㆍ전려진ㆍ박명애ㆍ정현도ㆍ정준범 viral hemorrhagic septicemia (VHS) Scuticocilate,, cm, 1-3.,,.,, cohabitation test. 실험어 재료및방법 2010 (E03), 2011 (E06),

338 김승민ㆍ전려진ㆍ박명애ㆍ정현도ㆍ정준범 viral hemorrhagic septicemia (VHS) Scuticocilate,, cm, 1-3.,,.,, cohabitation test. 실험어 재료및방법 2010 (E03), 2011 (E06), 한수지 48(3), 337-345, 2015 Original Article Korean J Fish Aquat Sci 48(3),337-345,2015 제주도여윔증상넙치 (Paralichthys olivaceus) 로부터분리한점액포자충의특성분석 김승민 전려진 1 박명애 2 정현도 3 정준범 * 제주대학교해양의생명과학부, 1 제주대학교수산백신연구센터, 2 국립수산과학원수산생물방역과,

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jun.; 27(6),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jun.; 27(6), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Jun.; 27(6), 495 503. http://dx.doi.org/10.5515/kjkiees.2016.27.6.495 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Design

More information

04_이근원_21~27.hwp

04_이근원_21~27.hwp 1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일

More information

歯1.PDF

歯1.PDF 200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)

More information

- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing

More information

Contents I. 항생제내성 / 감수성기준및용어설명 II. III. 호흡기질병 5 종항생제내성검사결과 소화기질병 3 종항생제내성검사결과

Contents I. 항생제내성 / 감수성기준및용어설명 II. III. 호흡기질병 5 종항생제내성검사결과 소화기질병 3 종항생제내성검사결과 2017 년양돈질병세균 항생제내성검사결과 I Seul Oh ACE of Optipharm ois@optipharm.co.kr 043-249-7532 Contents I. 항생제내성 / 감수성기준및용어설명 II. III. 호흡기질병 5 종항생제내성검사결과 소화기질병 3 종항생제내성검사결과 2018-01-30 2 1. 항생제감수성 / 내성기준 2018-01-30

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling

More information

untitled

untitled 理 葉 CNFH-88-04 行 87 年 9 1 88 年 6 30 類 葉 Staphylococcus aureus Staphylococcus epidermidis Streptococcus mutans Streptococcus sanguis Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa Candida

More information

<C7D1B1B9B1B3C0B0B0B3B9DFBFF85FC7D1B1B9B1B3C0B05F3430B1C733C8A35FC5EBC7D5BABB28C3D6C1BE292DC7A5C1F6C6F7C7D42E687770>

<C7D1B1B9B1B3C0B0B0B3B9DFBFF85FC7D1B1B9B1B3C0B05F3430B1C733C8A35FC5EBC7D5BABB28C3D6C1BE292DC7A5C1F6C6F7C7D42E687770> 기혼 여성이 사이버대학에서 상담을 전공하면서 겪는 경험 방기연 (고려사이버대학교 상담심리학과 부교수) * 요 약 본 연구는 기혼 여성의 사이버대학 상담전공 학과 입학에서 졸업까지의 경험을 이해하는 것을 목적으로 한 다. 이를 위해 연구참여자 10명을 대상으로 심층면접을 하고, 합의적 질적 분석 방법으로 분석하였다. 입학 전 에 연구참여자들은 고등교육의 기회를

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words

More information

( ).fm

( ).fm Korean J. Food Sci. An. Vol. 33, No. 1, pp. 133~138(2013) DOI http://dx.doi.org/10.5851/kosfa.2013.33.1.133 ARTICLE 시판축산물및수산물에서 Enterococcus faecalis 와 Enterococcus faecium 분포및항생제감수성에관한연구 성창현 천정환 곽효선 1

More information

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract

More information

< B3E2BAB8B0C7BFF8BAB828BAB8B0C72CC3E0BBEA29312E687770>

< B3E2BAB8B0C7BFF8BAB828BAB8B0C72CC3E0BBEA29312E687770> 부산광역시보건환경연구원보제 14 권 (I), 15~27, 2004 Rep. Busan Inst. Health & Environ, Vol.14, 15~27, 2004 미생물과 이주현 Study on the Antimicrobial Susceptbility of Vibrio spp. Isolated from Environmental source and Patients

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Feb.; 29(2), 93 98. http://dx.doi.org/10.5515/kjkiees.2018.29.2.93 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) UHF-HF

More information

11¹ÚÇý·É

11¹ÚÇý·É Journal of Fashion Business Vol. 6, No. 5, pp.125~135(2002) The Present State of E-Business according to the Establishment Year and the Sales Approach of Dongdaemun Clothing Market Park, Hea-Ryung* and

More information

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*

More information

<28BCF6BDC320323031352D31332920B0E6B1E2B5B520C1F6BFAABAB020BFA9BCBAC0CFC0DAB8AE20C1A4C3A520C3DFC1F8C0FCB7AB5FC3D6C1BE2830312E3036292E687770>

<28BCF6BDC320323031352D31332920B0E6B1E2B5B520C1F6BFAABAB020BFA9BCBAC0CFC0DAB8AE20C1A4C3A520C3DFC1F8C0FCB7AB5FC3D6C1BE2830312E3036292E687770> 수시과제 2015-13 경기도 지역별 여성일자리 정책 추진 전략 연구책임자 : 최 윤 선 (본원선임연구위원) : 남 승 연 (본원연구위원) 연 구 지 원 : 이 상 아 (본원위촉연구원) 연 구 기 간 : 2015. 9 ~12 2015 발 간 사 여성 일자리는 사회 내 여성과 남성간의 차이를 좁히고 개개인의 삶을 윤택하게 만드는 중요 한 부분입니다. 이에 정부는

More information

- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α

More information

석사논문.PDF

석사논문.PDF ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   * A Research Trend Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities

More information

서론 34 2

서론 34 2 34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of

More information

cdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR

cdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR RT-PCR 법 II. 역전사효소반응 ( 주 ) 다인바이오연구소 현재분자생물학분야에서 RNA 수준의 gene expression ( 유전자발현 ) 과 cdna (complementary DNA) cloning에널리이용되고있는 RT-PCR (Reverse transcription ploymerase chain reaction) 은생명정보가 DNA에서 RNA로전달된다는분자생물학분야의

More information

인문사회과학기술융합학회

인문사회과학기술융합학회 Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement

More information

untitled

untitled 대한내과학회지 : 제 72 권제 1 호 27 Streptococcus pneumoniae와 Haemophilus influenzae 임상분리주에대한 Cefditoren의시험관내항균력 인제대학교의과대학일산백병원감염내과, 울산대학교의과대학서울아산병원감염내과 2, 울산대학교항균제내성ㆍ미생물유전학연구센터 3 곽이경 추은주 2, 3 박수진 3 이정은 3 정진용 2,

More information

목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i

목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i 11-1480523-000748-01 배경지역 ( 백령도 ) 에서의 대기오염물질특성연구 (Ⅲ) 기후대기연구부대기환경연구과,,,,,,, Ⅲ 2010 목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i 목차 Ⅳ ii 목차 iii 목차 iv 목차 μg m3 μg m3 v 목차 vi Ⅰ. 서론 Ⅰ μm μg m3 1 Ⅰ. 서론 μg m3 μg m3 μg m3 μm 2

More information

- 2 -

- 2 - - 1 - - 2 - - 3 - - 4 - - 5 - [ 그림 1] 산수유 [ 그림 2] 더덕 - 6 - - 7 - sample [ 그림 3] 균분리를위한접종 - 8 - PCA PCA with inoculum Slide glass [ 그림 4] Slide culture 모식도 - 9 - - 10 - Nutrient Medium Paperdisk with Antibiotics

More information

09권오설_ok.hwp

09권오설_ok.hwp (JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction

More information

디지털포렌식학회 논문양식

디지털포렌식학회 논문양식 ISSN : 1976-5304 http://www.kdfs.or.kr Virtual Online Game(VOG) 환경에서의 디지털 증거수집 방법 연구 이 흥 복, 정 관 모, 김 선 영 * 대전지방경찰청 Evidence Collection Process According to the Way VOG Configuration Heung-Bok Lee, Kwan-Mo

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze

More information

한국성인에서초기황반변성질환과 연관된위험요인연구

한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -

More information

untitled

untitled ORIGINAL ARTICLE Korean J Clin Lab Sci. Vol. 45, No. 1, Mar. 2013 21 Korean J Clin Lab Sci. 2013, 45(1):21-25 ISSN 1738-3544 Errors of Antibiotic Susceptibility Testing from Automated and Manual Systems

More information

fm

fm pissn 1229-1153 J. Fd Hyg. Safety Vol. 29, No. 3, pp. 228~233 (2014) http://dx.doi.org/10.13103/jfhs.2014.29.3.228 Journal of Food Hygiene and Safety Available online at http://www.foodhygiene.or.kr 축산물과수산물에서분리된장구균의항생제감수성및유전형분석

More information

232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특

232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특 한국도시행정학회 도시행정학보 제25집 제4호 2012. 12 : pp.231~251 생활지향형 요소의 근린주거공간 분포특성 연구: 경기도 시 군을 중심으로* Spatial Distribution of Daily Life-Oriented Features in the Neighborhood: Focused on Municipalities of Gyeonggi Province

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   3 * The Effect of H Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales

More information

°Ç°�°úÁúº´5-44È£ÃÖÁ¾

°Ç°�°úÁúº´5-44È£ÃÖÁ¾ K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis

More information

09È«¼®¿µ 5~152s

09È«¼®¿µ5~152s Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,

More information

한수지 47(6), , 2014 Original Article Kor J Fish Aquat Sci 47(6), ,2014 배합사료및습사료공급에따른넙치 (Paralichthys olivaceus) 의성장및어체성분비교 김강웅 이진혁 배기민 김경덕

한수지 47(6), , 2014 Original Article Kor J Fish Aquat Sci 47(6), ,2014 배합사료및습사료공급에따른넙치 (Paralichthys olivaceus) 의성장및어체성분비교 김강웅 이진혁 배기민 김경덕 한수지 47(6), 810-817, 2014 Original Article Kor J Fish Aquat Sci 47(6),810-817,2014 배합사료및습사료공급에따른넙치 (Paralichthys olivaceus) 의성장및어체성분비교 김강웅 이진혁 배기민 김경덕 이봉주 한현섭 김성삼 * 국립수산과학원사료연구센터 Comparison of Extruded

More information

< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770>

< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770> 대한임상검사학회지 : 40권제2호, 75-79, 2008 ISSN 1738-3544 대구지역병원에서분리된 Acinetobacter baumannii와 Pseudomonas aeruginosa의항생제내성현황 대구보건대학임상병리과 1, 세명대학교임상병리학과 2 김수정 1 이재식 2 Antibiotic Resistance Patterns of Acinetobacter

More information

27 2, 17-31, , * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** ( :

27 2, 17-31, , * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** ( : 27 2, 17-31, 2009. -, * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** (: dminkim@cau.ac.kr) 18 한국교육문제연구제 27 권 2 호, 2009. Ⅰ. (,,, 2004). (,, 2006).,,, (Myrick,

More information

EZ-Cloning kit

EZ-Cloning kit EZ TM 5 /3 RACE PCR Kit Instruction Manual Korean Ver. Kit for 10 reactions Cat.# EZ025 EZ TM 5 /3 RACE PCR Kit Table of Contents I. 제품설명... 3 II. 원리... 4 III. 제품구성... 7 IV. 염기서열정보... 8 V. 주의사항... 8 VI.

More information

05052유식안101.hwp

05052유식안101.hwp 제 출 문 식품의약품안전청장 귀 하 이 보고서를 유전자재조합식품 모니터링(부산광역시보건환경연구원/정구영) 과제의 연구 결과보고서로 제출합니다. 2005. 11. 30 주관연구기관명 : 부산광역시보건환경연구원 주관연구책임자 : 정구영 목 차 Ⅰ. 연구개발결과 요약문----------------------------------- 1 (한글)------------------------------------------

More information

10 이지훈KICS2015-03-068.hwp

10 이지훈KICS2015-03-068.hwp 논문 15-40-05-10 The Journal of Korean Institute of Communications and Information Sciences '15-05 Vol.40 No.05 http://dx.doi.org/10.7840/kics.2015.40.5.851 가로등 인프라를 활용한 안전한 스마트 방범 시스템 차 정 화, 이 주 용 *, 이

More information

(2005\263\342\271\351\274\255_final.hwp)

(2005\263\342\271\351\274\255_final.hwp) 제 2 절 식 의약품 종합정보서비스 243 제1장 평 가 분 야 제1절 식품규격평가 분야 제2절 식품안전평가 분야 제3절 의약품평가 분야 제4절 생약평가 분야 제5절 생물의약품평가 분야 제6절 의료기기평가 분야 제 1 절 식품규격평가 분야 245 제1장 평가분야 제1절 식품규격평가 분야 제1 항 식품의 기준 규격 1. 식품공전 식품의 기준 규격은 식품위생법

More information

04_08_HM _rev3_ hwp

04_08_HM _rev3_ hwp Korean Journal of Microbiology (213) Vol. 49, No. 2, pp. 126-13 DOI http://dx.doi.org/1.7845/kjm.213.325 Copyright c 213, The Microbiological Society of Korea 보문 원유시료에서분리한장알균속세균의다중약물유출펌프 (Multidrug Efflux

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis

More information

슬라이드 1

슬라이드 1 EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase

More information

..........5-45..

..........5-45.. K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals

More information

한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26

한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26 2015 한국전지학회 춘계학술대회 2일차 한국전지학회 춘계 학술대회(신소재 및 시장동향 관련 주제 발표) 시간 제목 비고 세션 1 차세대 이차전지용 in-situ 분석기술 좌장 : 윤성훈 09:00~09:30 Real-time & Quantitative Analysis of Li-air Battery Materials by In-situ DEMS 김동욱(한국화학연구원)

More information

<353420B1C7B9CCB6F52DC1F5B0ADC7F6BDC7C0BB20C0CCBFEBC7D120BEC6B5BFB1B3C0B0C7C1B7CEB1D7B7A52E687770>

<353420B1C7B9CCB6F52DC1F5B0ADC7F6BDC7C0BB20C0CCBFEBC7D120BEC6B5BFB1B3C0B0C7C1B7CEB1D7B7A52E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 13, No. 2 pp. 866-871, 2012 http://dx.doi.org/10.5762/kais.2012.13.2.866 증강현실을 이용한 아동교육프로그램 모델제안 권미란 1*, 김정일 2 1 나사렛대학교 아동학과, 2 한세대학교 e-비즈니스학과

More information

<31325FB1E8B0E6BCBA2E687770>

<31325FB1E8B0E6BCBA2E687770> 88 / 한국전산유체공학회지 제15권, 제1호, pp.88-94, 2010. 3 관내 유동 해석을 위한 웹기반 자바 프로그램 개발 김 경 성, 1 박 종 천 *2 DEVELOPMENT OF WEB-BASED JAVA PROGRAM FOR NUMERICAL ANALYSIS OF PIPE FLOW K.S. Kim 1 and J.C. Park *2 In general,

More information

Cloning

Cloning Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군

More information

1. KT 올레스퀘어 미디어파사드 콘텐츠 개발.hwp

1. KT 올레스퀘어 미디어파사드 콘텐츠 개발.hwp Journal of Next-generation Convergence Information Services Technology Vol.4, No.1, June (2015), pp. 1-8 차세대컨버전스정보서비스기술논문지 KT 올레스퀘어 미디어파사드 콘텐츠 개발 Media Fasade Contents Development of KT Olleh Square 김동조

More information

Journal of Life Science 2011, Vol. 21. No μ μ

Journal of Life Science 2011, Vol. 21. No μ μ Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,

More information

10(3)-09.fm

10(3)-09.fm w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½

More information

(72) 발명자 박용우 경상남도 진주시 이현동 이현웰가 114동 1503호 구본동 경기도 양주시 백석읍 방성리 78-5 - 2 -

(72) 발명자 박용우 경상남도 진주시 이현동 이현웰가 114동 1503호 구본동 경기도 양주시 백석읍 방성리 78-5 - 2 - (51) Int. Cl. (19) 대한민국특허청(KR) (12) 등록특허공보(B1) C12Q 1/68 (2006.01) (21) 출원번호 10-2008-0117508 (22) 출원일자 2008년11월25일 심사청구일자 2008년12월15일 (65) 공개번호 10-2010-0058919 (43) 공개일자 2010년06월04일 (56) 선행기술조사문헌 KR100619189

More information

03권동희(17-26)ok

03권동희(17-26)ok Geographical Analysis of National Monument Topography* Kwon, Dong-Hi 1) Abstract : As of January 2010, 59 topography have been designated as national monuments. From the geographical point of view, these

More information

10송동수.hwp

10송동수.hwp 종량제봉투의 불법유통 방지를 위한 폐기물관리법과 조례의 개선방안* 1) 송 동 수** 차 례 Ⅰ. 머리말 Ⅱ. 종량제봉투의 개요 Ⅲ. 종량제봉투의 불법유통사례 및 방지대책 Ⅳ. 폐기물관리법의 개선방안 Ⅴ. 지방자치단체 조례의 개선방안 Ⅵ. 결론 국문초록 1995년부터 쓰레기 종량제가 시행되면서 각 지방자치단체별로 쓰레기 종량제 봉투가 제작, 판매되기 시작하였는데,

More information

슬라이드 1

슬라이드 1 LC-MS 단백질분석을위한 SDS-PAGE staining protocol 및주의할점 Proteomics Core Facility 2017.12.28 Contents LC-MS 분석의뢰용 protein SDS-PAGE staining 시주의할점 Coomassie Blue R-250 을이용한 gel staining (general protocol) Coomassie

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

674 권순재ㆍ정연중ㆍ윤현진ㆍ목종수ㆍ권지영,.., (Watts et al., 2017)., 70% (Kummerer, 2009). (Witte, 2000)., (Souli et al., 2008)., % ,113 (NIFS, 2017

674 권순재ㆍ정연중ㆍ윤현진ㆍ목종수ㆍ권지영,.., (Watts et al., 2017)., 70% (Kummerer, 2009). (Witte, 2000)., (Souli et al., 2008)., % ,113 (NIFS, 2017 한수지 51(6), 673-681, 2018 Original Article Korean J Fish Aquat Sci 51(6),673-681,2018 용남광도해역의굴 (Crassostrea gigas) 및육상오염원에서분리한대장균 (Escherichia coli) 의항생제내성 권순재 정연중 윤현진 목종수 1 권지영 * 국립수산과학원남동해수산연구소, 1 국립수산과학원식품위생가공과

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun

More information

(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re

(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re EMF Health Effect 2003 10 20 21-29 2-10 - - ( ) area spot measurement - - 1 (Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern

More information

Automated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets

Automated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets PCR FlashGel System 2013. 04. 24 PCR 2013. 04. 24 순서 1. PCR 이란 2. PCR 실험의기본조건 3. PCR 효소선택가이드 4. Hot Start PCR의원리 5. PCR 실험시 Troubleshooting 6. PCR 장비 _TP350 소개 PCR(Polymerase Chain Reaction) PCR 이란? -

More information

歯kjmh2004v13n1.PDF

歯kjmh2004v13n1.PDF 13 1 ( 24 ) 2004 6 Korean J Med Hist 13 1 19 Jun 2004 ISSN 1225 505X 1) * * 1 ( ) 2) 3) 4) * 1) ( ) 3 2) 7 1 3) 2 1 13 1 ( 24 ) 2004 6 5) ( ) ( ) 2 1 ( ) 2 3 2 4) ( ) 6 7 5) - 2003 23 144-166 2 2 1) 6)

More information

02À±¼ø¿Á

02À±¼ø¿Á Geomorphic Development of Marine Terraces at Jeongdongjin-Daejin area on the East Coast, Central Part of Korean Peninsula Soon-Ock Yoon*, Sang-Ill Hwang** and Hak-Kyun Ban*** Abstract : In this paper we

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 30(3),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 30(3), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Mar.; 30(3), 223 228. http://dx.doi.org/10.5515/kjkiees.2019.30.3.223 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Analysis

More information