DBPIA-NURIMEDIA

Size: px

Start display at page:

Download "DBPIA-NURIMEDIA"

환희 삼
6 years ago
Views:

~846, 2017. www.ksfme.or.kr 수산해양교육연구, 제29권제3

1 JFM SE, 29(3), pp. 834~846, 수산해양교육연구, 제29권제3 호, 통권87 호, 년도제주지역양식넙치(Paralichthys olivaceus ) 에서분리된어병세균의 tetracycline 내성유전자분포 이다원ㆍ전려진ㆍ정준범 ( 제주대학교 ) Distribution of Tetracycline Resistance Genes in Pathogenic Bacteria Isolated from Cultured Olive Flounder (Paralichthys olivaceus) in Jeju in 2016 Da-Won LEEㆍLyu-Jin JUNㆍJoon-Bum JEONG (Jeju National University) Abstract Aquaculture practices to ensure greater production, such as high density breeding and excessive feeding, are become stressors that raise the prevalence of diseases. Accordingly, increasingly large volumes of antibiotics are used more frequently each year. Long term use antibiotics can generate resistant bacteria, which interrupt treatments and cause a potential transfer to human bodies. Thus, antibiotic resistance is of importance in public health. Tetracycline (Tc) is one of the typical medicines used in the aquaculture drugs, which has a wide range of application including gram-positive and gram-negative bacteria. In the examination of 153 strains isolated from olive flounder (Paralichthys olivaceus) farms located in Jeju in 2016, it turned out that a total of 84 strains were resistant to Tc or oxytetracycline (OTC). The extent to which the strains are resistant to Tc and OTC was confirmed through MIC test, mostly within the range of 25 to 100 μg/ ml. Twelve different types of tet genes were detected using single and multiplex PCR in the 84 Tc-resistant strains. The PCR was used to find tet(k), tet(m), tet(o), and tet(s), which are known to exist primarily in gram positive strains. According to the results, tet(s) is the most dominant gene in 49 strains of Streptococcus parauberis, accounting for 63.2%. And there were two strains that have two different types of resistant genes. The multiplex PCR was used to detect tet(a), tet(b), tet(c), tet(d), tet(e), and tet(g), which are commonly found in gram-negative strains. Each of tet(b), tet(d), and tet(b)&(m) was found in a strain presumed to be Vibrio sp., and only tet(d) was found in 10 Edwardsiella tarda strains. Key words : Olive flounder, Resistance, Tetracycline, Oxytetracycline, Streptococcus parauberis Ⅰ. 서론 우리나라의어류양식산업은 1980년대부터시 작하여지속적으로성장해왔으며, 제주도내넙 치양식은 2015년 27,142톤으로우리나라넙치 생산량의절반이상을차지하고있는대표적양 식대상어종이다 (KOSIS, 2016). 지속적인양식산 업의성장으로인해수산생물의생산량이증가하 Corresponding author : , jeongjb@jejunu.ac.kr

2 면서고밀도사육등의이유로수산생물의질병 발생률도함께증가하고있으며, 양식현장에서 생산성향상과감염증치료등의목적으로수산 용의약품의사용량및사용빈도는매년증가하고 있다(Kim et al., 2014). 이러한항생제의사용은 항생제내성균발생, 다제내성균의출현, 약물 잔류에의한안전성및약물의유실로인한환경 오염등의문제를야기할수있다. 수년간항생 제의오 남용으로인해발생한내성균으로감염 증치료의어려움이있어최근에는예방대책으로 백신의개발및천연물질을사용하여어체내생 리활성증가시키는등의방법이나오고있으나, 아직까지많은양식현장에서항생제가사용되고 있다 (Kim et al., 2009; Jee et al., 2014). 테트라사이클린 (Tc) 은대표적인수산용의약품 중하나로, 호기성그람양성및그람음성균, Richettsia, Mycoplasma, Chlamydia, 말라리아등 여러감염증에작용하는광범위항생제로알려져 있다. 테트라사이클린, 옥시테트라사이클린, 클로 르테트라사이클린등은구조적으로유사하고약 리작용및독성이거의동일하여테트라사이클린 계항생제로통합하여평가및관리되며, 테트라 사이클린계열항생제의세포벽합성억제작용기 작은세균 ribosome 의 30S subunit 에결합하여, acceptor 부위에 aminoacyl trna 가 mrna 와결합 하는것을방해하는방법으로단백질합성을억 제시켜정균작용을나타낸다. 테트라사이클린에 대해내성을갖는세균은 1950 년대처음으로확 인된이후현재다양한세균에서내성이증가하 여감염증치료에사용하기어려운경우가많아 졌다. 테트라사이클린계항생제의내성발생기 작은 3 가지로구분할수있으며, (1) 세포내로 침투한 tetracycline 을에너지의존성유출 (efflux) 을통해세포외로배출하여 ribosome 에축적되 지않게하는기작 (efflux pump), (2) 단백질합성 을위해 ribosome 에결합하는것을돕는보호단 백질을생산하는기작 (ribosomal protection), (3) 대사효소를활성화시켜 tetracycline 을불활성화 시키는기작 (enzymatic activation) 으로 tet(a), tet(b), tet(c), tet(d), tet(e), tet(g), tet(h), tet(i), tet(j), tet(k), tet(l) 및 tet(z) 는 efflux pump 에관 여하며, tet(m), tet(o), tet(s), tet(t) 및 tet(w) 는 ribosomal protection, tet(x) 는효소적기능에관여 하는것으로알려져있다 (Chopra and Roberts, 2001; Levy et al., 1999). 항생제내성균의증가는질병치료의어려움뿐 아니라축산물이나수산물을통해항생제내성균 이사람으로전달될위험이높은것으로알려져 항생제내성문제는공중보건학적으로중요하게 대두되고있으며, 항생제사용및세균의항생제 내성현황조사는치료용항생제의선택과내성 균의증가를막기위한대책수립의기초자료로 필요하나최근국내의항생제내성경향및내성 유전자조사는축산위주로이루어지고있다 (Kim et al., 2013; Lee et al., 2009). 어류의항생제내 성경향과내성유전자의분포에대한최근의연 구는이루어지지않고있는실정이며, 특히우리 나라넙치생산량의대부분을차지하고있는제 주지역에대한항생제내성경향및내성유전자 연구역시부족한실정이다. 따라서본연구에서 는제주도양식넙치에서분리한세균들을대상 으로항생제내성현황과테트라사이클린의내성 정도및 PCR을통한 Tc 내성유전자의분포및 종류를살펴보고자하였다. Ⅱ. 1. 균분리및동정 재료및방법 2016 년제주도내넙치양식장에서질병에감 염된것으로추정되는넙치로부터균을분리하 여, 실험균주로사용하였다. 분리균은 tryptic soy agar (TSA, Difco, USA) agar (BHIA, Difco, USA) 또는 brain heart infusion 배지상에서증식되었으 며, 균의동정을위해선택배지인 thiosulfate citrate bile salts sucrose (TCBS) agar (Difco, USA),

3 ㆍ ㆍ Salmonella Shigella (SS) agar (MB cell, Korea), glutamate starch phenol-red agar (GSP, Sigma-Aldrich, Korea), Blood agar 배지에시료의 내부장기를도말하고, 27 에서 18~24시간배양 하였다. Vibrio 선택배지인 sp. TCBS 균주의구분을위해비브리오 평판배지상에서초록색또는 노란색집락의집락을형성한것으로규정하였으 며, Edwardsiella tarda 균은선택배지인 SS 배지 에서검은색집락을형성하는것으로규정하였 다. 또한, 균주의세부적인종동정은 PCR 방법 을사용하여확인하였다. 종동정에사용한 PCR primer sets 는 <Table 1> 에나타내었다. 순수분리 된균주는 20% glycerol (Sigma, USA) 을첨가한 후실험에사용하기전까지 다. 2. 항생제감수성시험 80 에서보관하였 분리된균주는증균을위해 tryptic soy broth (TSB, Difco, USA) 를사용하였으며, 27 에서 18~24 시간동안배양하여실험에사용하였다. 배 양액은멸균한면봉을이용하여 mueller hinton agar (MHA, Difco, USA) 제디스크를평판에고착시켰다. 평판에도말한후항생 실험에사용된 항생제디스크는 amoxicillin, ampicillin, amoxicillin/clavulanic acid, ciprofloxacin, doxycycline, norfloxacin, ofloxacin, gentamycin, minocycline, nalidixic acid, oxolinic acid, oxytetracycline, tetracycline, chloramphenicol, erythoromycin, kanamycin, neomycin, penicilline, streptomycin 으로총 19종을대상으로실험을실 시하였으며, 모두 Liofilchem 로부터구입하여사 용하였다. 디스크를고착시킨 MHA는 27 에서 18~24 시간배양후균의증식억제대를확인하였 다. 3. MIC (Minimum inhibitory concentration) 균주들의 tetracycline과 oxytetracycline 에대한 내성정도는 broth dilution 방법을적용하여 MIC 값으로나타냈다. MIC 값측정을위하여, 96 well plate에 mueller hinton broth (MHB, Difco, USA) 160 μl, 단계별로희석한항생제 20 μl, 10 ⁵~10⁶ 으로희석시킨균배양액 20 μl를넣고, positive control에는 MHB 180 μl과균배양액 20 μl를넣 었으며, negative control에는 MHB 200 μl만넣었 다. Plate를 27 에서 18~24 시간배양한후, 균의 증식여부에따른액체배지의혼탁도를육안으로 확인하여균이자라지않은최소농도를 로결정하였다. MIC값으 <Table 1> Primers used for the detection of bacteria in this study Primer psp-1 psp-2 Oligonucleotide Sequences (5' to 3') 5'-TCCAGTCTTTCGACCTTCTT-3' 5 -CAAAGAGATGTTCGGCTTG-3' Amplicon size (bp) 220 bp Pathogen Streptococcus parauberis Reference psi-1 psi-2 5'-AAGAGACGCAGTGTCAAAAG-3' 5 -CGTTTCTTATCTTGTTACTC bp Streptococcus iniae Woo et al., 2006 plg-1 plg-2 5 -AAGCAGTCTTTTGATGCAAG-3 5 -ACTGTGCGCCCTTATTAACT bp Lactococcus garvieae E-1 5'-CGGTAAAGTTGAGTTTACGGGTG-3' E-2 5 -TGTAACCGTGTTGGCGTAAG bp Edwardsiella tarda Sakai et al.,

4 4. DNA 추출 PCR을위한 template DNA는 Higene Genomic DNA prep kit (BIOFACT, Korea) 를사용 하였다. 먼저 DNA 의추출을위하여, 균을 TSB 에접종하고 27 에서 18~24시간배양한후배 양액 1.5 ml를 1.5 ml microtube 에넣고, 10,000 rpm에서 1분간원심분리하여 pellet을수집하였 다. Cell Re-Suspension Solution 300 μl를넣어 pellet 을현탁시킨후, lysozyme 2 μl를첨가하여 37 에서 1 시간반응시켰다. 반응후 13,000 rpm 에서 1 분간원심분리하고, Cell Lysis Solution 300 μl를넣어 pellet 을현탁시키고, RNase A 1.5 μl를첨가하여 37 에서 30 분간반응시켰다. 반 응후실온에서식힌후 Protein Precipitation Solution 100 μl를넣고, 강하게 vortex하여 13,000 rpm에서 5 분간원심분리하였다. 상층액을 100% Isopropanol 300 μl가들어있는새 microtube에넣고 50회 inverting하여 13,000 rpm 에서 1 분간원심분리하였다. 상층액을제거한후 80% ethanol로 2 번세척하고, 15분간상온에서 건조시킨후, DNA Hydration Solution 50 μl를 넣고 5초간 vortex하여 DNA 를추출하였다. 분리 된 DNA는실험에사용하기전까지 20 에서 보관하였다. 5. PCR 및 Multiplex PCR 하여 본연구에서는 12종류의 Tc 내성유전자에대 PCR 방법으로분석하였으며, 사용된 primer sets 는 <Table 2> 에나타내었다. <Table 2> Primers and expected sizes of PCR amplicons of various tet genes Gene tet(a) to Primer TETF Oligonucleotide Sequences (5' to 3') GCGCTNTATGCGTTGATGCA Amplicon size tet(g) tet(a) TAR2 ACAGCCCGTCAGGAAATT 387 bp tet(b) TBR TGAAAGCAAACGGCCTAA 171 bp tet(c) TCR3 CGTGCAAGATTCCGAATA 631 bp tet(d) TDR3 CCAGAGGTTTAAGCAGTGT 489 bp tet(e) TER ATGTGTCCTGGATTCCT 246 bp tet(g) TGR3 ATGCCAACACCCCCGGCG 803 bp tet(k) TKF GTAATGGTACCTGGTAAATC TKR CTATTACCTATTGTCGCTAC 329 bp tet(l) TLF GATCGATAGTAGCCATGG TLR CTTCTATCAACAAGTATC 480 bp tet(m) TMF GAATCTGAACAATGGGAT TMR CTAACAATTCTGTTCCAGC 1,099 bp tet(o) TOF AGACGGAGCAGTATTAG TOR CTGCCCAACCTTTTGCTTCAC 200 bp tet(q) TQF GACTCTATGGATATAGAG TQR CCATATCCTCTACAATCG 835 bp tet(s) TSF CATAGACAAGCCGTTGACC TSR ATGTTTTTGGAACGCCAGAG 667 bp (bp) Reference Jun, 2003 Kim, 2004 Jun,

5 ㆍ ㆍ 이전의연구에서 efflux 기능을수행하는 tet(a), tet(b), tet(c), tet(d), tet(e), tet(g) 를검출하 기위해제작된 1개의 forward primer와각 tet gene에따른여섯개의 2003), tet(k), tet(l) 을검출하기위한 (Kim, 2004), 그리고 reverse primers (Jun, primer sets ribosomal protection의기능 을수행하는 tet(m), tet(o), tet(q) 및 tet(s) 를검 출하기위한 다 <Table 2>. primer sets (Jun, 2010) 를사용하였 Multiplex PCR 분석을위하여, 0.2 ml microtube에 1 µm의각 primer, 2.5 µm의각 dntp, 10x G-Taq Buffer, 2.5 U G-Taq DNA polymerase (Gene Pro Themal Cycler Cosmo, Korea) 및세균의 template DNA 를첨가한후, distilled water로최종 volume이 20 μl가되도록 하였고, 이전에보고된각각의 Tc 내성유전자에 대해특이적으로반응하는단일 forward primer 와 6개의 reverse primers 를넣어실시하였다. PCR 분석을위하여, 0.2 ml microtube에 1 µm 의각 primer, 2.5 µm의각 dntp, 10x G-Taq Buffer, 2.5 U G-Taq DNA polymerase (Gene Pro Themal Cycler Cosmo, Korea) 및 template DNA를 첨가한후 distilled water로 PCR 혼합물의최종 volume이 20 μl가되도록하였다. PCR 조건은 94 에서 3분간 pre-denaturation 시 킨후, 94 에서 30초 denaturation, 55 에서 30 초 annealing, 72 에서 30초 extension의반응을 1 cycle 로하여, 30 cycles 를반응시켰다. 그리고 72 에서 7분간 post-extension 시켰다. 증폭산물은 1x TAE buffer (40 mm Tris-acetate, 1 mm EDTA) 를전기영동을위한완 충액으로하여, 0.5 μg/ ml ethidium bromide가첨 가된 1% agarose gel 상에서전기영동후, UV 검 출기에서 band의크기를확인하여 Tc 내성유전 자의종류를확인하였다. Ⅲ. 결과 1. 균분리및동정 2016 년제주지역넙치양식장에서질병에감 염된것으로추정되는넙치로부터총 153 균주 를분리하여실험에사용하였다. 분리균은 TSA 와 BHIA 배지상에서증식되었으며, 선택배지인 TCBS, SS, GSP, Blood agar 를사용하여분류하 였다. Vibrioceae 는 TCBS 배지상에서초록색혹 은노란색집락을형성하는것으로규정하였으 며, E. tarda 균주는 SS 배지에서검은색집락을 형성하는것으로규정하였다. 또한, Streptococcus sp. 에대한세부적인동정을위하여, 특이적인 primer sets 를사용하여 PCR 을실시하였다 <Table 1>. Streptococcus sp. 균주의동정결과, S. parauberis 86 균주, S. iniae 1 균주가분리되었으 며, Lactococcus garvieae는검출되지않았다. 그 리고 Vibrio sp. 로추정되는 20 균주, E. tarda 16 균주, 미동정된 30 균주를분리하여실험에사 용하였다 [Fig. 1 & 2]. 2. 항생제감수성 제주도내넙치양식장에서분리한 S. parauberis 86 균주, S. iniae 1 균주, Vibrio sp. 20 균주, E. tarda 16 균주및동정되지않은 30 균주 [Fig. 1] 에대한항생제내성경향을알아보기 위한약제감수성결과는 [Fig. 3] 에나타내었다. S. parauberis 86 균주는 nalidixic acid 에 88.4%, oxolinic acid 에 82.6%, tetracycline 과 oxytetracycline 에각각 55.8% 로퀴놀론계항생제 와테트라사이클린계항생제에대해높은내성 률을보였으며, erythromycin, streptomycin 에는 30.2% 와 44.2% 의내성률을나타내었다. amoxicillin, ampicillin, amoxicillin/clavulanic acid, ciprofloxacin, norfloxacin, ofloxacin, minocycline, chloramphenicol, kanamycin 서는 등의항생제에대해 10% 이하의낮은내성률을보였으며, 86 균주의 95.3% 에해당하는 82균주가 2종류이상

[Fig. 1] Number of bacterial isolates from cultured fish in Jeju [Fig.

for Streptococcus parauberis (Lane 1, 2, 3, 4, 5, 6, 7 and 8),

iniae (Lane 9) and E-1/E-2 primer set for Edwardsiella tarda (Lane 10,

페니실린계항생제에대해 50% 이상의내성률을 나타내었고, 다른계열항생제에대한내성률은 5~20% 였으며,

의항생제에는감수성이있 었다. 또한, 20 균주중 90% 가페니실린계항생 제를포함해다른항생제에대해내성을가지는 다제내성균이었다.

6 [Fig. 1] Number of bacterial isolates from cultured fish in Jeju [Fig. 2] Amplification of bacterial DNA by PCR with psp-1/psp-2 primer set for Streptococcus parauberis (Lane 1, 2, 3, 4, 5, 6, 7 and 8), psi-1/psi-2 primer set for S. iniae (Lane 9) and E-1/E-2 primer set for Edwardsiella tarda (Lane 10, 11, 12, 13, 14 and 15), respectively. M, 100 bp DNA ladder. 의항생제에대해내성을가지는다제내성균임 을확인하였다. Vibrio sp. 로추정되는 20 균주에서의내성률은 amoxicillin 65%, ampicillin 70%, penicillin 65% 로 페니실린계항생제에대해 50% 이상의내성률을 나타내었고, 다른계열항생제에대한내성률은 5~20% 였으며, ciprofloxacin, norfloxacin, minocycline, gentamycin, neomycin 의항생제에는감수성이있 었다. 또한, 20 균주중 90% 가페니실린계항생 제를포함해다른항생제에대해내성을가지는 다제내성균이었다. E. tarda 16 균주에대한내성비율은 Vibrio sp. 와유사하게 penicillin, amoxicillin, ampicillin 등 페니실린계항생제에서 68.8~100% 였으며, erythromycin, tetracycline, oxytetracycline 에대해서 도 50% 이상의높은내성비율을확인할수

7 ㆍ ㆍ [Fig. 3] Antimicrobial resistance pattern of bacteria isolated from cultured fish in Jeju. *AML, amoxicillin; AMP, ampicillin; AUG, amoxicillin/clavulanic acid; CIP, ciprofloxacin; DXT, doxycycline; NOR, norfloxacin; OFX, ofloxacin; CN, gentamycin; MN, minocycline; NA, nalidixic acid; OA, oxolinic acid; OT, oxytetracycline; TE, tetracycline; C, chloramphenicol; E, erythromycin; K, kanamycin; N, neomycin; P, penicillin; S, streptomycin 있었다. 실험에사용된 E. tarda 16 균주모두 2 종류이상의항생제에내성을나타내는다제내 성균이었고, 실험에사용된모든균주들은 gentamycin 과 neomycin 에대해감수성이있었다. 3. MIC 약제감수성결과에서 tetracycline 이나 oxytetracycline 에대해내성이관찰된균주는 S. parauberis 57 균주, Vibrio sp. 3 균주, E. tarda 11 균주, 미동정 13 균주로, Tc 내성균주들과 감수성있는균주들의내성수준은 MIC 값으로확 인하였다. 그결과, tetracycline과 oxytetracycline 에 대해감수성있는실험균주들의 MIC 값은 0.78~1.56 μg/ ml의범위의값을나타내었으며 (data not shown), 내성을보이는 S. parauberis 57 균주 중 7 균주가 tetracycline 에대해 100 μg/ ml이상,

8 29 균주가 50 μg/ ml, 20균주는 25 μg/ ml그리고 1 균주가 6.25 μg/ ml의 MIC값을나타내었으며, oxytetracycline 에대해서는 6 균주가 100 μg/ ml이 상, 29 균주는 50 μg/ ml, 18 균주에서 25 μg/ ml, 4 균주가 12.5 μg/ ml의 MIC값을나타내었고, 두항 생제에대한 S. parauberis 균주의 MIC 값은대부 분 25~100 μg/ ml의범위에속하였다 <Table 3>. Vibrio sp. 3 균주중 1 균주는 tetracycline 과 oxytetracycline 에대해 100 μg/ ml이상의 MIC값을 나타내었고, 2 균주는각각의항생제에대해 25 μg/ ml, 50 μg/ ml의값을나타내었다. E. tarda 10 균주는 tetracycline 과 oxytetracycline 에대하여 100 μg/ ml이상의 MIC값을나타내었 고, 1 균주는 tetracycline 에대해 25 μg/ ml, oxytetracycline 에대해서는 50 μg/ ml의값을가졌 으며, 대부분의 E. tarda 균주는 100 μg/ ml이상의 높은내성수준을지니고있었다. 또한, 미동정된 13 균주에서는 tetracycline 에 대해 10 균주가 25~100 μg/ ml의 MIC값을나타내 었으며, 나머지균주는 3.125~12.5 μg/ ml의범위에 속하였다. oxytetracycline 에대해서는 13 균주모 두 25~100 μg/ ml의 MIC값을나타내었으며, tetracycline 보다좁은범위의내성수준을확인할 수있었다. 4. Tetracycline 내성유전자 2016년제주지역양식장의병어로부터분리된 총 153 균주에서 tetracycline 과 oxytetracycline 에대 해내성을보이는총 84 균주의 total nucleic acid 를사용하여 Tc 내성유전자의유무와그종류 및분포를조사하였다. 대부분그람음성세균에서 나타난다고보고된 tet(a), tet(b), tet(c), tet(d), tet(e) 및 tet(g) 6종류의 tet gene을검출하기위한 multiplex PCR 결과, E. tarda 10 균주에서 500 bp 에근접한 band를확인할수있었다 [Fig. 4]. 즉, 6 종류의 tet gene 중 tet(d) 가많이존재하였으며, tet(a), tet(b), tet(c), tet(e), tet(g) 는검출되지않 았다 <Table 4>. Vibrio sp. 로추정되는균주에서는 tet(b), tet(d), tet(b)&(m) 이각각 1균주씩검출되 었으며, 각각의 tet gene에대해서는 multiplex PCR 뿐만아니라단독으로 PCR 을실시하였을때 에도동일한결과를얻을수있었다. 그람양성균에서주로존재한다고알려져있는 tet(k), tet(l), tet(m), tet(o), tet(q), tet(s) 를검출하 기위한 PCR 결과, S. parauberis에서는 tet(s) 가 63.2% 로가장많이존재하였고, tet(m)&(s), tet(k)&(s) 같이 2종류의내성유전자를가지는 균주는각각 1 균주였으며, 나머지 tet(l), tet(o), tet(q) 는검출되지않았다. 미동정균주에서는 tet(s) 가 21.4% 로나타났으 며, 나머지균주들은본연구에서사용한 primer sets 로는확인할수없었다. <Table 3> Minimum inhibitory concentrations (MICs) of tetracycline and oxytetracycline against bacteria isolated from cultured fish in Jeju ( μg/ ml) Isolates Concentration of Tc / OTC S. parauberis (n=57) 7 / 6 29 / / 18 0 / 4 1 / 0 0 / 0 0 / 0 0 / 0 Vibrio sp. (n=3) 1 / 1 0 / 2 2 / 0 0 / 0 0 / 0 0 / 0 0 / 0 0 / 0 E. tarda (n=11) 10 / 10 0 / 1 1 / 0 0 / 0 0 / 0 0 / 0 0 / 0 0 / 0 Unknown (n=13) 7 / 10 1 / 2 2 / 1 1 / 0 1 / 0 1 / 0 0 / 0 0 /

ㆍ ㆍ [Fig. 4] DNA amplication of tet genes in tetracycline resistant isolates from cultured fish in Jeju. Lane 1, 2, 3, 4 and 5, tet(s) in Streptococcus parauberis; Lane 6, tet(m) in S.

9 ㆍ ㆍ [Fig. 4] DNA amplication of tet genes in tetracycline resistant isolates from cultured fish in Jeju. Lane 1, 2, 3, 4 and 5, tet(s) in Streptococcus parauberis; Lane 6, tet(m) in S. parauberis; Lane 7, tet(k) in S. parauberis; Lane 8, tet(b) in Vibrio sp.; Lane 9, tet(d) in Vibrio sp.; Lane 10, tet(m) in Vibrio sp.; Lane 11, 12 and 13, tet(d) in Edwardsiella tarda; Lane 14 and 15, tet(s) in unidentified bacteria; M, 100 bp DNA ladder. <Table 4> Detection of various tet genes in tetracycline resistant isolates from cultured fish in Jeju Isolates No. of isolates tet genes 49 tet(s) S. parauberis 1 tet(m)&(s) (n=57) 1 tet(k)&(s) 1 tet(b) Vibrio sp. 1 tet(d) (n=3) 1 tet(b)&(m) E. tarda (n=11) 10 tet(d) Unknown (n=13) 3 tet(s) total 67 Ⅳ. 고찰 항생제는양식현장에서생산성증가와감염증 치료의목적으로사용되어지고있으며, 항생제의 사용은최근내성균의발생과축산물이나수산물 을통해사람으로내성이전이되는등의문제가 제기되고있어공중보건학적측면에서중요하게 대두되고있다. 2016년제주지역넙치양식장의병어로부터 S. parauberis 86 균주, S. iniae 1 균주, Vibrio sp. 20 균주, E. tarda 16 균주, 미동정 30 균주총 153 균주를분리하였다. 연쇄구균병의원인체는 S. parauberis, S. iniae, Lactococcus garvieae 등으로 알려져있으나, 최근에는주로 S. parauberis의검 출빈도가뚜렷하게증가하는추세이다. 분리된균주들의 ampicillin, amoxicillin, ciprofloxacin, gentamycin, nalidixic acid, oxolinic acid, tetracycline, oxytetracycline, chloramphenicol,

10 erythromycin, kanamycin, streptomycin, penicillin 을포함한 등 19종의항생제에대한약제감수성결 과, S. parauberis는 nalidixic acid, tetracycline 등의 항생제에대해내성률이높았으며, 이는 S. parauberis 균주중 67% 가 oxolinic acid에내성이 있었고, tetracycline에대해서는 46.4% 의내성을 보였다는보고 (Kim et al., 2014; Kim et al., 2010) 와유사한결과를나타내었다. S. parauberis 균주 는 minocycline 과 doxycycline에대해 tetracycline보 다낮은내성률을보였는데, 이는 minocycline 이 나 doxycycline 이 tetracycline 에비해사용된시기 가짧고, 누적사용량이적어낮은내성비율이 나타난것으로생각된다. Vibrioceae는종이다양 하여 TCBS 배지에서초록색또는노란색 를형성하는것을분리해 colony Vibrio sp. 로분류하였 다. 이들은 ampicillin, amoxicillin 등의페니실린계 항생제에대해높은내성을보였고, 페니실린계 이외의항생제에대해서는대체적으로낮은내성 률을보였다. 이전 Son et al.(2005) 과 Kim et al.(2010) 이다양한 Vibrio sp. 가 ampicillin에대해 90% 가넘는높은내성률을보였다는보고와일 치하였으며, tetracycline에대한내성비율은종마 다차이가있는것으로보고되어이후세부적인 종동정과함께조사가더필요할것으로여겨진 다. E. tarda 에서는 penicillin, ampicillin, erythromycin, tetracycline 등다양한계열의항생제에높은내 성률을나타내었고, ampicillin에 38.8%, tetracycline에 84.4% 의내성을나타내었다는이전 의보고(Kim et al., 2010; Kim et al., 2012) 보다 본연구에서의 ampicillin과 tetracycline에대한내 성률이높게확인된것은항생제의사용량이감 소하였을때내성률또한감소하는양상을보였 다는이전의연구(Song et al., 2009) 로미뤄보았 을때, 양식현장에서항생제의사용량이줄어들 지않고여전히지속적으로사용되어짐을시사하 고있다. 그리고실험에사용된모든균주들은 chloramphenicol, ciprofloxacin, norfloxacin, ofloxacin 등의항생제에대해감수성이있거나 매우낮은내성률을보였는데, 이와같은결과는 chloramphenicol, fluoroquinolone 계열의항생제가 동물에투여되는것이금지되면서항생제의사용 량이감소하여균주들의내성빈도역시낮아진 것으로보인다. 또한, 모든균주들이 gentamycin 과 neomycin 에대해감수성이있었는데, 이는대 부분의세균에서 neomycin의내성비율이높이 나타난이전의보고(Heo et al., 2002) 와차이가 있었다. 실험에사용된 153 균주중대부분의균주들이 2 종류이상의항생제에대해내성을가지는다제 내성균이었다. S. parauberis 와 E. tarda 균주에대 해이전의보고들은 (Kim et al., 2006; Kim et al., 2010) 다제내성균의비율이 90% 이상이었으며, 본연구에서도그와유사한결과를확인할수있 었다. Kim et al.(2010) 은 Vibrio sp. 의다제내성률 이 57.9% 라보고하였으나, 본연구에서는 70% 로 다제내성균의비율이증가하는것을확인할수 있었다. Tetracycline 계, penicillin 계, quinolone계항 생제에대한높은내성률은이전의연구들에서 보고된바가있으나제주지역의항생제내성현 황연구는제대로이루어지지않았었으며, 따라 서본연구가제주도내항생제내성경향에대한 기초자료로활용될것으로사료된다. 양식현장에서장기간 tetracycline계항생제의 사용으로내성균이출현하였으며, 그로인한감 염증치료의어려움및적절한약제선택의부재 등의문제가발생하였다. 제주도내양식장에서 분리한 153 균주중 tetracycline 내성균주는 84 균주였으며, MIC test를통해내성수준과균주들 이지니고있는내성유전자의분포및종류를 PCR 및 multiplex PCR 을통해살펴보았다. Chopra and Roberts(2001), Roberts(2005) 는 tet(m) 이가장일반적이며, 다양한그람양성세균 과음성세균뿐만아니라 mycoplasma 에서도발견 된다고보고하였고, 이전 Park et al.(2009) 의보고

11 ㆍ ㆍ 는 S. parauberis 내 tet gene의분포를살펴보았으 며, 그결과 tet(m) 을가지는균주는 42 균주, tet(s) 를가지는균주는 15 균주로, tet(s) 보다 tet(m) 의검출빈도가더높은것을확인하였다. 그러나본연구에서는 tet(s) 가가장 dominant한 gene 이었으며, tet(m) 은 2종류의내성유전자를 가지는 2 균주에서만검출되어이전의보고와다 소차이가있었다. 본연구에서 tet(m) 을가지는 내성균의비율이낮은이유는제주도에서분리된 균주의지역적특성으로분류할지는더지속적 인연구가필요할것으로여겨진다. S. parauberis 내 tet gene을지니는균주들의 tetracycline 이나 oxytetracycline 에대한 MIC값은대부분 25~100 μg / ml이상의범위에속하였으며, tet gene이확인되 지않은균주들은본연구에서의 primers가적용 되지않는다른내성유전자를지닐가능성이있 는것으로추정하였다. Vibrio sp. 에서확인된내성유전자는각각 tet(b), tet(d), 그리고 tet(b)&(m) 으로, Vibrio sp. 에 서모두 tet(b) 가검출되었다는보고(Jun, 2003) 및 tet(b)&(m) 이검출되었다는이전의보고(Kim, 2004) 와일치하였으나, tet(d) 의검출은이전과다 른내성유전자의분포를확인할수있었다. 하 지만, 실험에사용된 Vibrio sp. 균주의수가이전 의연구에서사용된수보다부족하기때문에향 후보다많은균주를채집하여추가적인연구가 필요할것으로사료된다. Vibrio sp. 내 tet gene을 지니는균주들의 tetracycline과 oxytetracycline 에 대한내성정도를확인한결과, 2종류의내성유 전자를지니는균주에서의 MIC값은 100 μg/ ml 이상이었으며, tet(b) 와 tet(d) 를지니는균주들의 MIC값은 25~50 μg/ ml이었다. 이전 Roberts(1996) 는 E. tarda 균주에서는 tet(a) 와 tet(d) 가발견된다고보고하였으며, 본연 구에서분리한 E. tarda 10 균주모두 tet(d) 를지 니고있는것을확인하여이전에보고된결과와 일치하였다. tet gene을가지는 E. tarda 균주들의 MIC 값을확인해보았더니, 100 μg/ ml이상의 MIC 값을가진 E. tarda 10 균주는 tet(d) 를가지고있 었으나 tetracycline과 oxytetracycline 에대해각각 25 μg/ ml, 50 μg/ ml의 MIC값을가진 1 균주에서 는 tet gene 을확인할수없었다. E. tarda의 tetracycline 에대한 MIC값이 25 μg/ ml이상이었을 때 tet gene 이확인되었다는이전의보고(Jun, 2003) 와상이한결과를보였다. 한편, S. parauberis 6 균주, E. tarda 1 균주, 미 동정 10 균주는 tetracycline이나 oxytetracycline 에 대해내성이있었으나 본연구에서사용한 primer sets 로는내성유전자를확인할수없었으 며, 이러한결과는본연구에서사용하지않은 tet(i), tet(t) 및 tet(w) 같이다른종류의내성유 전자이거나, 새로운 tet gene의출현에의한결과 로해석할수있다. 따라서이후에는본연구에 서사용되지않은 primer sets를통해확인을하 는등의추가적인연구가필요할것으로생각된 다. References Chopra, I. and Roberts, M. C.(2001). Tetracycline Antibiotics: Mode of Action, Applications, Molecular Biology, and Epidemiology of Bacterial Resistance. Microbiology and Molecular Biology Reviews 65(2), 232~260. Heo, J. H. Jung, M. H. Cho, M. H. Kim, G. H. Lee, K. C. Kim, J. H. and Jung, T. S.(2002). The study on fish diseases with reference to bacterial susceptibility to antibiotics in the southern area of Kyeognam. Journal of Veterinary Clinics 19(1), 19~22 Jee, B. Y. Shin, K. W. Lee, D. W. Kim, Y. J. and Lee, M. K.(2014). Monitoring of the mortalities and medications in the inland farms of olive flounder, Paralichthys olivaceus, in South Korea. Journal of Fish Pathology 27(1), 77~83. Jun, L. J.(2003). Characterization of tet genes in fish pathogenic bacteria from Korea. Master's Thesis, Department of Fish Pathology, Pukyong National University, Busan, South Korea

12 Jun, L. J.(2010). Characterization of antibiotic resistant genes carried by fish pathogens in Korea. Ph.D. Thesis, Department of Fish Pathology, Pukyong National University, Busan, South Korea. Kim, J. H. Kim, S. G. Kim, S. S. Kim, J. H. Park, S. H. Nam, K. H. Kim, H. B.(2013). Analysis of the antibiotic resistance gene in Salmonella Typhimurium isolates from diseased pigs in Gyeongbuk province. Korean Journal of Veterinary Service 36(2), 73~78. Kim, J. H. Lee, C. H. and Kim, E. H.(2006). Transferable R plasmid of Streptococci isolated from diseased olive flounder (Paralichthys olivaceus) in Jeju. Journal of Fish Pathology 19(3), 267~276. Kim, J. W. Cho, M. Y. Jee, B. Y. Park, M. A. and Kim, N. Y.(2014). Administration and use of aquaculture drugs in Korea. Journal of Fish Pathology 27(1), 67~75. Kim, M. S. Cho, J. Y. Seo, J. S. Jung, S. H. Choi, H. S. and Park, M. A.(2012). Distribution of MIC value of antibiotics against Edwardsiella tarda isolated from olive flounder (Paralichthys olivaceus). Journal of Fish Pathology 25(3), 181~188. Kim, M. S. Seo, J. S. Park, M. A. Cho, J. Y. Hwang, J. Y. Kwon, M. G. and Jung, S. H.(2010). Antimicrobial resistance of Edwardsiella tarda, Vibrio spp., and Streptococcus spp. isolated from olive flounder (Paralichthys olivaceus). Journal of Fish Pathology 23(1), 37~45. Kim, S. S. Jang, J. W. Song, J. W. Lim, S. J. Jeong, J. B. Lee, S. M. Kim, K. W. Son, M. H. and Lee, K. J.(2009). Effects of dietary supplementation of alga mixtures (Hizikia fusiformis and Ecklonia cava) on innate immunity and disease resistance against Edwardsiella tarda in olive flounder (Paralichthys olivaceus). Korean Journal of Fisheries and Aquatic Science 42(6), 614~620. Kim, S. Y. Kim, Y. C. Jeong, S. K. Jun, L. J. Jin, J. W. and Jeong, H. D.(2014). Increased resistance to Quinolones in Streptococcus parauberis and development of a rapid assay for detecting mutations in topoisomerase genes. Korean Journal of Fisheries and Aquatic Science 47(3), 247~254. Kim, Y. H.(2004). Characterization of tetracycline resistance genes in Vibrio spp. isolated from marine fishes. Master's Thesis, Department of Fish Pathology, Pukyong National University, Busan, South Korea. KOSIS.(2016). Korean Statistical Information Service. Lee, H. W. Lim, S. K. and Kim, M. N.(2009). Characteristics of Ampicillin-Resistant Vibrio spp. isolated from a west coastal area of Korean peninsula. Korean Journal of Fisheries and Aquatic Science 42(1), 20~25. Levy, S. B. MuMurry L. M. Barbosa, T. M. Burdett, V. Courvalin, P. Hillen, W. Roberts, M. C. Rood, J. I. & Taylor, D. E.(1999). Nomenclature for new tetracycline resistance determinants. Antimicrobial Agents and Chemotherapy 43(6), 1523~1524. Park, Y. K. Nho, S. W. Shin, G. W. Park, S. B. Jang, H. B. Cha, I. S. Ha, M. A. Kim, Y. R. Dalvi, R. S. Kang, B. J. Jung, T. S.(2009). Antibiotic susceptibility and resistance of Streptococcus iniae and Streptococcus parauberis isolated from olive flounder (Paralichthys olivaceus). Veterinary Microbiology 136, 76~81. Roberts, M. C.(2005). Update on acquired tetracycline resistance genes. FEMS Microbiology Letters 245, 195~203. Roberts, M. C.(1996). Tetracycline resistance determinants: mechanisms of action, regulation of expression, genetic mobility, and distribution. FEMS Microbiology Reviews 19, 1~24. Sakai, T. Iida, T. Osatomi, K. and Kanai, K.(2007). Detection of Type 1 Fimbrial genes in fish pathogenic and non-pathogenic Edwardsiella tarda strains by PCR. Fish Pathology 42(2), 115~117. Son, K. T. Oh, E. G. Lee, T. S. Lee, H. J. Kim, P. H. and Kim J. H.(2005). Antimicrobial susceptibility of Vibrio parahaemolyticus and Vibrio alginolyticus from fish farms on the southern coast of Korea. Korean Journal of Fisheries and Aquatic Science 38(6), 365~371. Song, J. H.(2009). Current status and future strategies of antimicrobial resistance in Korea. Korean Journal of Medicine 77(2), 143~

13 ㆍ ㆍ Woo, S. H. Kim, H. J. Lee, J. S. Kim, J. W. and Park, S. I.(2006). Pathogenicity and classification of streptococci isolated from cultured marine fishes. Journal of Fish Pathology 19(1), 17~33. Received : 24 March, 2017 Revised : 26 April, 2017 Accepted : 12 April,

398 이다원ㆍ전려진ㆍ김승민ㆍ정준범 (Lee and Kim, 2013)., Em (Lee et al., 2016) Korean statistical information service (KOSIS),,., Em (Han et al., 2012; Sung et

398 이다원ㆍ전려진ㆍ김승민ㆍ정준범 (Lee and Kim, 2013)., Em (Lee et al., 2016) Korean statistical information service (KOSIS),,., Em (Han et al., 2012; Sung et 한수지 51(4), 397-403, 2018 Original Article Korean J Fish Aquat Sci 51(4),397-403,2018 제주지역양식넙치 (Paralichthys olivaceus) 에서분리한어병세균내 Erythromycin 내성유전자분석 이다원 전려진 김승민 1 정준범 * 제주대학교해양의생명과학부, 1 주식회사우진비앤지 Analysis