04_08_HM _rev3_ hwp

Size: px

Start display at page:

Download "04_08_HM _rev3_ hwp"

윤정 원
5 years ago
Views:

1 Korean Journal of Microbiology (213) Vol. 49, No. 2, pp DOI Copyright c 213, The Microbiological Society of Korea 보문 원유시료에서분리한장알균속세균의다중약물유출펌프 (Multidrug Efflux Pump) 유전자의분포도와항생제내성패턴 강소원 1 이상진 1 최성숙 2 * 1 삼육대학교동물과학부, 2 삼육대학교약학대학 Distribution of Multidrug Efflux Pump Genes in Enterococci spp. Isolated from Bovine Milk Samples and Their Antibiotic Resistance Patterns SoWon Kang 1, SangJin Lee 1, and SungSook Choi 2 * 1 Division of Animal Science, Sahmyook University, Seoul , Republic of Korea 2 College of Pharmacy, Sahmyook University, Seoul , Republic of Korea (Received March 26, 213 / Accepted June 9, 213) The major aim of this study was to investigate the distribution of genes that encode multidrug efflux pumps in Enterococci spp. isolates from bovine milk samples and antibiotic resistance patterns of these strains. Of the 245 isolates, 44.1% showed ampicillin resistance, 79.2% showed erythromycin resistance, 76.3% showed tetracycline resistance and 36.3% showed chloramphenicol resistance. In case of vancomycin and ciprofloxacin, all of the isolates were susceptible to these antibiotics. Of the 245 enterococcal isolates, 82.1% have MFS type eme(a) gene, 72.7% have ABC type efr(a) gene, 77.1% have ABC type efr(b) gene, and 71.8% have ABC type lsa gene. In case of Enterococcus faecalis, the original strain for these genes, 92.5% have eme(a), 87.4% have efr(a), 88.4% have efr(b), and 88.4% have lsa. Interestingly, in case of different species of Enterococci, eme(a) was also detected in four strains of E. faecium, seven strains of E. avium, four strains of E. durans and two strains of E. raffinosus. efr(a) was also detected in two strains of E. faecium and two strains of E. durans and efr(b) was also detected in four strains of E. faecium, five strains of E. avium and four strains of E. durans. This means the possibility of co-transfer of resistance genes between Enterococci species in natural environment. These results are the first report describing the presence of same multidrug efflux pumps in different species of Enterococci in Korea. Keywords: Enterococci, antibiotic resistance, bovine milk sample, multidrug efflux pump 장알균속세균은그람양성균으로사람과동물에정상적으로상재하는세균의일종으로보통사람과동물의소화관, 야채류및유제품등에서쉽게검출되는균이다 (Devriese et al., 1992; Flahaut et al., 1997). 건강한사람에게는질병의위험이없으나면역성이약한만성질환자등을대상으로원내감염을일으켜수술후감염, 비뇨기감염및균혈증의주요원인균으로알려지기시작하였다 (Klein et al., 1998). 하지만장알균이본태성내성을나타내는항생제가많을뿐아니라감수성이던항생제에대해내성을획득하는경우가많아항생제를이용한장알균감염치료를어렵게하고있다 (Malani et al., 22). 항생제내성의문제는사람뿐만아니라축산분야에서도내성증가로인한가축의질병치료의어려움을겪고있고내성균또는내성에관여하는 *For correspondence. sschoi@syu.ac.kr; Tel.: ; Fax: 유전자가사람에게로의전달가능성이제기되고있어공중보건학적으로중요하게대두되고있다 (OIE, 21; NORM, 23). 세균이항생제에내성을나타내는기전은 1) 항생제의불활성화 2) 약물의표적부위의변화 3) 세포내투과도변화에의한약물의세포내농도감소 4) 약물의능동적유출등으로구분할수있다 (Putman et al., 2). 특히다제내성균의문제가심각한현실에서약물의능동적유출에관여하는펌프의중요성은점점증가하고있다. 약물유출을담당하는펌프는항생제의종류에구애받지않고다양한항생제, 살균소독제및각종독성물질들도동시에유출시키며특이성이크지않기때문에한번도노출된적이없는서로다른계열의항생제도유출할수있어동시에여러항생제에내성을나타내도록한다 (Levy, 1992; Saier et al., 1994). 세균에서알려진다중약물유출펌프는에너지원과염기서열의유사성에따라크게다섯가지로구분할수있다 : 1) ATP binding cassette (ABC) superfamily (Lubelski et al., 27), 2)

2 장알균속세균의다중약물유출펌프 127 major facilitator superfamily (MFS) (Pao et al., 1998), 3) small multidrug resistance (SMR) superfamily (Jack et al., 21), 4) multidrug and toxic compound extrusion (MATE) superfamily (Kuroda and Tsuchiya, 29), 5) resistance-nodulation-cell division (RND) superfamily (Tseng et al., 1999; Seeger et al., 28). 이중그람양성세균은 ABC, MFS 및 SMR 타입의유출펌프를갖고있는것으로보고되었다 (Depardieu et al., 27). 다중약물유출펌프는염색체또는 plasmid 상에그유전자가존재하며특히염색체상에존재한다는것은기질인항생제등에의해필요에따라유전자발현을조절할수있다는장점이된다 (Grkovic et al., 22; Hollenbeck and Rice, 212). 대표적인장알균속세균인 Enterococcus faecalis (E. faecalis) 에서잘알려진다중약물유출펌프로는 MFS 타입에속하는 EmeA와 ABC 타입에속하는 EfrAB와 Lsa가있다. EmeA는 Staphylococcus aureus의 NorA와염기서열의유사성이있는펌프로 quinolone 계항생제, 염화벤잘코니움등의살균소독제의내성에관여하고있음이알려져있다 (Jonas et al., 21). Lsa는지금까지장알균속세균중 E. faecali에서만존재하는것으로알려진다중약물유출펌프로 lincosamide 및 streptogramnin계, quinolon계항생제및살균제의유출에관여하는것으로보고되었다 (Singh et al., 22). 최근 Lee 등 (23) 의연구에따르면전형적인 ABC 타입의약물유출펌프에해당하는 EfrAB가 E. faecalis에서발견되었으며관련유전자로 efr(a) 와 efr(b) 가있음을보고하였다. EfrAB는 tetracycline, quinolone계항생제및각종살균, 소독제에대한내성에관여하는다중약물유출펌프이다 (Lubelski et al., 27). 그외에도 macrolide계항생제에특이적인 mef(a), tetracycline에특이적인 tet(k), tet(l) 은 drug-specific efflux pump로알려진장알균에존재하는 MFS 타입의펌프이다. 최근 Sánchez 등 (213) 은스페인의전통발효식품에서분리한 E. faecalis의 96% 가 ABC 타입의유출펌프인 EfrAB을갖고있으며 E. faecium의 16% 가이유전자를갖고있다고보고하였다. 본연구에서는우리나라원유시료에서분리한장알균을대상으로각종항생제에대한내성패턴을연구하고장알균에존재한다고보고된다중약물유출펌프인 EmeA, EfrAB 및 Lsa의분포도를조사, 비교하고자하였다. 특히 E. faecalis 이외의다른종에속한장알균속에서 eme(a), efr(a), efr(b) 및 lsa 유전자분포율과유전자의염기서열의유사성을확인하고자하였다. 재료및방법균주및배지본연구에사용한균주는본실험실에서분리, 동정하여보관하고있던장알균속세균 245균주 (Kim et al., 212) 를대상으로실험을하였으며균주의배양은 Brain Heart Infusion (Difco, USA) 배지를사용하였다. 항생제감수성검사 245균주의장알균을대상으로 ampicillin (Sigma Co., USA), erythromycin (Sigma Co.), tetracycline (Sigma Co.), chloramphenicol (Sigma Co.), vancomycin (Sigma Co.) 및 ciprofloxacin (Korea united pharm Inc.) 에대한감수성검사를실시하였다. 감수성검사는 Clinical Laboratory Standards Institute (CLSI, USA) 의고체배지희석법으로실시하였으며 (CLSI, 27) Muller-Hinton (Difco) 배지를사용하고표준장알균으로 E. faecalis ATCC29212를사용하였다. 본실험에사용한항생물질은최고농도를 64 μg/ml 로하고 2배계열희석하여최저농도가.3 μg/ml 되도록항생물질희석계열을만들었다. 여기에하룻밤전배양한균액을 1 6 CFU/ml 되도록희석한후 5 μl씩항생제배지에접종하여배양하고균주의성장을확인할수없는가장낮은항생제의농도를최소억제농도 (Minimum Inhibitory Concentration, MIC) 로결정하였다 약물유출펌프관련유전자의검출다중약물유출펌프유전자후보군으로는 eme(a), efr(a), efr(b) 및 lsa를대상으로하였으며 drug specific 한 msr(a), msr(c), mef(a), tet(l) 및 tet(k) 에대한분포도함께확인하였다. 장알균의 genomic DNA는 GeneAll Cell SV kit (GeneAll Biotechnology Co. Ltd., Seoul, Korea) 을이용하여분리하였으며장알균의세포벽의분해를용이하게하기위하여 lysozyme (3 mg/ml, Sigma) 을첨가하였다. 유전자의검출은 gene specific PCR 반응을실시하였으며 primer는 Genotech (Daejeon, Korea) 에서제작하여사용하였다. 본실험에사용한 primer 의염기서열과반응조건을 Table 1에나타내었다. PCR 반응은 AccuPower TM premix (Bioneer, Korea) 를사용하여 95, 5분간 denaturation 후 95, 3초, Table 1에표시된 annealing 조건에서 3초, 72 1분간 extension 반응을 3회반복후마지막 72 1분간 elongation하였다. 다중약물유출펌프의 DNA 염기서열분석 PCR 반응으로증폭한 DNA 절편이해당약물유출펌프유전자인지확인하기위하여 DNA 염기서열을확인하였다. 각유전자의 PCR 반응후전기영동을실시하여해당크기의 DNA 절편을 agarose gel에서잘라낸후 GeneAll PCR purificaiotn kit (GeneAll Biotechnology Co. Ltd.) 을이용해 agarose gel에서 DNA를추출, 정제후 Genotech에의뢰하여염기서열을결정후미국국립의학도서관 (PubMed) 에서제공하는염기서열분석 (nucleotide blast) 을하여염기서열의동질성을확인하였다. 결과및고찰 장알균의항생제감수성유형원유시료에서분리한 245 장알균속균주의항생제내성을조사한결과 ampicillin에대한내성률은 44.1% (MIC 5 8 μg/ml, MIC 9 32 μg/ml), erythromycin에대한내성률은 79.2% (MIC 5 > 64 μg/ml, MIC 9 > 64 μg/ml), tetracycline에대한내성률은 76.3% (MIC 5 > 64 μg/ml, MIC 9 > 64 μg/ml), chloramphenicol 에대한내성률은 36.3% (MIC 5 8 μg/ml, MIC 9 > 64 μg/ml), vancomycin 에대한내성률은 % (MIC 5.5 μg/ml, MIC 9 1 μg/ml)

3 128 Kang et al. Table 1. Primers used for this study Gene Sequences (5 3) Amplicon (bp) Annealing Temp. ( ) eme(a) AGCCCAAGCGAAAAGCGGTTT CCATCGCTTTCGGACGTTCA erf(a) GTCTGTTTCGTTTAATGGCAGCAGCC CGAATAGCTGGTTCATGTCTAAGGC erf(b) ATGTTCTTAATCAATCCGCTGATGGC CATAGTAACTACCAAGGACAGCTACCC lsa GTGACTTCTTTTGAACAGTGGGA TTCAGCCACTTGTTGTCTGCC mef(a) ATTGCAGCTGGTTTACAGGC CATGATACAATGCACACGCA msr(a) GCA AATGGTGTAGGTAAGACAACT ATCATGTGATGTAAACAAAAT msr(c) ATAACAAACCTGCAAGTTC CTTCAATTAGTCGATCCATA tet(k) TTAGGTGAAGGGTTAGGTCC GCAAACTCATTCCAGAAGCA tet(l) CACGATAGCTAAGGTTATAACGAAGATAGTAGCC AATGGAAAAGGTTAACATAAAGGCTGTGTTCACCC Table 2. Distribution of MIC values against the 245 Enterococcal isolates from raw milk sample Abs Number of isolates with MIC (μg/ml) MIC range Interpretation (μg/ml) >64 range MIC 5 MIC 9 S I R Amp > (55.9) (44.1) Em >64 >64 > (3.7) (17.1) (79.2) Tc >64 >64 > (23.3) (.4) (76.3) Cam >64 8 > (49.4) (14.3) (36.3) Van (99.6) (.4) Cip (95.5) (4.5) Amp, ampicillin; Em, erythromycin; Tc, tetracycline; Cam, chloramphenicol; Van, vancomycin; Cip, ciprofloxacin. S, sensitive; I, intermediate; R, resistant. 및 ciprofloxacin에대한내성률은 % (MIC 5.5 μg/ml, MIC 9 1 μg/ml) 로관찰되었다. 본연구결과장알균의 erythromycin과 tetracycline에대한내성균의비율이 79.2% 와 76.3% 로높게나타났으며이러한결과는다른국내, 외다른연구결과와도유사한경향을보이고있음을알수있으며 (Mannu et al., 23; Kwon et al., 27; Jeong et al., 28; Nam et al., 29) 우리나라축산물유래장알균의 erythromycin과 tetracycline에대한내성비율이높음을알수있었다 (Table 2). 약물유출펌프유전자의분포비율장알균에존재하는 multidrug efflux pump를 coding 하는 eme(a), efr(a), efr(b) 및 lsa 유전자의분포를 PCR법으로확인하였다. 그결과총 245균주중 21균주 (82.1%) 가 eme(a) 를보유하고있었으며, 178균주 (72.7%) 가 efr(a) 유전자를, 189균주 (77.1%) 가 efr(b) 유전자를보유하고있었으며 176균주 (71.8%) 가 lsa 유전자를보유하고있었다. 한편내성비율이높은 erythromycin 과 tetracycline에특이적인 efflux pump인 mef(a), msr(a), msr(c), tet(k) 및 tet(l) 의분포도함께조사한결과 143 균주 (58.4%) 가 erythromycin specific pump인 mef(a) 를 3균주 (12.2%) 가 tetracycline specific pump인 tet(l) 을갖고있음을확인하였다 (Table 3). 장알균속에서알려진대표적인다중약물유출펌프인 EmeA는 MFS 계열에속하는펌프로 S. aureus의 NorA와염기서열유사성이 32% 인펌프이다 (Jonas et al., 21). EmeA는각종항생제와염화벤잘코니움등의살균소독제내성에관여하고있음이알려져있는대표적인 multidrug efflux pump로본실험에사용한전체장알균중 82.1% (21/245) 에분포하고있었다. E. faecalis의경우 199균주중 184균주에서 (92.5%) eme(a) 유전자가분포함을확인하였으며그외에도 E. faecium 균주에서 25 균주중 4개균에서 (16%), E. avium의경우 7개균주모두에서 (1%), E. durans의경우 6균주중 4개균주에서, E. raffinosus 의경우 4개균주중 2개균주에서 eme(a) 가존재함을알수있었으며각유전자의염기서열의동질성은 E. faecalis V583 유전

4 장알균속세균의다중약물유출펌프 129 Table 3. Distribution of multidrug drug efflux pump genes in Enterococci spp. isolated from bovine milk samples in Korea Strains No. of isolates Erythromycin Phenotypes Tetracycline Genotypes Multidrug efflux pumps Drug-specific efflux pumps Resistance Resistance Range MIC 5 MIC 9 Range MIC 5 MIC 9 rate rate eme(a) efr(a) efr(b) lsa mef(a) tet(l) MIC (μg/ml) MIC (μg/ml) E. faecalis 199(81.2).13~>64 >64 >64 17(85.4).5~>64 >64 >64 149(74.9) (92.5) (87.4) (88.4) (88.4) (67.8) (12.1) E. faecium 25(1.2) 3.13~>64 >64 >64 15(6.6).25~25 >64 >64 18(72.) (16) (8) (16) (2) (16) E. avium 7(2.9) 4~>64 4 >64 3(42.9) 64~>64 64 >64 7(1) (1) (71.4) (42.9) E. durans 6(2.5) 2~>64 4 >64 2(33.3) 16~>64 >64 >64 6(1) (66.7) (33.3) (66.7) (16.7) 1 E. gallinarum 4(1.6).25~>64 >64 >64 3(75) >64 >64 >64 4(1) (25) 2 E. raffinosus 4(1.6).13~> (25) 1~>64 >64 >64 3(75.) (5) 21 Total 245(1).13~>64 >64 >64 194(79.2).25~>64 >64 >64 187(76.3) (82.1) 178 (72.7) 189 (77.1) 176 (71.8) 143 (58.4) 3 (12.2) 자와 98% 이상동질성이있음을알수있었다. EmeA는원래 E. faecalis에존재하는 MFS 타입의약물유출펌프이나본연구결과에따르면 E. faecium, E. avium, E. durans 및 E. raffinosus에서도염기서열이거의동일한 eme(a) 유전자가존재함을확인할수있었으며이는같은속에속한균사이의유전자의수평이동에대한가능성을말해주고있다. 한편 ABC 타입의다중약물유출펌프인 lsa, efr(a) 및 efr(b) 유전자의분포는 lsa의경우 245균주중 176균주에서 (71.8%) 관찰되었으며 efr(a) 는 245균중 178균주에서 (72.7%), efr(b) 는 189균주에서 (77.1%) 관찰되었다. Singh 등 (22) 의보고에따르면환자에게서분리된장알균을대상으로한연구결과 E. faecalis균은 1% 가 lsa 유전자를보유하며그외의다른종의장알균에서는 lsa 유전자의존재를확인하지못하였다고하였고 lsa 유전자를인위적으로 E. faecium 에도입하였을때정상적으로발현되어 quinupristin/dalfopristine 에대한내성을획득함을보고하였다. 하지만본연구에따르면 88.4% 의 E. faecalis가 lsa 유전자를소유하고있었으며그외다른종에선 lsa 유전자가존재하지않았다. 한편가장최근에알려진새로운 ABC 타입의유출펌프인 EfrAB 펌프유전자는 E. faecalis 외에도 efr(a) 는 E. faecium 2균주, E. durans 2균주에존재함을확인하였으며 efr(b) 는 E. faecium 4균주, E. avium 5 균주, E. durans 4균주에존재하는것을확인하였다. 장알균속에존재하는 efr(a) 와 efr(b) 유전자분포를보고한 Sanchez 등 (213) 의연구에따르면 E. faecalis에서는 96%, E. faecium에서는 13% 의균에본유전자가분포한다고보고하고있다. 하지만본연구에서확인된것으로는 E. faecalis 중 87.4% 에서 efr(a) 가, 88.4% 에서 efr(b) 가분포하였으며 E. faecium 중 8% 에서 efr(a) 가, 16% 에서 efr(b) 가분포하고있었다. 한편그외다른장알균인 E. avium, E. durans 및 E. raffinosus에서도 efr(a), efr(b) 유전자가존재함을확인하였다. 특히본연구에서확인된각유전자의염기서열의동질성은 E. faecalis V583과비교하였 을때 98% 이상동질성이있음을알수있었으며 E. faecalis 및 E. faecium이외장알균속에서 efr(a), efr(b) 가존재함을보고한최초의보고로사료되어더욱가치가있는자료로판단되다. 한편원유시료에서분리된장알균이 erythromycin과 tetracycline 에대해높은내성률을나타내어두약물에특이적인 efflux pump의존재를조사한결과 erythromycin에대한 efflux pump 중에는 mef(a) 만이존재하는것을확인하였으며 (143/245, 58.4%) tetracycline에특이적인 efflux pump는 tet(l) 만이존재하는것을 (3/245, 12.2%) 확인하였다. 특히 tetracycline에대한높은내성률에비해 tet(l) 의분포률은상대적으로낮으나이는이미본연구자등이보고한대로 (Kim and Choi, 212) 63.7% 의균이표적부위를변화시키는 tet(m) 을갖고있기때문인것으로사료된다. 본연구는우리나라의축산물유래장알균에서다중약물유출펌프유전자인 eme(a), efr(a), efr(b), 및 lsa 유전자의분포비율을연구한첫보고라사료되며또한 E. faecalis 이외다른종의장알균에서 E. faecalis에존재한다고알려진다중약물유출펌프유전자인 eme(a), efr(a) 및 efr(b) 가존재함을규명한연구로서동일속에속한다른종의균주간의내성유전자의수평이동에대한가능성을시사하는결과로추후에도지속적인모니터링이필요된다. 적요원유시료에서분리한장알균속세균 245균주의항생제내성에관여하는다중약물유출펌프유전자분포도와항생제내성패턴을연구하였다. 그결과 245 장알균속균주의 ampicillin에대한내성률은 44.1%, erythromycin에대한내성률은 79.2%, tetracycline에대한내성률은 76.3%, chloramphenicol에대한내성률은 36.3% 였으며 vancomycin과 ciprofloxacin에대해서는모두감수성임을알수있었다. 내성관련유전자중 MFS타

5 13 Kang et al. 입의 eme(a) 는 82.1% 의장알균에분포하였으며, ABC 타입의유전자인 efr(a) 는 72.7%, efr(b) 는 77.1%, lsa는 71.8% 의장알균에분포하였다. 특히이러한유전자의기원세균인 Enterococcus faecalis의경우 eme(a) 는 92.5%, efr(a) 는 87.4%, efr(b) 는 88.4%, lsa는 88.4% 의분포도를나타내었다. 한편동일한장알균속이지만종이다른장알균에서 eme(a) 는 E. faecium 4균주, E. avium 7균주, E. durans 4균주및 E. raffinosus 2균주에분포하고있었다. efr(a) 는 E. faecium 2균주와 E. durans 2균주에분포하였으며, efr(b) 는 E. faecium 4균주, E. avium 5균주및 E. durans 4균주에분포하였다. 본연구는우리나라원유시료에서분리한장알균속의여러종의세균에서동일한다중약물유출펌프 (multidrug efflux pump) 의분포에대한첫번째보고라사료되며 E. faecalis 이외의장알균속에서이러한유전자의분포는서로다른종간의유전자의수평적인이동의가능성을시사한다. 감사의말 본연구는 212학년도삼육대학교교내연구비로수행되었으며이에감사드립니다. 참고문헌 CLSI. 27. Performance standards for antimicrobial susceptibility testing: seventeenth informational supplement. Clinical and Laboratory Standards Institute. ASM press, Washington, D.C., USA. Depardieu, F., Podglajen, I., Leclercq, R., Collatz, E., and Courvalin, P. 27. Modes and modulations of antibiotic resistance gene expression. Clin. Microbiol. Rev. 2, Devriese, L.A., Collins, M.D., and Wirth, R The genus Enterococcus. In Ballows, A., Truper, H.G., Dworkin, M., Harder, W., and Schleifer, K.H. (eds.) The Prokaryotes, 2 nd edn., vol. 2, pp , Springer-Verlag, New York, N.Y., USA. Flahaut, S., Boutibonnes, P., and Auffray, Y Les enterocoques dans I environnement proche de I homme. Canad. J. Microbiol. 43, Grkovic, S., Brown, M.H., and Skurray, R.A. 22 Regulation of bacterial drug export systems. Microbiol. Mol. Biol. Rev. 66, Hollenbeck, B.L. and Rice, L.B Intrinsic and acquired resistance mechanisms in enterococcus. Virulence 3, Jack, D.L., Yang, N.M., and Saier, M.H.Jr. 21. The drug/metabolite transporter superfamily. Eur. J. Biochem. 268, Jeong, S.H., Lim, S.K., Lee, H.S., Jeong, B.Y., Lee, J.Y., Yang, C.B., and Shin, H.C. 28. The present situation of antibiotics used in animal and resistant bacteria. Infect. Chemother. 4, Suppl Jonas, B.M., Murray, B.E., and Weinstock, G.M. 21. Characterization of emea, a NorA homolog and multidrug resistance efflux pump, in Enterococcus faecalis. Antimicrob. Agents Chemother. 45, Kim, J.H. and Choi, S.S Prevalence and molecular characterization of tetracycline resistance in Enterococcus isolates from raw milk samples in Korea. J. Fd. Hyg. Safety 27, Kim, J.H., Lee, S.J., and Choi, S.S Copper resistance and its relationship with erythromycin resistance in Enterococcus isolates from bovine milk samples in Korea. J. Microbiol. 5, Klein, G., Pack, A., and Reuter, G Antibiotic resistance patterns of enterococci and occurrence of vancomycin-resistant enterococci in raw minced beef and pork in Germany. Appl. Environ. Microbiol. 64, Kuroda, T. and Tsuchiya, T. 29. Multidrug efflux transporters in the MATE family. Biochim. Biophys. Acta. 1794, Kwon, Y.I., Kim, T.W., Kim, H.Y., Chang, Y.H., Kwak, H.S., Woo, G.I., and Chung, Y.H. 27. Monitoring of antimicrobial resistant bacteria from animal farm environments in Korea. Kor. J. Microbiol. Biotechnol. 35, Lee, E.W., Huda, M.N., Kuroda, T., Mizushima, T., and Tsuchiya, T. 23. EfrAB, an ABC multidrug efflux pump in Enterococcus faecalis. Antimicrob. Agents Chemother. 47, Levy, S.B Active efflux mechanisms for antimicrobial resistance. Antimicrob. Agents Chemother. 36, Lubelski, J., Konings, W.N., and Driessen, A.J. 27. Distribution and physiology of ABC-type transporters contributing to multidrug resistance in bacteria. Microbiol. Mol. Biol. Rev. 71, Malani, P.N., Kauffman, C.A., and Zervos, M.J. 22. Enterococcal disease, epidemiology and treatment. In Gilmore, M.S. (ed.) The Enterococci: pathogenesis, molecular biology and antimicrobtiotic resistance. pp Amercan Society for Mcirobiology. Washington, D.C., USA. Mannu, L., Paba, A., Daga, E., Comunian, R., Zanetti, S., Duprè, I., and Sechi, L.A. 23. Comparison of the incidence of virulence determinants and antibiotic resistance between Enterococcus faecium strains of dairy, animal and clinical origin. Int. J. Food Microbiol. 88, Nam, H.M., Lim, S.K., Moon, J.S., Kang, H.M., Kim, J.M., Jang, K.C., Kim, J.M., Kang, M.I., Joo, Y.S., and Jung, S.C. 29. Antimicrobial resistance of enterococci isolated from mastitic bovine milk samples in Korea. Zoonoses Public Health. 57, NORM. NORM-VET. 23. Usage of antimicrobial agents and occurrence of antimicrobial resistance in Norway, pp OIE. European Scientific Conference. 21. The use of antibiotics in animal ensuring the protection of public health, pp Pao, S.S., Paulsen, I.T., and Saier, M.H.Jr Major facilitator superfamily. Microbiol. Mol. Biol. Rev. 62, Putman, M., van Veen, H.W., and Konings, W.N. 2. Molecular properties of bacterial multidrug transporters. Microbiol. Mol. Biol. Rev. 64, Saier, M.H.Jr., Tam, R., Reizer, A., and Reizer, J Two novel families of bacterial membrane proteins concerned with nodulation, cell division and transport. Mol. Microbiol. 11, Sánchez, V.A., Lavilla, L.L., Benomar, N., Gálvez, A., Pérez, P.R., and Abriouel, H Phenotypic and molecular antibiotic resistance profile of Enterococcus faecalis and Enterococcus faecium isolated from different traditional fermented foods. Foodborne Pathog. Dis. 1, Seeger, M.A., Diederichs, K., and Eicher, T. 28. The AcrB efflux pump: conformational cycling and peristalsis lead to multidrug resistance. Curr. Drug Targets. 9, Singh, K.V., Weinstock, G.M., and Murray, B.E. 22. An Enterococcus faecalis ABC homologue (Lsa) is required for the resistance of this species to clindamycin and quinupristin-dalfopristin. Antimicrob. Agents Chemother. 46, Tseng, T.T., Gratwick, K.S., and Kollman, J The RND permease superfamily: an ancient, ubiquitous and diverse family that includes human disease and development proteins. J. Mol. Microbiol. Biotechnol. 1,

Lumbar spine

Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical