398 이다원ㆍ전려진ㆍ김승민ㆍ정준범 (Lee and Kim, 2013)., Em (Lee et al., 2016) Korean statistical information service (KOSIS),,., Em (Han et al., 2012; Sung et

Size: px
Start display at page:

Download "398 이다원ㆍ전려진ㆍ김승민ㆍ정준범 (Lee and Kim, 2013)., Em (Lee et al., 2016) Korean statistical information service (KOSIS),,., Em (Han et al., 2012; Sung et"

Transcription

1 한수지 51(4), , 2018 Original Article Korean J Fish Aquat Sci 51(4), ,2018 제주지역양식넙치 (Paralichthys olivaceus) 에서분리한어병세균내 Erythromycin 내성유전자분석 이다원 전려진 김승민 1 정준범 * 제주대학교해양의생명과학부, 1 주식회사우진비앤지 Analysis of Erythromycin Resistance Gene in Pathogenic Bacteria Isolates from Cultured Olive flounder Paralichthys olivaceus in Jeju Da Won Lee, Lyu Jin Jun, Seung Min Kim 1 and Joon Bum Jeong* School of Marine Biomedical Sciences, Jeju National University, Jeju 63243, Korea 1 Central Research Institute, Woo Gene B&G, Hwaseong 48513, Korea We determined the resistance rates of pathogenic bacteria isolated from cultured olive flounder Paralichthys olivaceus to erythromycin (Em), antibiotic typically used in aquaculture and analyzed the genotypes of resistant bacteria using polymerase chain reaction (PCR). We isolated and utilized 160 isolates of Streptococcus parauberis, 1 of S. iniae, 66 of Edwardsiella tarda, 56 of Vibrio sp. and 23 of unidentified bacteria from presumed infected olive flounder from Jeju Island from March 2016 to October Of the 306 isolated strains, Em-resistant strains included 33 of S. parauberis, 39 of E. tarda and 2 of Vibrio sp. We conducted PCR to assess the resistance determination of Emresistant strains. Five different types of Em-resistance genes were detected in the 74 Em-resistant strains: erm (A), erm (B), erm (C), mef (A) and mef (E); erm (A) and erm (B) were detected in 1 (3%) and 24 (72.7%) S. parauberis isolates, respectively. In E. tarda, erm (B) was detected in five isolates (12.8 %) and no Em-resistance genes were detected in the two Vibrio sp. isolates. Key words: Erythromycin, Olive flounder, Resistance gene, Jeju, erm (B) 서론 1920,,., (Lee et al., 2010a),. Animal and Plant Quarantine Agency (APQA, 2009) erythromycin (Em) 6.3%, oxytetracycline. Em macrolide, 50S ribosome ribonucleic acid (RNA) (Hansen et al., 1999). Em,. methylase ribosome, erm (erythromycin ribosome methylation), efflux pump mef (A) (macrolide efflux), msr (A) (macrolide and streptogramine B), vag (virginiamycin factor) (Lee and Kim, 2013). Em rrna methylase erm (A), erm (B), erm (C), efflux mef (A) (Sapkota et al., 2006). macrolide Korean J Fish Aquat Sci 51(4) , August 2018 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial Licens ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Received 2 July 2018; Revised 5 August 2018; Accepted 14 August 2018 *Corresponding author: Tel: Fax: address: jeongjb@jejunu.ac.kr Copyright 2018 The Korean Society of Fisheries and Aquatic Science 397 pissn: , eissn:

2 398 이다원ㆍ전려진ㆍ김승민ㆍ정준범 (Lee and Kim, 2013)., Em (Lee et al., 2016) Korean statistical information service (KOSIS),,., Em (Han et al., 2012; Sung et al., 2013; Lee et al., 2016). macrolide Em,. 재료및방법 균주의채집및분리 tryptic soy agar (TSA, Difco., USA) brain heart infusion agar (BHIA, Difco., USA) thiosulfate citrate bile salts sucrose (TCBS) agar (Difco., USA), salmonella shigella (SS) agar (MB cell, Korea), glutamate starch phenol-red agar (GSP, Sigma-Aldrich, Korea), blood agar (KOMED, Korea), 균주의동정 SS Edwardsiella tarda, TCBS Vibrio sp.. Higene genemic DNA prep kit (BIO- FACT, Korea) genomic DNA, Table 1 primer sets PCR. Table 1. Primer sets used for the identification of bacteria in this study Target pathogen Oligonucleotide sequences (5'-3') Product size (bp) Reference Streptococcus iniae AAGAGACGCAGTGTCAAAAG CGTTTCTTATCTTGTTACTC 220 Streptococcus parauberis TCCAGTCTTTCGACCTTCTT CAAAGAGATGTTCGGCTTG 107 Woo et al., 2006 Lactococcus garvieae AAGCAGTCTTTTGATGCAAG ACTGTGCGCCCTTATTAACT 307 Edwardsiella tarda CGGTAAAGTTGAGTTTACGGGTG TGTAACCGTGTTGGCGTAAG 415 Sakai et al., 2007 Vibrio genus GTCARATTGAAAARCARTTYGGTAAAGG ACYTTRATRCGNGTTTCRTTRCC 689 Vibrio alginolyticus ACGGCATTGGAAATTGCGACTG Kim et al., TACCCGTCTCACGAGCCCAAG Vibrio anguillarum GTTCATAGCATCAATGAGGAG GAGCAGACAATATGTTGGATG 519 Demircan and Candan, 2006 Vibrio harveyi GTGATGAAGAAGCTTATCGCGATT CGCCTTCTTCAGTTAACGCAGGA 601 Kim et al., 2014 Vibrio parahaemolyticus AGCTTATTGGCGGTTTCTGTCGG CKCAACACCAAGAAAAGCCGTC 297 Kim et al., 2015 Pseudomonas anguilliseptica GACCTCGCGCCATTA CTCAGCAGTTTTGAAAG 438 Blanco et al., 2002 Flexibacter maritimus TGTAGCTTGCTACAGATGA AAATACCTACTCGTAGGTACG 400 Cepeda et al., 2003

3 Erythromycin 내성유전자분석 399 항생제감수성검사 Em, clinical and laboratory standards institute (CLSI, 2017),. tryptic soy broth (TSB, Difco., USA), , mueller hinton agar (MHA, Difco., USA), Liofilchem, amoxicillin (10 g, AML), amoxicillin/clavulanic acid (30 g, AUG), ampicillin (10 g, AMP), chloramphenicol (10 g, C), ciprofloxacin (5 g, CIP), doxycycline (30 g, DXT), enrofloxacin (5 g, ENR), erythromycin (15 g, E), gentamycin (10 g, CN), kanamycin (30 g, K), minocycline (30 g, MN), nalidixic acid (30 g, NA), neomycin (30 g, N), norfloxacin (10 g, NOR), ofloxacin (5 g, OFX), oxolinic acid (2 g, OA), oxytetracycline (30 g, OT), penicillin (10 g, P), streptomycin (10 g, S), sulfadiazine (300 g, SUZ), tetracycline (30 g, TE) 21,., Em broth dilution method minimum inhibitory concentration (MIC) test, Lee et al. (2010b). 100 g/ml 0.78 g/ml mueller hinton broth (MHB, Difco., USA) 1/2, MIC plate Erythromycin 내성유전자검출 Em erm (A), erm (B), erm (C), mef (A) mef (E) PCR, primer Table 2. PCR 1 µm primer, 2.5 µm dntp, 10x G-Taq Buffer, 2.5 U G-Taq DNA polymerase (Gene Pro Themal Cycler Cosmo) template DNA, distilled water PCR volume 20 L. PCR 94 3 pre-denaturation, denaturation, annealing, extenstion 1 cycle 30 cycles, 72 7 post-extension. 1% agarose gel, UV (UVP, USA) band. 결과 세균의분리및동정 SS, TCBS, GSP, Blood agar, Streptococcus sp. 161, E. tarda 66, Vibrio sp. 56, 23. PCR, S. parauberis 160, S. iniae 1, Lactococcus garvieae. E. tarda SS 66, PCR. Vibrioceae PCR, 56 Vibrio sp. V. alginolyticus Table 2. Primers and expected sizes of PCR products of various erm / mef genes Gene Primer Oligonucleotide sequences (5 to 3 ) Product size (bp) Reference erm (A) Em (A)F GTTCAAGAACAATCAATACAGAG Em (A)R GCATCAGGAAAAGGACATTTTAC 421 erm (B) Em (B)F GAAAAGGTACTCAACCAAAT Em (B)R AGTAACGGTACTTAAATTGT 639 erm (C) Em (C)F GCTAATATTGTTTAAATCGTCAATTCC Em (C)R GGATCAGGAAAAGGACATTTTAC 572 Jun, 2010 mef (A) mef-f ATGGAAAAATACAACAATTGG mefa-r GTAGTACAGCCATTCCTTC 646 mef (E) mef-f ATGGAAAAATACAAACAATTGG mefe-r CCTATCAACATTCCAGATGC 812 PCR, polymerase chain reaction; erm, erythromycin ribosome methylation; mef, macrolide efflux.

4 400 이다원ㆍ전려진ㆍ김승민ㆍ정준범 100 Streptococcus parauberis (n=33) Edwardsiella tarda (n=39) Vibrio sp. (n=9) Rate of resistant isolates (%) more than less than 12.5 MIC value of erythromycin (µg/ml) Fig. 1. MIC value distribution of erythromycin against Streptococcus parauberis, Edwardsiella tarda, Vibrio sp. isolated from olive flounder Paralichthys olivaceus. 4, V. harveyi Vibrio primer sets V. alginolyticus, V. anguillarum, V. harveyi, V. parahaemolyticus Vibrio., primer sets., (,,, ) , (,,, ) S. parauberis 119, S. iniae 1, E. tarda 46, Vibrio sp. 38, Erythromycin 내성균주분리 Em Em. Em S. parauberis 33, E. tarda 39, Vibrio sp. 9.,,,, 99 S. parauberis 5, E. tarda 10, Vibrio sp (16.2%),,, 207 S. parauberis 28, E. tarda 29, Vibrio sp (31.4%),.,, (30.1%), (22.4%) Em. Minimum inhibitory concentration (MIC) Em 81 MIC test. S. parauberis g/ml, g/ml, g/ml g/ml MIC (Fig. 1). E. tarda 5 50 g/ml, g/ml. Vibrio sp. 9 E. tarda g/ml, 2 25 g/ml MIC. S. parauberis E. tarda, Vibrio sp., Em MIC. 약제감수성 S. parauberis, E. tarda Vibrio sp. macrolide penicillins, tetracyclines Table 3. S. parauberis quinolone (91.9%), sulfonamide (79.4%), tetracycline (50%), E. tarda penicillin (80.3%), tetracycline (75.8%), quinolone (54.5%), sulfonamide (45.5%)., Vibrio sp. penicillin

5 Erythromycin 내성유전자분석 401 고찰 Fig. 2. DNA amplification of erm gene in erythromycin resistant isolates of Streptococcus parauberis, Edwardsiella tarda and Vibrio sp. from cultured fish in Jeju. Lane 1, S. parauberis-erm (A); Lane 2-9, S. parauberis-erm (B); Lane 10-14, E. tarda- erm (B); Lane 15 and 16, Vibrio sp.-not detected; M, 100bp DNA ladder., chloramphenicol. Erythromycin 내성유전자분석 Em total nucleic acid, PCR Em. erm (A), erm (B), erm (C), mef (A) mef (E) PCR Jun (2010), S. parauberis 33 erm (B) 24 (72.7%), 1 (3%) erm (A) (Table 4, Fig. 2). Em E. tarda 39 5 (12.8%) erm (B),., Vibrio sp., 5 erm/mef.,,,,. Em 6.3% oxytetracycline (APQA, 2009). Em, PCR Em S. parauberis 160, S. iniae 1, E. tarda 66, Vibrio sp L. garvieae, S. parauberis, S. iniae, Enterococcus sp. (Domeenech et al., 1996; Eldar and Ghittino, 1999),, S. parauberis 160., S. iniae S. parauberis (Jeong et al., 2006) S. iniae S. parauberis., Thompson et al. (2004) 60,, TCBS, Demircan and Candan (2006), Kim et Table 3. Number of bacterial isolates from cultured fish against various antimicrobial agents Isolates Penicillins Antimicrobial agents Quinolones Tetracyclines Aminoglycosides Sulfonamides Chloramphenicols Streptococcus parauberis (n=160) 11 (6.9%) 80 (50%) 147 (91.9%) 70 (43.8%) 127 (79.4%) 4 (2.5%) Edwardsiella tarda (n=66) 53 (80.3%) 50 (75.8%) 36 (54.5%) 15 (22.7%) 30 (45.5%) 0 (0%) Vibrio sp. (n=56) 49 (87.5%) 15 (26.8%) 5 (8.9%) 10 (17.9%) 12 (21.4%) 3 (5.4%) Table 4. Detection of various erm / mef genes in erythromycin resistant isolates from cultured fish in Jeju Resistance isolates Genotypes of erythromycin resistance factor erm (A) erm (B) erm (C) mef (A) mef (E) Streptococcus parauberis (n=33) Edwardsiella tarda (n=39) Vibrio sp. (n=2) erm, erythromycin ribosome methylation; mef, macrolide efflux.

6 402 이다원ㆍ전려진ㆍ김승민ㆍ정준범 al. (2014), Kim et al. (2015)., V. alginolyticus 4, V. harveyi 2. Vibrio sp., V. scophthalmi, V. harveyi, V. anguillarum, Photobacterium damselae (Jo, 2006). Em CLSI (2017) 13 mm. S. parauberis 33, E. tarda 39, Vibrio sp (30.1%), 32 (22.4%) Em., E. tarda %, 56.3%, Vibrio sp. 10.2%, 12.5% E. tarda. S. parauberis 23 (46.9%), 10 (31.3%)., Em. Em MIC test, PCR. CLSI (>8 g/ml), Vibrio sp. Em 2, gene. Luna et al. (1999) Portillo et al. (2000) erm (B), erm (A). S. parauberis erm (B) 24, erm (A) 1. E. tarda Em,. E. tarda 39 Em erm (B) 5 (Fig. 2). E. tarda Vibrio sp. S. parauberis Em (Hiroshi, 1996)., erm mef, Lee et al. (2010a) Em erm mef msr, erm (B) mef (A). msr primer., mef mph (Nonaka et al., 2015).,. Em. 사사 References APQA (Animal and Plant Quarantine Agency) National antibiotic use and monitoring of antimicrobial resistance in 2015 [Internet]. Retrieved from on Jun 18, Blanco MM, Gibello A, Vela AI, Moreno MA, Dominguez L and Fernandez-Garayzabal JF PCR detection and PFGE DNA macrorestriction analyses of clinical isolates of Pseudomonas anguilliseptica from winter disease outbreaks in sea bream Sparus aurata. Dis Aquat Org 50, Cepeda C, Garcia-Marquez S and Santos Y Detection of Flexibacter maritimus in fish tissue using nested PCR amplification. J Fish Dis 26, j x. CLSI (Clinical and Laboratory Standards Institute) Performance standards for antimicrobial susceptibility testing, 28th edition [Internet]. Retrieved from on Jun 14, Demircan D and Candan A Identification of Vibrio anguilliarum by PCR (rpon Gene) associated with Vibriosis in marine fish in Turkey. Turk J Vet Anim Sci 30, Domeenech A, Derenaaandez-Garayzabal JF, Pascual C, Garcia JA, Cutuli MT, Moreno MA, Collins MD and Dominguez L Streptococcosis in cultured turbot, Scopthalmus maximus, associated with Streptococcus parauberis. J Fish Dis 19, tb00117.x. Eldar A and Ghittino C Lactococcus garvieae and Streptococcus iniae infections in rainbow trout Oncorhynchus mykiss: similar, but different diseases. Dis Aquat Org 36,

7 Erythromycin 내성유전자분석 Han AR, Yoon YJ and Kim JW Antibiotic Resistance and Plasmid Profile of Vibrio parahaemolyticus Strains Isolated from Kyunggi-Incheon Coastal Area. Kor J Microbiol 48, Hansen LH, Mauvais P and Douthwaite S The macrolide-ketolide antibiotic binding site is formed by structures in domains II and V of 23S ribosomal RNA. Mol Microbiol 31, Hiroshi N Multidrug Efflux Pumps of Gram-Negative Bacteria. J Bacteriol 178, Jeong YU, Kang CY, Kim MJ, Heo MS, Oh DC and Kang BJ Characterization of Streptococcosis occurrence and molecular identification of the pathogens of cultured flounder in Jeju island. J Microbiol 42, Jo MR Rapid molecular identification and antibiotic resistance of Vibrio spp. Isolated from the farmed olive flounders in Jeju island, Korea. Master s Thesis, Jeju National University, Jeju, Korea. Jun LJ Characterization of antibiotic resistant genes carried by fish pathogens in Korea. Ph. D. Thesis, Pukyong National University, Busan, Korea. Kim HJ, Ryu JO, Lee SY, Kim ES and Kim HY Multiplex PCR for detection of the Vibrio genus and five pathogenic Vibrio species with primer sets designed using comparative genomics. BMC Microbiol 15, org/ /s Kim MS, Cho JY and Choi HS Identification of Vibrio harveyi, Vibrio ichthyoenteri and Photobacterium damselae isolated from olive flounder Paralichthys olivaceus in Korea by multiplex PCR developed using the rpob gene. J Fish Sci 80, Lee SY and Kim YH Incidence of Erythromycin Resistance Genes, erm(b) and mef(a), in Streptococci Isolated from Dental Plaques of Koreans. Int J Oral Biol 38, /IJOB Lee DW, Jun LJ and Jeong JB Distribution of Tetracycline Resistance Genes in Pathogenic Bacteria Isolated from Cultured Olive Flounder (Paralichthys olivaceus) in Jeju in JFMSE 29, JFMSE Lee HI, Jung JH, Lee SJ and Choi SS. 2010a. Analysis of Genotype and Phenotype of Erythromycin Resistance in Enterococci spp. Isolated from Raw Milk Samples. Kor J Microbiol 46, Lee HY, Lim JE, Kim SC, Kim KR, Lee SS, Kwon OK, Yang JE and Ok YS. 2010b. Environmental Monitoring of Selected Veterinary Antibiotics in Soils, Sediments and Water Adjacent to a Poultry Manure Composting Facility in Gangwon Province, Korea. J Korean Soc Environ Eng 32, Luna VA, Coates P, Eady EA, Cove JH, Nguyen TH and Roberts MC A variety of Gram-positive bacteria carry mobile mef genes. J Antimicro Chemother 44, org/ /jac/ Nonaka L, Maruyama F, Suzuki S and Masuda M Novel macrolide-resistance genes, mef (C) and mph (G), carried by plasmids from Vibrio and Photobacterium isolated from sediment and seawater of a coastal aquaculture site. Appl Microbiol 61, abs/ /lam Portillo A, Ruiz-Larrea F, Zarazaga M, Alonso A, Martinez JL and Torres C Macrolide Resistance Genes in Enterococcus spp.. Antimicrob Agents Chemother 44, Sakai T, Iida T, Osatomi K and Kanai K Detection of type 1 fimbrial genes in fish pathogenic and non-pathogenic Edwardsiella tarda strains by PCR. Fish Pathol 42, /jsfp Sapkota AR, Ojo KK, Roberts MC and Schwab KJ Antibiotic resistance genes in multidrug-resistant Enterococcus spp. And Streptococcus spp. Recovered from the indoor air of a large-scale swine-feeding operation. Lett Appl Microbiol 43, x. Sung CH, Chon JW, Kwak HS, Kim HS and Seo KH Prevalence and Antimicrobial Resistance of Enterococcus faecalis and Enterococcus faecium Isolated from Beef, Pork, Chicken and Sashimi. Korean J Food Sci 33, /kosfa Thompson FL, Iida T and Swings J Biodiversity of Vibrios. Microbiol Mol Biol Rev 68, org/ /mmbr Woo SH, Kim HJ, Lee JS, Kim JW and Park SI Pathogenicity and classification of streptococci isolated from cultured marine fishes. J Fish Pathol 19,

42(3)-11(p ).fm

42(3)-11(p ).fm The Korean Journal of Microbiology, Vol. 42, No. 3, September 2006, p. 199-204 Copyright 2006, The Microbiological Society of Korea e ³ w ³ w Á Á½ Áx Á 1 Á 2, * w w w w w w e ³ ³ w p w. e ³ w ù š» 30 cm.

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA JFM SE, 29(3), pp. 834~846, 2017. www.ksfme.or.kr 수산해양교육연구, 제29권제3 호, 통권87 호, 2017. http://dx.doi.org/10.13000/jfmse.2017.29.3.834 2016 년도제주지역양식넙치(Paralichthys olivaceus ) 에서분리된어병세균의 tetracycline 내성유전자분포

More information

레이아웃 1

레이아웃 1 2014 의약품 제품 요약 해설집 National Fisheries Research & Development Institute 정 부 간 행 물 등 록 번 호 11-1192266-000040-01 과학원간행물 등록번호 S P - 2 0 1 4 - A Q - 0 0 2 2014 의약품 제품 요약 해설집 National Fisheries Research & Development

More information

한수지 52(4), , 2019 Original Article Korean J Fish Aquat Sci 52(4), ,2019 Streptococcus parauberis 의디스크확산법결과에대한 Epidemiological Cut-off Val

한수지 52(4), , 2019 Original Article Korean J Fish Aquat Sci 52(4), ,2019 Streptococcus parauberis 의디스크확산법결과에대한 Epidemiological Cut-off Val 한수지 52(4), 382-388, 2019 Original Article Korean J Fish Aquat Sci 52(4),382-388,2019 Streptococcus parauberis 의디스크확산법결과에대한 Epidemiological Cut-off Value 의설정 천원경 이윤항 김윤재 노형진 김아란 김남은 서정수 1 권문경 1 이지훈 1 김도형

More information

338 김승민ㆍ전려진ㆍ박명애ㆍ정현도ㆍ정준범 viral hemorrhagic septicemia (VHS) Scuticocilate,, cm, 1-3.,,.,, cohabitation test. 실험어 재료및방법 2010 (E03), 2011 (E06),

338 김승민ㆍ전려진ㆍ박명애ㆍ정현도ㆍ정준범 viral hemorrhagic septicemia (VHS) Scuticocilate,, cm, 1-3.,,.,, cohabitation test. 실험어 재료및방법 2010 (E03), 2011 (E06), 한수지 48(3), 337-345, 2015 Original Article Korean J Fish Aquat Sci 48(3),337-345,2015 제주도여윔증상넙치 (Paralichthys olivaceus) 로부터분리한점액포자충의특성분석 김승민 전려진 1 박명애 2 정현도 3 정준범 * 제주대학교해양의생명과학부, 1 제주대학교수산백신연구센터, 2 국립수산과학원수산생물방역과,

More information

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770> Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한

More information

한수지 49(6), , 2016 Original Article Korean J Fish Aquat Sci 49(6), ,2016 Photobacterium damselae 의디스크확산법결과에대한 Epidemiological Cut-off Valu

한수지 49(6), , 2016 Original Article Korean J Fish Aquat Sci 49(6), ,2016 Photobacterium damselae 의디스크확산법결과에대한 Epidemiological Cut-off Valu 한수지 49(6), 838-844, 2016 Original Article Korean J Fish Aquat Sci 49(6),838-844,2016 Photobacterium damselae 의디스크확산법결과에대한 Epidemiological Cut-off Value 의결정 권문경 임윤진 1 김명석 2 서정수 김도형 1 * 국립수산과학원방역과, 1 부경대학교수산생명의학과,

More information

(2005\263\342\271\351\274\255_final.hwp)

(2005\263\342\271\351\274\255_final.hwp) 제 2 절 식 의약품 종합정보서비스 243 제1장 평 가 분 야 제1절 식품규격평가 분야 제2절 식품안전평가 분야 제3절 의약품평가 분야 제4절 생약평가 분야 제5절 생물의약품평가 분야 제6절 의료기기평가 분야 제 1 절 식품규격평가 분야 245 제1장 평가분야 제1절 식품규격평가 분야 제1 항 식품의 기준 규격 1. 식품공전 식품의 기준 규격은 식품위생법

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

<B8F1C2F72E687770>

<B8F1C2F72E687770> 제1장 제17장 성홍열 및 사슬알균 감염증 사슬알균 (Streptococci)은 증식 중의 특징적으로 쌍 또는 사슬모양의 그람양성 알균 으로 catalase 음성, 통성혐기성균이며, 보통 한천배지에서는 발육이 어렵고 혈액이나 혈청 등을 첨가한 배지에서 잘 발육한다. 포도당이나 다른 탄수화물을 분해하나 포도당 을 분해하여 가스를 생성하지 않는다. 이들은 최소

More information

Microsoft PowerPoint - PDFCoTemp.PPT

Microsoft PowerPoint - PDFCoTemp.PPT 주요유방염세균의검출및 항생제감수성검사 임숙경 1. 검사시료 1. 시료채취 유방염우유 2. 체세포수측정 3. 대상세균 - Staphylococcus aureus - Coagulase negative staphylococci -Escherichia coli 3. 균분리방법 E. coli CHEC Agar 직접도말 (37 18-24h) 보라색집락 EMB Agar

More information

MBL fm

MBL fm Microbiol. Biotechnol. Lett. (2017), 45(3), 250 256 pissn 1598-642X eissn 2234-7305 Microbiology and Biotechnology Letters 해양유래미생물을이용한어류질병세균에대한항균활성탐색 김동휘, 박소현, 김지현, 이해리, 허문수 * 제주대학교해양과학대학수산생명의학과 Received:

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

( )Kju225.hwp

( )Kju225.hwp 비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin

More information

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법

More information

한수지 49(5), , 2016 Original Article Korean J Fish Aquat Sci 49(5), ,2016 창선해역의지중해담치 (Mytilus galloprovincialis) 양식장및육상오염원에서분리한대장균 (Escheri

한수지 49(5), , 2016 Original Article Korean J Fish Aquat Sci 49(5), ,2016 창선해역의지중해담치 (Mytilus galloprovincialis) 양식장및육상오염원에서분리한대장균 (Escheri 한수지 49(5), 564-572, 2016 Original Article Korean J Fish Aquat Sci 49(5),564-572,2016 창선해역의지중해담치 (Mytilus galloprovincialis) 양식장및육상오염원에서분리한대장균 (Escherichia coli) 의항생제내성 권순재 이가정 * 정연중 박상기 고경리 양지혜 목종수 국립수산과학원남동해수산연구소

More information

인문사회과학기술융합학회

인문사회과학기술융합학회 Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement

More information

한수지 49(5), , 2016 Original Article Korean J Fish Aquat Sci 49(5), ,2016 곰소만해역해수에서분리한장염비브리오 (Vibrio parahaemolyticus) 의항균제내성및최소발육억제농도의구명 김

한수지 49(5), , 2016 Original Article Korean J Fish Aquat Sci 49(5), ,2016 곰소만해역해수에서분리한장염비브리오 (Vibrio parahaemolyticus) 의항균제내성및최소발육억제농도의구명 김 한수지 49(5), 582-588, 206 Original Article Korean J Fish Aquat Sci 49(5),582-588,206 곰소만해역해수에서분리한장염비브리오 (Vibrio parahaemolyticus) 의항균제내성및최소발육억제농도의구명 김태옥 엄인선 김희대 박권삼 * 군산대학교식품생명공학과, 충북도립대학바이오생명의약과 Antimicrobial

More information

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF. 1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis

More information

22(3)-07.fm

22(3)-07.fm J. Fd Hyg. Safety Vol. 22, No. 3, pp. 179~191 (2007),QWTPCN QH (QQF *[IKGPG CPF 5CHGV[ Available online at http://www.foodhygiene.or.kr Î ÜôÚ ò Ù Â 1 Â 2 Âú äâ Ö 3 Â Ùý* w w w, 1 w tœw, 2 w yw, 3 w yl

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

<4D F736F F F696E74202D20B3D2C4A1BFACBCE2B1B8B1D5C1F528BEC6C4EDBEC6C0CEC6F7292E >

<4D F736F F F696E74202D20B3D2C4A1BFACBCE2B1B8B1D5C1F528BEC6C4EDBEC6C0CEC6F7292E > 넙치연쇄구균증의발생현황및대책 1. 서론 병리연구과권문경 우리나라의넙치양식은 1970년대후반부터종묘생산이시작되어 1986년도에제주도에서종묘생산기술개발을계기로육상양식이시작되었다. 1997년도에는 5,500톤을생산하였으며 ( 허등, 2001), 이후급속도로발전하여 2008년에는 46,432톤을생산함으로서 11년만에약10 배의생산량증가를이루었다. 양식산업이발전함에따라시설규모도소규모에서대규모로전환되고사육방법또한고밀도로사육하는경우가많아사육관리부주의등으로각종질병이발생되고있으며,

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4) THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method

More information

untitled

untitled 理 葉 CNFH-88-04 行 87 年 9 1 88 年 6 30 類 葉 Staphylococcus aureus Staphylococcus epidermidis Streptococcus mutans Streptococcus sanguis Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa Candida

More information

가자미식해의제조공정최적화 37., (Choi et al., 200).. 재료 재료및방법 (Verasper Jordan et Gilbert;, ), (, ), (, ) (, )., (, ), (, ), (, ), (, ), (, ), (, ). 가자미식해제조 (round

가자미식해의제조공정최적화 37., (Choi et al., 200).. 재료 재료및방법 (Verasper Jordan et Gilbert;, ), (, ), (, ) (, )., (, ), (, ), (, ), (, ), (, ), (, ). 가자미식해제조 (round 한수지 48(), 036-043, 205 Original Article Kor J Fish Aquat Sci 48(),036-043,205 반응표면분석법을이용한가자미 (Verasper moseri Jordan et Gilbert) 식해제조최적화 한대원 김덕기 한호준 조순영 2 * 강릉원주대학교식품과학과, 강릉원주대학교동해안해양생물자원연구센터, 2 강릉원주대학교식품가공유통학과

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

한수지 51(1), 23-30, 2018 Original Article Korean J Fish Aquat Sci 51(1),23-30,2018 넙치 (Paralichthys olivaceus) 근육채취방법에따른 Kudoa septempunctata 진단효율비교 송준영

한수지 51(1), 23-30, 2018 Original Article Korean J Fish Aquat Sci 51(1),23-30,2018 넙치 (Paralichthys olivaceus) 근육채취방법에따른 Kudoa septempunctata 진단효율비교 송준영 한수지 51(1), 23-30, 2018 Original Article Korean J Fish Aquat Sci 51(1),23-30,2018 넙치 (Paralichthys olivaceus) 근육채취방법에따른 Kudoa septempunctata 진단효율비교 송준영 정승희 1 최혜승 2 * 국립수산과학원남동해수산연구소, 1 국립수산과학원병리연구과, 2 국립수산과학원남해수산연구소

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic

More information

<313430333033C6AFC1FD28C3E0B1B8292E687770>

<313430333033C6AFC1FD28C3E0B1B8292E687770> 스포츠와 물리학: 구기운동 안티-싸커 와 간접-축구 DOI: 10.3938/PhiT.23.005 이 인 호 Anti-soccer and Indirect Soccer 편성은 없다고 장담한다. 벨기에(FIFA 랭킹 11위), 러시아 (FIFA 랭킹 22위), 알제리(FIFA 랭킹 26위), 그리고 한국(FIFA 랭킹 61위)으로 이어지는 H조 편성 결과이다. 이

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>

<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770> J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,

More information

04_08_HM _rev3_ hwp

04_08_HM _rev3_ hwp Korean Journal of Microbiology (213) Vol. 49, No. 2, pp. 126-13 DOI http://dx.doi.org/1.7845/kjm.213.325 Copyright c 213, The Microbiological Society of Korea 보문 원유시료에서분리한장알균속세균의다중약물유출펌프 (Multidrug Efflux

More information

한수지 47(5), , 2014 Original Article Kor J Fish Aquat Sci 47(5), ,2014 한국연안산패류중 Vibrio parahaemolyticus 의분포및항생제내성특성비교 유홍식 * 오은경 1 신순범 2 박용수

한수지 47(5), , 2014 Original Article Kor J Fish Aquat Sci 47(5), ,2014 한국연안산패류중 Vibrio parahaemolyticus 의분포및항생제내성특성비교 유홍식 * 오은경 1 신순범 2 박용수 한수지 47(5), 5-515, 214 Original Article Kor J Fish Aquat Sci 47(5),5-515,214 한국연안산패류중 Vibrio parahaemolyticus 의분포및항생제내성특성비교 유홍식 * 오은경 1 신순범 2 박용수 이희정 3 김지회 송기철 1 국립수산과학원식품안전과, 1 국립수산과학원서해수산연구소, 2 국립수산과학원남서해수산연구소,

More information

( ).fm

( ).fm Korean J. Food Sci. An. Vol. 33, No. 1, pp. 133~138(2013) DOI http://dx.doi.org/10.5851/kosfa.2013.33.1.133 ARTICLE 시판축산물및수산물에서 Enterococcus faecalis 와 Enterococcus faecium 분포및항생제감수성에관한연구 성창현 천정환 곽효선 1

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

VHS 및 RSIVD 모니터링 177 al., 2001) (World Organization for Animal Health, OIE). VHSV Rhabdoviridae Novirhabdovirus RNA 6 gene nucleocapsid protein (N), p

VHS 및 RSIVD 모니터링 177 al., 2001) (World Organization for Animal Health, OIE). VHSV Rhabdoviridae Novirhabdovirus RNA 6 gene nucleocapsid protein (N), p 한수지 49(2), 176-183, 2016 Original Article Korean J Fish Aquat Sci 49(2),176-183,2016 2015 년제주도양식넙치 (Paralichthys olivaceus) 를대상으로한 VHS 및 RSIVD 모니터링 박현경 전려진 1 김승민 박명애 2 조미영 2 황성돈 2 박신후 2 정현도 3 정준범 * 제주대학교해양의생명과학부,

More information

Æ÷Àå½Ã¼³94š

Æ÷Àå½Ã¼³94š Cho, Mun Jin (E-mail: mjcho@ex.co.kr) ABSTRACT PURPOSES : The performance of tack coat, commonly used for layer interface bonding, is affected by application rate and curing time. In this study, bonding

More information

<28B0A1C7F6BCF6C1A429203136C0FD2DC3E0BCF6BBEAB9B020C0AFC7D8B9B0C1FA20BAD0BCAEB9FD20C6EDB6F72830313136292E687770>

<28B0A1C7F6BCF6C1A429203136C0FD2DC3E0BCF6BBEAB9B020C0AFC7D8B9B0C1FA20BAD0BCAEB9FD20C6EDB6F72830313136292E687770> 발 간 사 최근 축 수산물의 소비가 급속히 늘어남에 따라 축산업 및 수산업도 점차 기업화, 대규모화 되고 있습니다. 이에 따라 질병 예방을 위해 사 용되는 동물용의약품과 환경으로부터 기인된 유해물질이 축 수산식품 에 잔류될 가능성이 더욱 높아가고 있습니다. 국제교역도 가속화되고 있 어 수입 축 수산식품의 안전성 관리도 더욱 강화되어야 할 시점입니다. 또한 한국인의

More information

04_이근원_21~27.hwp

04_이근원_21~27.hwp 1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일

More information

목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적

목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적 用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure

More information

Analysis of teacher s perception and organization on physical education elective courses Chang-Wan Yu* Korea Institute of curriculum and evaluation [Purpose] [Methods] [Results] [Conclusions] Key words:

More information

개최요강

개최요강 55 2009. 5. ( ) ( ) < > 1. 1 2. 2. 2. 3 1) 3 2) 3 3) GC-MS 4. 5 1) 5 2) 5 3) ICP-OES 6 3. 7. 7 1) 7 2) 10. 13 1) 1g 13 2),,, 14 3), 15 4),, 15 4. 17 19 < > [ 1] 2 [ 2] ICP-OES 6 [ 3] 13 [ 4] 1g 13 [ 5]

More information

목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i

목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i 11-1480523-000748-01 배경지역 ( 백령도 ) 에서의 대기오염물질특성연구 (Ⅲ) 기후대기연구부대기환경연구과,,,,,,, Ⅲ 2010 목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i 목차 Ⅳ ii 목차 iii 목차 iv 목차 μg m3 μg m3 v 목차 vi Ⅰ. 서론 Ⅰ μm μg m3 1 Ⅰ. 서론 μg m3 μg m3 μg m3 μm 2

More information

한수지 47(5), , 2014 Original Article Kor J Fish Aquat Sci 47(5), ,2014 서해안천수만일대양식조피볼락 (Sebastes schlegeli) 의상피선충감염현황 서한길 서정수 류민경 이은혜 권세련 1

한수지 47(5), , 2014 Original Article Kor J Fish Aquat Sci 47(5), ,2014 서해안천수만일대양식조피볼락 (Sebastes schlegeli) 의상피선충감염현황 서한길 서정수 류민경 이은혜 권세련 1 한수지 47(5), 603-610, 2014 Original Article Kor J Fish Aquat Sci 47(5),603-610,2014 서해안천수만일대양식조피볼락 (Sebastes schlegeli) 의상피선충감염현황 서한길 서정수 류민경 이은혜 권세련 1 강종순 2 노윤산 2 최혜승 정승희 한현자 * 국립수산과학원병리연구과, 1 선문대학교수산생명의학과,

More information

表紙(化学)

表紙(化学) 수험 번호 성 명 2013년 일본 공과대학 학부 유학생 파견 선발 시험 화 학 (90분 100점) 주 의 1 시험시작의 지시가 있을 때까지 열지 마시오. 2 해답은 해답용지의 지정된 난 안에 알아보기 쉽게 기입하시오. 3 해답에 한글이 포함되면 채점되지 않습니다. 필요한 경우, 아래의 값을 사용하시오. 원자량 H 1.0, C 12, N 14, O 16, Cu

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although

More information

노인정신의학회보14-1호

노인정신의학회보14-1호 제14권 1호 통권 제23호 www.kagp.or.kr 발행인 : 정인과 / 편집인 : 이동우 / 발행처 : 정인과 (152-703) 서울특별시 구로구 구로동 80번지 고려대학교 구로병원 정신과 / TEL : 02-818-6608 / FAX : 02-852-1937 발행일 : 2008년 4월 30일 / 제 작 : (주)엠엘커뮤니케이션 140-846 서울특별시

More information

09권오설_ok.hwp

09권오설_ok.hwp (JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction

More information

674 권순재ㆍ정연중ㆍ윤현진ㆍ목종수ㆍ권지영,.., (Watts et al., 2017)., 70% (Kummerer, 2009). (Witte, 2000)., (Souli et al., 2008)., % ,113 (NIFS, 2017

674 권순재ㆍ정연중ㆍ윤현진ㆍ목종수ㆍ권지영,.., (Watts et al., 2017)., 70% (Kummerer, 2009). (Witte, 2000)., (Souli et al., 2008)., % ,113 (NIFS, 2017 한수지 51(6), 673-681, 2018 Original Article Korean J Fish Aquat Sci 51(6),673-681,2018 용남광도해역의굴 (Crassostrea gigas) 및육상오염원에서분리한대장균 (Escherichia coli) 의항생제내성 권순재 정연중 윤현진 목종수 1 권지영 * 국립수산과학원남동해수산연구소, 1 국립수산과학원식품위생가공과

More information

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 901 무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 (A Effective Sinkhole Attack Detection Mechanism for LQI based Routing in WSN) 최병구 조응준 (Byung

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

13장문현(541~556)ok

13장문현(541~556)ok A Study on the Spatial Distribution of Local Foods and Regional Products in the Seomjin River Area* Jeong-ok Kim**Mal-shick Shin***Jeong-rock Lee****Mun-hyun Jang*****,,,,,,,,,. 36, 15, 14, 5, 19. 32,

More information

한수지 52(2), , 2019 Note Korean J Fish Aquat Sci 52(2), ,2019 국내유통김 (Porphyra sp.) 의미생물오염도평가 노보영 황선혜 1 조용선 1 * 한국식품연구원식품표준센터, 1 한국식품연구원식품분석

한수지 52(2), , 2019 Note Korean J Fish Aquat Sci 52(2), ,2019 국내유통김 (Porphyra sp.) 의미생물오염도평가 노보영 황선혜 1 조용선 1 * 한국식품연구원식품표준센터, 1 한국식품연구원식품분석 한수지 52(2), 80-84, 209 Note Korean J Fish Aquat Sci 52(2),80-84,209 국내유통김 (Porphyra sp.) 의미생물오염도평가 노보영 황선혜 조용선 * 한국식품연구원식품표준센터, 한국식품연구원식품분석센터 Microbial Contamination Levels in Porphyra sp. Distributed in

More information

한수지 47(6), , 2014 Original Article Kor J Fish Aquat Sci 47(6), ,2014 배합사료및습사료공급에따른넙치 (Paralichthys olivaceus) 의성장및어체성분비교 김강웅 이진혁 배기민 김경덕

한수지 47(6), , 2014 Original Article Kor J Fish Aquat Sci 47(6), ,2014 배합사료및습사료공급에따른넙치 (Paralichthys olivaceus) 의성장및어체성분비교 김강웅 이진혁 배기민 김경덕 한수지 47(6), 810-817, 2014 Original Article Kor J Fish Aquat Sci 47(6),810-817,2014 배합사료및습사료공급에따른넙치 (Paralichthys olivaceus) 의성장및어체성분비교 김강웅 이진혁 배기민 김경덕 이봉주 한현섭 김성삼 * 국립수산과학원사료연구센터 Comparison of Extruded

More information

10(3)-09.fm

10(3)-09.fm w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

433대지05박창용

433대지05박창용 Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This

More information

- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol

More information

?

? http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ

More information

02À±¼ø¿Á

02À±¼ø¿Á Geomorphic Development of Marine Terraces at Jeongdongjin-Daejin area on the East Coast, Central Part of Korean Peninsula Soon-Ock Yoon*, Sang-Ill Hwang** and Hak-Kyun Ban*** Abstract : In this paper we

More information

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770> 대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실

More information

..........5-45..

..........5-45.. K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals

More information

특허청구의 범위 청구항 1 구제역이나 에이아이(AI) 감염에 의해 살 처분된 가축 매몰지의 붕괴나 침출수 유출에 의한 제2차 오염을 방 지하기 위한 방제방법에 있어서, 매몰지 내부에 고화제(Firming agent) 및 첨가물질이 주입되도록 통로를 형성하기 위한 천공단

특허청구의 범위 청구항 1 구제역이나 에이아이(AI) 감염에 의해 살 처분된 가축 매몰지의 붕괴나 침출수 유출에 의한 제2차 오염을 방 지하기 위한 방제방법에 있어서, 매몰지 내부에 고화제(Firming agent) 및 첨가물질이 주입되도록 통로를 형성하기 위한 천공단 (19) 대한민국특허청(KR) (12) 공개특허공보(A) (51) 국제특허분류(Int. Cl.) B09B 1/00 (2006.01) C09K 17/00 (2006.01) E02D 31/00 (2006.01) (21) 출원번호 10-2011-0016170 (22) 출원일자 2011년02월23일 심사청구일자 전체 청구항 수 : 총 9 항 2011년02월23일 (11)

More information

Kor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의

Kor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의 RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on

More information

자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr

자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr Original Article pissn 1738-2637 J Korean Soc Radiol 2012;67(2):129-134 The Survey of Magnetic Resonance Imaging Quality according to in Korea 1 자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 1 Hyun-Hae

More information

05.fm

05.fm pissn 1229-1153 J. Fd Hyg. Safety Vol. 29, No. 1, pp. 26~30 (2014) http://dx.doi.org/10.13103/jfhs.2014.29.1.026 Journal of Food Hygiene and Safety Available online at http://www.foodhygiene.or.kr 식품에서분리된리스테리아모노사이토젠스의분포및항생제내성

More information

Y 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are

More information

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A528B1E8C1BEB9E8292E687770>

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A528B1E8C1BEB9E8292E687770> Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 18, No. 11 : 2593~2599 Nov. 2014 오픈소스 모바일 UI컴포넌트 선정 절차 프레임워크 손효정 1 이민규 2 성백민

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jun.; 27(6),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jun.; 27(6), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Jun.; 27(6), 495 503. http://dx.doi.org/10.5515/kjkiees.2016.27.6.495 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Design

More information

fm

fm pissn 1229-1153 J. Fd Hyg. Safety Vol. 29, No. 3, pp. 228~233 (2014) http://dx.doi.org/10.13103/jfhs.2014.29.3.228 Journal of Food Hygiene and Safety Available online at http://www.foodhygiene.or.kr 축산물과수산물에서분리된장구균의항생제감수성및유전형분석

More information

04김호걸(39~50)ok

04김호걸(39~50)ok Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*

More information

The characteristic analysis of winners and losers in curling: Focused on shot type, shot accuracy, blank end and average score SungGeon Park 1 & Soowo

The characteristic analysis of winners and losers in curling: Focused on shot type, shot accuracy, blank end and average score SungGeon Park 1 & Soowo The characteristic analysis of winners and losers in curling: Focused on shot type, shot accuracy, blank end and average score SungGeon Park 1 & Soowon Lee 2 * 1 Program of Software Convergence, Soongsil

More information

한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26

한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26 2015 한국전지학회 춘계학술대회 2일차 한국전지학회 춘계 학술대회(신소재 및 시장동향 관련 주제 발표) 시간 제목 비고 세션 1 차세대 이차전지용 in-situ 분석기술 좌장 : 윤성훈 09:00~09:30 Real-time & Quantitative Analysis of Li-air Battery Materials by In-situ DEMS 김동욱(한국화학연구원)

More information

<C7D1B1B9B1B3C0B0B0B3B9DFBFF85FC7D1B1B9B1B3C0B05F3430B1C733C8A35FC5EBC7D5BABB28C3D6C1BE292DC7A5C1F6C6F7C7D42E687770>

<C7D1B1B9B1B3C0B0B0B3B9DFBFF85FC7D1B1B9B1B3C0B05F3430B1C733C8A35FC5EBC7D5BABB28C3D6C1BE292DC7A5C1F6C6F7C7D42E687770> 기혼 여성이 사이버대학에서 상담을 전공하면서 겪는 경험 방기연 (고려사이버대학교 상담심리학과 부교수) * 요 약 본 연구는 기혼 여성의 사이버대학 상담전공 학과 입학에서 졸업까지의 경험을 이해하는 것을 목적으로 한 다. 이를 위해 연구참여자 10명을 대상으로 심층면접을 하고, 합의적 질적 분석 방법으로 분석하였다. 입학 전 에 연구참여자들은 고등교육의 기회를

More information

ORIGINAL ARTICLE Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist

ORIGINAL ARTICLE   Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist ORIGINAL ARTICLE http://dx.doi.org/10.15263/jlmqa.2015.37.4.209 Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resistance: MicroScan versus Etest Goeun Kang, Hyun Soo Kim,

More information

1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   3 * The Effect of H Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales

More information

Statistical Data of Dementia.

Statistical Data of Dementia. Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.

More information

해수사육무지개송어에서분리한 Vibrio anguillarum 특성연구 255, , ,,, (Lee, 2013)., (infectious hematopoietic necrosis virus; IHNV) (infectious pancreatic

해수사육무지개송어에서분리한 Vibrio anguillarum 특성연구 255, , ,,, (Lee, 2013)., (infectious hematopoietic necrosis virus; IHNV) (infectious pancreatic 한수지 51(3), 254-261, 2018 Original Article Korean J Fish Aquat Sci 51(3),254-261,2018 해수사육무지개송어 (Oncorhynchus mykiss) 에서분리된 Vibrio anguillarum 의특성분석 천혜진 김위식 1 조미영 정승희 한현자 * 국립수산과학원병리연구과, 1 전남대학교수산생명의학과

More information

untitled

untitled ORIGINAL ARTICLE Korean J Clin Lab Sci. Vol. 45, No. 1, Mar. 2013 21 Korean J Clin Lab Sci. 2013, 45(1):21-25 ISSN 1738-3544 Errors of Antibiotic Susceptibility Testing from Automated and Manual Systems

More information

디지털포렌식학회 논문양식

디지털포렌식학회 논문양식 ISSN : 1976-5304 http://www.kdfs.or.kr Virtual Online Game(VOG) 환경에서의 디지털 증거수집 방법 연구 이 흥 복, 정 관 모, 김 선 영 * 대전지방경찰청 Evidence Collection Process According to the Way VOG Configuration Heung-Bok Lee, Kwan-Mo

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   * A Research Trend Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities

More information

서론 34 2

서론 34 2 34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of

More information

732 서한길ㆍ서정수ㆍ류민경ㆍ이은혜ㆍ정승희ㆍ한현자 (Moravec and Harrison, 1989; Moravec and Wang, 2002; Wijová et al., 2006).,,,., Philometridae., (Edward, 1996). Seo et al.

732 서한길ㆍ서정수ㆍ류민경ㆍ이은혜ㆍ정승희ㆍ한현자 (Moravec and Harrison, 1989; Moravec and Wang, 2002; Wijová et al., 2006).,,,., Philometridae., (Edward, 1996). Seo et al. 한수지 48(5), 731-738, 2015 Original Article Korean J Fish Aquat Sci 48(5),731-738,2015 조피볼락 (Sebastes schlegeli) 선충 (Nematode: Philometridae) 에대한분자생물학적동정및 PCR 검출법개발 서한길 서정수 류민경 이은혜 정승희 한현자 * 국립수산과학원병리연구과

More information

국립중앙도서관 출판시도서목록(CIP) 강원도 시군별 투입산출표 작성 연구 / 김진기, 박봉원 [ 공저]. -- 춘천 : 강원발전연구원 (Research Institute for Gangwon) 2 014 p. ; cm. -- ( 연구보고 ; 14-25) 참고문헌 수록

국립중앙도서관 출판시도서목록(CIP) 강원도 시군별 투입산출표 작성 연구 / 김진기, 박봉원 [ 공저]. -- 춘천 : 강원발전연구원 (Research Institute for Gangwon) 2 014 p. ; cm. -- ( 연구보고 ; 14-25) 참고문헌 수록 A Study on Creation of Input Calculation Table for Cities and Counties of Gangwon Province 국립중앙도서관 출판시도서목록(CIP) 강원도 시군별 투입산출표 작성 연구 / 김진기, 박봉원 [ 공저]. -- 춘천 : 강원발전연구원 (Research Institute for Gangwon) 2

More information

석사논문.PDF

석사논문.PDF ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh

More information

14.531~539(08-037).fm

14.531~539(08-037).fm G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked

More information

untitled

untitled Original Article Experiences of Unwed Mothers Choi, Yang-Ja 1) Kim, Kwuy-Bun 2) 1) Professor, Redcross College of Nursing, 2) Professor, Kyung Hee University, College of Nursing Science 1) 2) 1) 2) Purpose:

More information

101~110 ¿õ´ã.¿ìȲ

101~110 ¿õ´ã.¿ìȲ 101 DOI : 10.3831/KPI.2010.13.2.101 Received : 10. 05. 06 Accepted : 10. 05. 27 The Experimental Study on the Effect of Fel Ursi & Bovis Calculus Pharmacopuncture Solution in Bacterial Species which cause

More information

09-감마선(dh)

09-감마선(dh) Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected

More information

(5차 편집).hwp

(5차 편집).hwp (215), 54(1), 17-3 211 STEAM,.. STEAM, STEAM, 5~6 11.,., 5~6...,. (, 21)., 29. (,, 212). 211 STEAM * :, E-mail: njkwon@hanmail.net http://dx.doi.org/1.15812/ter.54.1.2153.17 (215), 54(1), 17-3,. (Arts)

More information

???춍??숏

???춍??숏 Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY

More information

untitled

untitled 대한내과학회지 : 제 72 권제 1 호 27 Streptococcus pneumoniae와 Haemophilus influenzae 임상분리주에대한 Cefditoren의시험관내항균력 인제대학교의과대학일산백병원감염내과, 울산대학교의과대학서울아산병원감염내과 2, 울산대학교항균제내성ㆍ미생물유전학연구센터 3 곽이경 추은주 2, 3 박수진 3 이정은 3 정진용 2,

More information

<C7A5C1F620BEE7BDC4>

<C7A5C1F620BEE7BDC4> 연세대학교 상경대학 경제연구소 Economic Research Institute Yonsei Universit 서울시 서대문구 연세로 50 50 Yonsei-ro, Seodaemun-gS gu, Seoul, Korea TEL: (+82-2) 2123-4065 FAX: (+82- -2) 364-9149 E-mail: yeri4065@yonsei.ac. kr http://yeri.yonsei.ac.kr/new

More information

<313630313032C6AFC1FD28B1C7C7F5C1DF292E687770>

<313630313032C6AFC1FD28B1C7C7F5C1DF292E687770> 양성자가속기연구센터 양성자가속기 개발 및 운영현황 DOI: 10.3938/PhiT.25.001 권혁중 김한성 Development and Operational Status of the Proton Linear Accelerator at the KOMAC Hyeok-Jung KWON and Han-Sung KIM A 100-MeV proton linear accelerator

More information