DBPIA-NURIMEDIA

Size: px

Start display at page:

Download "DBPIA-NURIMEDIA"

운도 여
5 years ago
Views:

1 Korean Society for Biotechnology and Bioengineering Journal 29(4): (2014) ISSN / eissn 연구논문 재조합대장균에서 MaoC 를이용한지방산으로부터의중간사슬길이폴리하이드록시알칸산생산연구 박시재 1, 이승환 2, 오영훈 2, 이상엽 3 * MaoC Mediated Biosynthesis of Medium-chain-length Polyhydroxyalkanoates in Recombinant Escherichia coli from Fatty Acid Si Jae Park 1, Seung Hwan Lee 2, Young Hoon Oh 2, and Sang Yup Lee 3 * 접수 : 2014 년 7 월 3 일 / 게재승인 : 2014 년 7 월 22 일 2014 The Korean Society for Biotechnology and Bioengineering Abstract: Biosynthesis pathway of medium-chain-length (MCL) polyhydroxyalkanoates (PHA) from fatty acid β-oxidation pathway was constructed in recombinant Escherichia coli by introducing the Pseudomonas sp PHA synthase gene (phac2) and the maoc genes from Pseudomonas putida, Sinorhizobium meliloti, and Ralstonia eutropha. The metabolic link between fatty acid β-oxidation pathway and PHA biosynthesis pathway was constructed by MaoC, which is homologous to P. aeruginosa (R)-specific enoyl-coa hydratase (PhaJ1). When the E. coli W3110 strains expressing the phac2 gene and one of the maoc genes from P. putida, Sinorhizobium meliloti, and Ralstonia eutropha were cultured in LB medium containing 2 g/l of sodium decanoate as a carbon source, MCL-PHA that mainly consists of 3-hydroxyhexanoate (3HHx), 3-hydroxyoctanoate (3HO) and 3-hydroxydecanoate (3HD), was produced. The monomer composition of PHA and PHA contents varied depending on MaoC employed for the production of PHA. The highest PHA content of 18.7 wt% was achieved in recombinant E. coli W3110 expressing the phac2 gene and the P. putida maoc gene. These results suggest that MCL-PHA biosynthesis pathway can be constructed in recombinant E. coli strains from the b-oxidation pathway by employing MaoC able to supply (R)-3-hydroxyacyl- CoA, the substrate of PHA synthase. Keywords: Escherichia coli, MaoC, β-oxidation, Polyhydroxyalkanoates, Fatty acid 1 명지대학교환경에너지공학과 1 Department of Environmental Engineering and Energy, Myongji University, Yongin , Korea 2 한국화학연구원바이오화학연구센터 2 Industrial Biochemicals Research Group, Research Center for Biobased Chemistry, Division of Convergence Chemistry, Korea Research Institute of Chemical Technology, Daejeon , Korea 3 한국과학기술원생명화학공학과 3 Metabolic and Biomolecular Engineering National Research Laboratory, Department of Chemical and Biomolecular Engineering (BK21 Plus Program), Center for Systems and Synthetic Biotechnology, and Institute for the BioCentury, KAIST, Daejeon , Korea Tel: , Fax: leesy@kaist.ac.kr 1. INTRODUCTION 폴리하이드록시알칸산 (polyhydroxyalkanoates, PHAs) 은미생물이탄소원이풍부하고 N, P, S, O 등의생장에필요한요소들이부족할때에너지및환원력보존을위하여세포내에축적하는생분해성고분자물질이다. PHA 는생분해성과생적합성을지닌바이오폴리머이고, 모노머의종류에따라서다양한물성을나타내기때문에기존의석유화학유래의합성고분자를대체하기위한바이오폴리머로서많은관심을받고있다 [1,2]. PHA 의합성에가장중요하고핵심적인효소는 PHA synthase 이다. PHA synthase 는미생물의대사회로를

2 재조합대장균에서 MaoC 를이용한지방산으로부터의중간사슬길이폴리하이드록시알칸산생산연구 245 통해생성된다양한 hydroxyacyl-coa (HA-CoA) 를기질로사용하여 PHA를합성한다. 만약에 HA-CoA이광학활성을지닌다면모두 (R)-form이기때문에 PHA의모노머는 R-form 의광학이성질체이다 [3]. PHA synthase는 3, 4, 5, 6- hydroxyacyl-coa를기질로사용할수있으나, 이중에가장효율적으로이용하는기질은 (R)-3-hydroxyacyl-CoA (R3HA-CoA) 이다 [1-3]. 탄소수가 4~12개인 R3HA-CoA들이미생물의다양한대사회로의대사중간산물을이용하여만들어질수있다. 이중, 탄소수가 4개인 (R)-3-hydrobutyryl-CoA (R3HB-CoA) 는주로 acetyl-coa로부터두효소, β-ketothiloase (PhaA) 와 NADPH dependent acetoacetyl-coa reductase (PhaB) 에의해서합성되며, 탄소수가 6개이상인 R3HA-CoA는지방산대사회로의대표적인대사중간산물들인 enoyl-coa, 3-ketoacyl-CoA, (S)-3-hydroxyacyl-CoA, (R)-3-hydroxyacyl-acyl carrier protein (ACP) 등으로부터합성될수있다 [1,2]. 현재까지이러한대사중간산물을 R3HA-CoA로전환할수있는다양한효소들이발견되어져왔으며, 대표적인효소로 (R)-specific enoyl-coa hydratase, 3-ketoacyl-ACP reductase, epimerase, 3-hydroyacyl-ACP:CoA transferase 등이알려져있다 [4-15]. 이러한효소들의대사회로상의정확한기능의규명을통해 PHA 합성에관여된대사회로에대해더욱명확하게이해할수있으며, 효율적으로 PHA를합성하는재조합미생물의제작이가능하게되었다. 지방산을이용하여 PHA를합성하는미생물이효율적으로이용하는대사중간산물은 enoyl-coa로서, enoyl-coa 를 3HA- CoA로전환하는효소인 (R)-specific enoyl-coa hydratase가다양한미생물, 특히 Pseudomomas 균주에서많이스크리닝되어져왔다. 특히, Pseudomonas aeruginosa PAO1균주는적어도네개이상의 (R)-specific enoyl-coa hydratase를코딩하는유전자 (phaj1, phaj2, phaj3 and phaj4 gene) 를지니고있는것으로알려져있으며, 각각의 PhaJ는다른기질특이성을보유하고있는것으로알려져있다 [10,14,15]. 이에반해 P. putida와 P. oleovorans 균주는비교적적은숫자의 phaj 유전 자를보유하고있는것으로알려져있으며, 최근에 PhaJ 에대한연구가활발히진행되고있다 [14,15]. 최근에우리그룹은 P. aeruginosa PhaJ1 이 MaoC like domain 을지니고있는정보를기반으로하여대장균의 MaoC 단백질이 enoyl-coa 를 R3HA-CoA 로전환하는역할을하는것을밝힌바있다 [13]. 또한대장균 MaoC 단백질을이용하여재조합대장균에서지방산대사회로를이용한 mediumchain-length (MCL)-PHA 를합성대사회로를제작할수있다는보고를한바있다 [13]. 최근에는 P. putida 에서도 MaoC domain 을보유한단백질 (P0580) 이 enoyl-coa hydratase 기능을한다는보고가있었다 [14,15]. 본연구에서는 P. putida, Ralstonia eutropha, Sinorhizobium meliloti 에존재하는 MaoC 단백질을 MaoC domain 를이용한 homology search 를이용하여스크리닝하였다. 스크리닝된 MaoC 단백질을이용하여, 지방산을탄소원으로사용해서 MCL-PHA 를합성하는재조합대장균을개발하였다. 2. MATERIALS AND METHOD 2.1. 균주및플라스미드본연구에사용된균주와플라스미드를 Table 1 에정리하였다. 플라스미드제작을위하여대장균 XL1-Blue 를호스트균주로이용하였다. 지방산으로부터 PHA 를생산하기위하여대장균 W3110 (KCTC 2223) 을호스트균주로사용하였다. MaoC 유전자는 P. putida KT2440, S. meliloti 1021, R. eutropha NCIMN11599 균주의크로모좀으로부터 Table 2 에정리된프라이머를이용하여 PCR 을통해증폭하였다. 프라이머는 P. putida KT2440, S. meliloti 1021, R. eutropha NCIMB 의유전체정보를기반으로제작하였다. PCR 은 PCR Thermal Cycler MP (Takara Shuzo Co., LTD., Shiga, Japan) 을이용하여 Expand High Fidelity PCR System (Roche Molecular Biochemicals, Mannheim, Germany) 으로수행하였다. 플 Table 1. Bacterial strains and plasmids used in this study Strains or Plasmids Relevant Characteristics Reference or Source Strains E. coli XL1-Blue reca1, enda1, gyra96, thi, hsdr17, suppe44, rela1, l -, lac -, F [proab lacl q lacz M15, Tn10 (tet) r ] Stratagene a E. coli W3110 F - mcra mcrb IN(rrnD - rrne)1λ - KCTC b Pseudomonas putida wild type Lab stock Sinorhizobium meliloti wile type KCTC b Ralstonia eutropha wild type KCTC b Plasmids p10499a ptrc99a derivative; Ap r ; gntt104 promoter 9, 13 pmcs104613c2 pbbr1mcs derivative; gntt104 promoter, Pseudomonas sp phac2 gene 13 p10499p0580 p10499a derivative; P. putida KT2442 maoc(p0580) gene This study p10499smmaoc p10499a derivative; S. meliloti maoc gene This study p10499remaoc p10499a derivative; R. eutropha maoc gene This study a Stratagene Cloning System, La Jolla, CA, USA b Korean Collection for Type Cultures, Daejeon, Republic of Korea

3 246 Korean Society for Biotechnology and Bioengineering Journal 29(4): (2014) Table 2. List of primers used in PCR expriments for the amplification of the maoc genes a Primer Primer sequence Template used Primer1 5- GGAATTCATGAGCCGACAATGGCACGAC Primer2 5- CCCAAGCTTTTACAGGCTCTCCCAACGGCC P. putida chromosomal DNA Primer3 5-GGAATTCATGAGCGAGCAGACGATCTAT Primer4 5-CCCAAGCTTTTATTGGATAGTTCCCTCAGGTTT S. meliloti chromosomal DNA Primer5 5- GGAATTCATGAACGCCTATCAACTTTGTC Primer6 5- CCCAAGCTTTCAGTCCCCGCTGCTGCC R. eutropha chromosomal DNA a Restriction enzyme sites are shown in bold. 라스미드 pmcs104613c2 는 gntt104 promoter 를이용하여 Pseudomonas sp phac2 gene 를발현하는벡터이다 [13]. P. putida KT2440, S. meliloti 1021, R. eutropha NCIMN11599 의 maoc 유전자를발현하는벡터는 PCR 을통해획득한 maoc 유전자를 p10499a 벡터 [9] 의 EcoRI 과 HindIII 제한효소사이트에클로닝하여제작하였다 배양조건대장균 XL1-Blue 는 Luria-Bertani (LB) medium ( 리터당 : 10 g tryptone, 5 g yeast extract, 5 g NaCl 함유 ) 에서 37 o C 로배양하였다. PHA 의생산을위하여, maoc 유전자와 phac2 유전자를발현하는재조합대장균 W3110 을 100 ml 의 LB medium 을함유하고있는 250 ml 플라스크에서 96 시간동안배양하였다. 2 g/l 의 sodium decanoate (Sigma Co., St. Louis, MO, USA) 를기질로 LB medium 에첨가하였다. 플라스크배양은진탕배양기에서 250 rpm 과 30 o C 에서수행하였다. 결과는세번반복하여평균값을구하였다. Ampicillin (Ap, 50 mg l -1 ) 과 chloramphenicol (Cm, 34 mg l -1 ) 을균주의플라스미드안정성을위하여배지에첨가하였다 분석조건 PHA의농도와 PHA 모노머의조성을 fused silica capillary column (Supelco SPB TM -5, 30 m 0.32 mm ID 0.25 mm film, Bellefonte, PA, USA) 이장착된 gas chromatography (6890N GC System, Agilent Technologies, Palo Alto, CA, USA) 로 benzoic acid methyl ester를 internal standard로사용하여분석하였다 [16]. PHA의농도와 PHA 모노머조성을측정하기위하여다음과같이 3-hydroxyacid methyl ester를만들었다. PHA 를합성한재조합대장균을원심분리하여수득한후 95 o C에서 24시간건조하여수분을모두제거하였다. 건조된재조합대장균 30~100 mg (PHA content에따라양을달리하였음 ) 을 chloroform 2 ml과 PHA solution 1 ml을넣은바이알에서 95 o C oven에서 overnight하여반응하였다. PHA solution은 970 ml의메탄올에 30 ml의 H 2 SO 4 과 8g의 benzoic acid를넣어서제조하였다. Methanolysis 반응후상온에서식으면증류수 1mL을첨가하여약 1분간 vortexing하여섞어준후분리된두개의층중아래의 chloroform 층을 GC로분석하였다. 건조균체중량 (dry cell weight per liter of culture broth) 은기존에보고된방법으로측정하였다 [17]. PHA content (wt%) 는건조균체중량과 PHA 농도의비율로정의된다. 3. RESULTS AND DISCUSSION 3.1. Identification and cloning of the maoc genes from P. putida, S. meliloti, and R. eutropha P. putida, S. meliloti, R. eutropha 의 maoc 유전자는 E. coli maoc 유전자와 P. aeruginosa phaj1 유전자서열을기반으로 BLAST ( 의 protein homology search 를통해스크리닝하였다. E. coli maoc 유전자의발현을통해재조합대장균에서지방산으로부터 MCL- PHA 를합성할수있었기때문에 [13], 본연구에서는 P. putida, S. meliloti, R. eutropha 로부터스크리닝된 maoc 유전자의발현을통하여재조합대장균에서 MCL-PHA 의합성대사회로를구축하고자하였다. MaoC 유전자의발현은 p10499a 플라스미드에클로닝하여, 지속적으로발현할수있도록유도하였다. P. putida KT2440 에존재하는 MaoC (PP0580) 은 (R)-specific enoyl-coa hydratase 로알려져있으며, P. putida 에서발현및활성이확인되었으나 [14,15], 실제로대장균을비롯한재조합균주에서 PHA 합성에응용된적이없기때문에이번실험에서 PHA 합성에응용하였다. Fig. 1 에 MaoC 효소의 multiple alignment 결과를정리하였다. BLAST search 결과를통해 P. putida, S. meliloti, R. eutropha 의 MaoC 효소모두 E. coli MaoC 효소와마찬가지로 MaoC domain 이잘보존되어있는것을알수있었다. P. putida, S. meliloti, R. eutropha MaoC 효소모두의경우 E. coli MaoC 의경우와같이효소활성에중요한아미노산잔기인히스티딘 (H) 과아스파틱산 (D) 가잘보존되어있었다 [13]. PCR 를통해획득한각각의 MaoC 유전자를 p10499a 에클로닝하여재조합대장균제작에사용하였다. p10499a 는대장균 gntt104 프로모터를보유한발현벡터로서, 해당유전자를지속적으로발현할수있는벡터로많이사용되어왔다 [9,13]. Fig. 2 에현재까지 PHA 합성에사용된 β-oxidation pathway 의대사공학전략과본연구에서적용된 MaoC 를이용한대사공학전략을정리하였다. β-oxidation pathway 의주효소인 FadB 혹은 FadA 를제거할경우 β-oxidation pathway 의대사산물들이 PHA synthase 의기질인 R3HA-CoA 로전환되어 PHA synthase 의발현만으로도 PHA 가합성된다는보고가있어왔다 [4-6,12,13]. 하지만정상적인 β-oxidation pathway 를지닌재조합대장균에서는 enoyl-coa hydratase 혹은 3-ketoacyl-CoA reductase 등을플라스미드를통해과다발현해야만 β-oxidation pathway 의대사산물들이 R3HA-CoA 로전환되어 PHA 합성에이용될수

재조합대장균에서 MaoC 를이용한지방산으로부터의중간사슬길이폴리하이드록시알칸산생산연구 247 Fig. 1. Alignment of the deduced amino acid sequence of MaoC from E. coli, P. putida, S. meliloti, R. eutropha with that of P.

4 재조합대장균에서 MaoC 를이용한지방산으로부터의중간사슬길이폴리하이드록시알칸산생산연구 247 Fig. 1. Alignment of the deduced amino acid sequence of MaoC from E. coli, P. putida, S. meliloti, R. eutropha with that of P. aeruginosa (R)-specific enoyl-coa hydratase (PhaJ1). Conserved amino acids are shown in boxes. The catalytically important residues Asp and His are indicated by arrows. Fig. 2. Metabolic pathways for MCL-PHA biosynthesis in recombinant E. coli strain through fatty acid b-oxidation pathway. Enoyl-CoA hydratase, epimerase and 3-ketoacyl-CoA or ACP reductase have been employed to supply PHA precursors. Characters in parenthesis represent: A, enzymes that have not been elucidated in E. coli; B, amplified enzymes to supply PHA precursors in active b-oxidation pathway - FabG [7-9], RhlG [9], PhaJ [10,11] and MaoC [13-15, this study]; X, enzymes that have been inactivated to supply PHA precursors from fatty acid [4-6,12,13]. 있다 [7-11,13]. 따라서, 본실험에서 β-oxidation pathway 의 enoyl-coa 를 R3HA-CoA 로전환하기위해서는 MaoC 의플라스미드를통한발현이필수적이기때문에 p10499a 벡터에 MaoC 유전자를클로닝하여, β-oxidation pathway 를통해 PHA 를합성할수있는재조합대장균을제작하였다 Production of PHA in recombinant E. coli strains harboring the PHA synthase gene and the maoc gene MaoC 를이용한 PHA 합성대사회로구축을확인하기위하여, pmcs104613c2 와 MaoC 유전자를발현하는 p10499a 기반플라스미드를이용하여 E. coli W3110 을형질전환하여세종류의재조합대장균을제작하였다. 제작된재조합대장균을

5 248 Korean Society for Biotechnology and Bioengineering Journal 29(4): (2014) Table 3. Results of flask cultures of recombinant E. coli W3110 strains harboring pmcs104613c2 and a p10499a derivative containing different maoc genes a Condition DCW PHA conc. PHA content Monomer composition (mol%) (g/l) (g/l) (wt%) 3HB 3HHx 3HO 3HD pmcs104613c2 + p10499p ± ± ±0.03 2±2 8±2 39±2 51±2 pmcs104613c2 + p10499smmaoc 1.45± ± ± ±2 50±2 38±2 pmcs104613c2 + p10499remaoc 1.56± ± ± ±2 47±2 31±2 a Cells were cultivated for 96 h at 30 o C in LB medium supplemented with 2 g l -1 of sodium decanoate. Cultures were carried out in triplicates. Abbreviation: 3HB, (R)-3-hydroxybutyric acid; 3HHx, (R)-3-hydroxyhexanoic acid; 3HO, (R)-3-hydroxyoctanoic acid; 3HD, (R)-3- hydroxydecanoic acid 2g/L의 sodium decanoate 가함유된 LB medium에서 30 o C에서 96시간동안배양하였다 (Table 3). P. putida, S. meliloti, R. eutropha의 MaoC효소와 PHA synthase를발현하는재조합대장균들은모두 PHA를배지에첨가된 2g/L의 sodium decanoate으로부터합성하였으며, 합성된 PHA의모노머는 3-hydroxybutyrate (3HB), 3-hydroxyhexanoate (3HHx), 3-hydroxyoctanoate (3HO), 3-hydroxydecanoate (3HD) 이었다. PHA의모노머조성은 MaoC 종류에따라달랐으며, P. putida MaoC 가이용되었을때, 3HD 모노머의고분자내의분율이 50 mol% 에달했고, S. meliloti와 R. eutropha의 MaoC 효소를적용하였을때에는 3HO의몰분율이제일높았다 (Table 3). 이는같은조건에서 E. coli MaoC를이용했을때고분자내의몰분율이 3HO가 74 mol% 로제일높았고, 3HD의몰분율이 7mol% 였던예전결과와비교해도, 고분자생산에적용되는 MaoC의기질특이성에따라생성된고분자의몰분율이상이해질수있음을의미한다. 생성된고분자의 PHA content는 P. putida MaoC가적용되었을때 18.7 wt% 로제일높았고, R. eutropha MaoC가이용되었을때에는 3.2 wt% 로제일낮았다. 4. CONCLUSION 본연구진은 P. putida, S. meliloti, R. eutropha 의 MaoC 효소를클로닝하여 β-oxidation pathway 의 enoyl-coa 를 R3HA-CoA 로전환하는대사회로를제작하였고, 이를이용하여지방산으로부터 PHA 를합성하는재조합대장균시스템을개발하였다. 본연구진이개발한 MaoC 를이용한 PHA 생산시스템을활용한다면, 다양한모노머조성을지닌 MCL-PHA 를지방산으로부터효율적으로생산할수있어, 다양한물성을지닌 MCL-PHA 을합성할수있을것으로기대된다. ACKNOWLEDGEMENTS 본연구는한국연구재단을통한미래창조과학부기후변화대응바이오리파이너리를위한시스템대사공학원천기술개발사업 (NRF-2012-C1AAA M1A2A ) 과교육부일반연구자사업연구비 (NRF-2013R1A1A ) 의지원 으로이루어졌으며, 이에감사드립니다. REFERENCES 1. Lee, S. Y. (1996) Bacterial polyhydroxyalkanoates. Biotechnol. Bioeng. 49: Madison, L. L. and G. W. Huisman (1999) Metabolic engineering of poly(3-hydroxyalkanoates): from DNA to plastic. Microbiol. Mol. Biol. Rev. 63: Steinbüchel, A. and H. E. Valentin (1995) Diversity of bacterial polyhydroxyalkanoic acid. FEMS Microbiol. Lett. 128: Qi, Q., B. H. A. Rehm, and A. Steinbüchel (1997) Synthesis of poly(3-hydroxyalkanoates) in Escherichia coli expressing the PHA synthase gene phac2 from Pseudomonas aeruginosa: comparison of PhaC1 and PhaC2. FEMS Microbiol. Lett. 157: Langenbach, S., B. H. A. Rehm, and A. Steinbüchel (1997) Functional expression of the PHA synthase gene phac1 from Pseudomonas aeruginosa in Escherichia coli results in poly(3-hydroxyalkanoate) synthesis. FEMS Microbiol. Lett. 150: Qi, Q., A. Steinbüchel, and B. H. A. Rehm (1998) Metabolic routing towards polyhydroxyalkanoic acid synthesis in recombinant Escherichia coli (fadr): inhibition of fatty acid beta-oxidation by acrylic acid. FEMS Microbiol. Lett. 167: Ren, Q., N. Sierro, B. Witholt, and B. Kessler (2000) FabG, an NADPH-dependent 3-ketoacyl reductase of Pseudomonas aeruginosa, provides precursors for medium-chain-length poly-3-hydroxyalkanoate biosynthesis in Escherichia coli. J. Bacteriol. 182: Taguchi, K., Y. Aoyagi, H. Matsusaki, T. Fukui, and Y. Doi (1999) Co-expression of 3-ketoacyl-ACP reductase and polyhydroxyalkanoate synthase genes induces PHA production in Escherichia coli HB101 strain. FEMS Microbiol. Lett. 176: Park, S. J., J. P. Park, and S. Y. Lee (2002) Metabolic engineering of Escherichia coli for the production of medium-chain-length polyhydroxyalkanoates rich in specific monomers. FEMS Microbiol. Lett. 214: Tsuge, T., T. Fukui, H. Matsusaki, S. Taguchi, G. Kobayashi, A. Ishizaki, and Y. Doi (2000) Molecular cloning of two (R)-specific enoyl-coa hydratase genes from Pseudomonas aeruginosa and their use for polyhydroxyalkanoate synthesis. FEMS Microbiol. Lett. 184: Tsuge, T., K. Taguchi, S. Taguchi, and Y. Doi (2003) Molecular characterization and properties of (R)-specific enoyl-coa hydrata-

6 재조합대장균에서 MaoC 를이용한지방산으로부터의중간사슬길이폴리하이드록시알칸산생산연구 249 ses from Pseudomonas aeruginosa: metabolic tools for synthesis of polyhydroxyalkanoates via fatty acid β-oxidation. Int. J. Biol. Macromol. 31: Snell, K. D., F. Feng, L. Zhong, D. Martin, and L. L. Madison (2002) YfcX enables medium-chain-length poly(3-hydroxyalkanoate) formation from fatty acids in recombinant Escherichia coli fadb strains. J. Bacteriol. 184: Park, S. J. and Lee, S. Y. (2003) Identification and characterization of a new enoyl-coa hydratase involved in the biosynthesis of medium-chain-length polyhydroxyalkanoates in recombinant Escherichia coli. J. Bacteriol. 185: Wang, Q., R. C. Tappel., C. Zhu., and C. T. Nomura. (2012) Development of a new strategy for production of medium-chain-length polyhydroxyalkanoates by recombinant Escherichia coli via inexpensive non-fatty acid feedstocks. Appl. Environ. Microbiol. 78: Sato, S., H. Kanazawa., and T. Tsuge (2011) Expression and characterization of (R)-specific enoyl coenzyme A hydratases making a channeling route to polyhydroxyalkanoate biosynthesis in Pseudomonas putida. Appl. Microbiol. Biotechnol. 90: Braunegg, G., B. Sonnleitner, and R. M. Lafferty (1978) A rapid gas chromatographic method for the determination of poly-β-hydroxybutyric acid in microbial biomass. Eur. J. Appl. Microbiol. Biotechnol. 6: Choi, J., S. Y. Lee, K. Shin, W. G. Lee, S. J. Park, H. N. Chang, and Y. K. Chang (2002) Pilot scale production of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) by fed-batch culture of recombinant Escherichia coli. Biotechnol. Bioprocess Eng. 7:

학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪李錫河 * * Significance of Soybean as Food and Strategies for Self Suffici

학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and