07(16-151)p fm

Transcription

1 ISSN (PRINT) ISSN (ONLINE) 약학회지제 60 권제 6 호 327~334 (2016) Yakhak Hoeji Vol. 60, No. 6 DOI /psk 종설 Short Report TRIP-16 화합물의베타세포당지질독성해독기전분석 박선미 정대연 구진모 황윤정 * 최성이 * 강엽 * 정귀완 # 경기과학기술진흥원바이오센터, * 아주대학교의과대학 (Received November 21, 2016; Revised December 21, 2016; Accepted December 29, 2016) A Triazolo[3,4-a]phthalazine Derivative Protects INS-1 beta Cells from Glucolipotoxicity induced by High Glucose and Palmitate Sun-mi Park, Dae-youn Jeong, Jin-mo Ku, Yoon-Jung Hwang*, Sung-E Choi*, Yup Kang*, and Kwi-wan Jeong # Bio-Center, Gyeonggi Institute of Science and Technology Promotion; Suwon, Gyeonggi-do 16229, Republic of Korea *Institute for Medical Science, Ajou University School of Medicine; Suwon, Gyeonggi-do 16499, Republic of Korea Abstract Gradual deterioration of pancreatic beta cells is a conundrum still to be resolved in the diabetes field. The toxicity manifested by high level of glucose and saturated fatty acid (SFA), which is collectively termed as glucolipotoxicity, has been accepted as a predominant factor of beta cell dysfunction or failure. In this study, we examined the effect of TRIP (Triazolo[3,4-a]phthalazine)-16, a compound derivatized from TRIP which had been identified in a high throughput screening to discover chemicals protecting INS-1 cells from glucolipotoxicity. We also investigated its mode of action to reduce glucolipotoxicity, especially regarding modulation of lipid metabolism. From a series of cell-based experiments, we observed that TRIP-16 reduced fatty acid-induced triglyceride (TG) accumulation, whereas it increased oxidation rate of glucose or palmitate. The compound also reduced reactive oxygen species generated by palmitate and upregulated expression levels of carnitine palmitoyltransferase-1a (CPT-1a), peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC- 1α) and uncoupling protein 2 (UCP-2), implicating that it can facilitate mitochondrial energy metabolism to oxidize palmitate. In terms of beta cell functioning, TRIP-16 augmented glucose-stimulated insulin secretion (GSIS) per se. Taken together, our data strongly suggest that TRIP-16 can be a potential drug candidate for prevention of type 2 diabetes through beta cell protection. Keywords diabetes, beta cell, glucolipotoxicity, beta oxidation, Triazolo[3,4-a]phthalazine 우리나라뿐아니라전세계당뇨환자의 90~95% 를차지하고있는 2형당뇨는주로중년기이후복부비만, 과영양, 운동부족등과같은환경적요인이나유전적소인에의하여인슐린저항성이커짐과동시에, 늘어나는인슐린요구를충족시키지못하고인슐린분비를담당하는췌장베타세포가점진적으로기능을상실하고소멸되면서발생한다. 1) 포도당과지방산은정상적인상황에서는세포의생존에필요한에너지원으로쓰이지만, 에너지 # Corresponding Author Kwi-wan Jeong Bio-Center, Gyeonggi Institute of Science and Technology Promotion; Suwon, Gyeonggi-do 16229, Republic of Korea Tel.: Fax.: assylum@gstep.re.kr 원의수급불균형이장기간지속되거나비만환자의경우과도한농도의혈중포도당과지방산이산화적스트레스, 소포체스트레스, 염증반응등여러가지대사스트레스를유발하고말초조직의인슐린저항성및베타세포의사멸을유도하여더욱심한당뇨로진전시킨다. 2) 만성적인고농도의포도당과지방산은따로 ( 당독성 : glucotoxicity; 지질독성 : lipotoxicity) 또는함께 ( 당지질독성 : glucolipotoxicity) 베타세포에독성을유발한다는사실이실험적으로증명되었다. 고혈당은과도한소포체스트레스및산화적스트레스로인해베타세포의인슐린생합성과분비를억제하고세포사멸을초래한다. 3) Melatonin은당독성에의한산화적스트레스를억제하여베타세포사멸을막으며, 4) 항산화제 ( 예. N-acetyl cysteine) 와항산화효소 (glutathione peroxidase) 는설치류에서고혈당에의한인슐린 327

2 328 박선미 정대연 구진모 황윤정 최성이 강엽 정귀완 발현감소와산화적스트레스마커의증가를막고혈당을정상범위로되돌린다. 5,6) 4-phenylbutyric acid(4-pba) 는당독성에의한포도당자극인슐린분비 (glucose-induced insulin secretion, GSIS) 저해를막는다. 7) 이러한연구결과는산화스트레스및소포체스트레스관점에서당독성과베타세포사멸의인과관계를뒷받침해준다. 지방산은베타세포에서인슐린분비를촉진시키기도하지만만성적인고농도의지방산은베타세포의기능이상및사멸을초래한다. 이러한지질독성은당독성과마찬가지로소포체스트레스형태로나타나기도하며, 팔미트산과같은포화지방산의경우미토콘드리아또는퍼옥시좀대사를거쳐활성산소발생을증가시켜산화적스트레스를유발하거나, 세포사멸을유도하는 ceramide 와같은독성이차대사산물을만들어내기도한다. 8,9) 다수의 in vitro 실험과동물실험을기반으로한연구에서지질은고농도의포도당이수반될경우독성이더욱높아진다고보고되었다. 고도의당대사로부터과생성된 malonyl-coa는에스테르화지방산인 long-chain acyl-coa(lc-coa) 의미토콘드리아내수송을담당하는 carnitine palmitoyl transferase 1(CPT1) 을저해하여지질베타산화 (β-oxidation) 를억제한다. 그결과 LC-CoA가세포질에축적되고 phosphatidic aicd, lysophosphatidic acid, diacylglycerol, ceramide 등독성지질분자의생성이증가한다. 10,11,12) 또한고농도의당은 sterol regulatory element-binding protein 1c(SREBP1c) 를통한인슐린분비감소및지질생합성경로활성화를통해지질독성을강화한다. 13) 결론적으로고농도의당과지질은대사스트레스와독성분자를증가시켜상승적인독성을발휘함으로써베타세포의기능이상및사멸을초래하며이를당지질독성이라고부른다. 여러가지기전을통해당지질독성을낮춰베타세포를보호함으로써당뇨치료효과가기대되는약물이다수보고되었다. AMPactivated protein kinase(ampk) activator로알려진 5- Aminoimidazole-4-carboxamide ribonucleotide(aicar) 는 triglyceride 축적을억제하고, peroxisome proliferator-activated receptor(ppar) agonist로알려진 bezafibrate는베타산화를촉진함으로써당지질독성으로부터베타세포를보호하며, 이와는반대로 CPT-1 inhibitor인 etomoxir는베타산화를억제하여당지질독성을악화시키는것으로보고되었다. 11,14) Estrogen receptor agonist인 17-β-estradiol(E2) 은 signal transducer and activator of transcription 3(STAT3) 활성화를통해 fatty acid synthase (FAS) 를저해함으로써지질생합성을억제하는기전으로베타세포를보호한다. 15) TO901317과 GW3965 약물은 liver X receptor (LXR) agonist로서 stearoyl-coa desaturase-1(scd1) 의발현을증가시켜포화지방산을 triglyceride로만들고세포내부에축적및고립시킴으로써지질독성을완화시키는것으로알려졌다. 16) TCA cycle 대사중간체를보충하여결과적으로 citrate 유출을막고 malonyl-coa 생성을줄임으로써베타산화촉진및당지질독성을억제하는연구또한 INS-1 세포를통해진행되었다. 11) 이밖에 sirtuin 1(SIRT1) activator, 17) glycogen synthase kinase 3(GSK3) inhibitor인 1-Azakenpaullone, 18) c-jun N-terminal kinases(jnk) inhibitor인 SP ) 등의당지질독성저해효과또한보고되었다. 본연구에서는베타세포사멸을억제하는화합물로서스크리닝된 TRIP(Triazolo[3,4-a]phthalazine) 화합물의구조최적화연구를통해유도된 TRIP-16 화합물의베타세포사멸억제기전에대하여연구하였다. 당지질독성조건을재현한고농도의포도당 / 지방산조건에서 TRIP16 화합물의 INS-1 세포사멸억제활성, 에너지대사관련유전자발현조절과 triglyceride 축적억제, 포도당및지방산산화증가와이에따른활성산소생성여부를확인하였고, GSIS 실험을통해, TRIP-16 화합물이베타세포의인슐린분비기능에어떠한영향을주는지알아보았다. 실험방법시약및재료베타세포보호효과를갖는화합물을스크리닝하기위하여한국화합물은행 ( 대전, 대한민국 ) 으로부터화합물라이브러리를제공받아검색하였으며, 그중효과를보인 TRIP 화합물에대한유도체는경기과학기술진흥원 ( 수원, 대한민국 ) 에서합성하였다. Roswell Park Memorial Institute medium-1640(rpmi-1640) 배지, 항생제 (penicillin/streptomycin), fatty acid-free bovine serum albumin(bsa), palmitate, oleic acid, Hank's buffered salt solution(hbss), N-acetyl-L-cysteine(NAC) 은 Sigma-aldrich 사 (St Louis, MO, USA), fetal bovine serum(fbs) 은 Invitrogen 사 (Carlsbad, CA, USA) 제품을구입하였다. Cell counting kit- 8(CCK-8) 은 Dogindo molecular technologies 사 (Rockville, MD, USA) 제품을구입하였다. Poly ADP ribose polymerase(parp), caspase-3, β-actin 항체는 Cell Signaling 사 (MA, USA) 제품을구매하였다. CPT1a, PPARγ coactivator-1α(pgc1α), uncoupling protein 2(UCP2), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) 의 PCR 프라이머는코스모진텍 ( 서울, 대한민국 ) 으로부터합성및구매하였다. 세포배양 INS-1 세포는 RPMI-1640 배지에 10% FBS, 100 U/ml penicilin 과 100 μg/ml streptomycin을첨가하여 5% CO 2 와 37 o C의환경에서배양하였다. 2~3일마다새로운배지로갈아주며세포를유지하였으며, 각실험에서요구되는수의세포를분주한후, 하루 J. Pharm. Soc. Korea

3 TRIP-16 화합물의베타세포당지질독성해독기전분석 329 뒤세포가안정적으로부착되면실험을수행하였다. 팔미트산용액준비팔미트산용액은이전발표된논문을참고하여준비하였다. 11) 0.01N 수산화나트륨에 20 mm 팔미트산용액을 80 o C에서 30분간용해시키고, 용액이투명해질때까지 1N 수산화나트륨을첨가한다. 준비된팔미트산용액을 5% fatty acid-free BSA와부피비 1:3 비율로혼합하여실험에필요한적정농도 ( 최종 100~ 400 μm) 로희석하여사용하였다. CCK-8 assay 세포생존율측정을위해서 Cell counting kit-8(cck-8; Dogindo molecular technologies, Inc. Rockville, MD, USA) 시약을이용하였다. 이분석법은수용성이며무색의 tetrazolium (WST-8) 시약이살아있는세포의미토콘드리아환원효소에의해오렌지색의 formazan으로변화되는원리를이용하여측정하는분석법이다. 96-well plate에 INS-1 세포를 cells/100 μl 로분주하여세포가안정적으로부착되면, 고농도포도당 / BSA(25 mm glucose/bsa) 또는고농도포도당 / 팔미트산 (25 mm glucose/400 μm palmitic acid) 배지로바꿔주고화합물을 18시간동안처리하였다. 18시간후, CCK-8(10X) 시약 10 μl/well를넣고 37 o C 배양기에서 4시간동안반응시킨후, FlexStation III(Molecular devices, CA, USA) 장비를이용하여 470 nm 흡광도를측정하였다. DNA Fragmentation assay 이분석법은세포사멸과정에서일어나는 DNA의단편화 (fragmentation) 를측정하는방법이다. INS-1 세포에세포생존율측정방법과동일하게처리후, Cell Death Detection ELISA PLUS kit (Roche diagnostics, GmbH, Mannheim, Germany) 와 FlexStation III 장비를이용하여 405 nm 흡광도를측정하였다. SDS-PAGE 및웨스턴블랏 6-well plate에배양한 INS-1 세포에세포생존율측정방법과동일하게처리후, 세포를모아 RIPA buffer(1% Triton X-100, 1% sodium deoxycholate, 50 mm NaCl 2, 50 mm Tris-HCl, 1 mm sodium vanadate, 2 mm PMSF) 를이용하여단백질을분리하고 sample buffer(187 mm tris-hcl ph 6.8, 10% SDS, 30% glycerol, 100 mm DTT, 0.3% bromophenol blue) 에희석하여 5분간끓였다. 준비된단백질샘플을 SDS polyacrylamide gel 로전기영동하여, nitrocellulose membrane(bio-rad, Hercules, CA, USA) 으로이동시킨후에 5% skim milk로 30분간 blocking 하였다. 각각의 1차항체및 2차항체와반응시킨후, 항체와결합한단백질의양을 Immobilon Western Chemiluminescent HRP Substrate(Merck Millipore, Darmstadt, Germany) 와이미지분석기 (ImageQuant LAS 4000 mini, GE Healthcare, UK) 를이용하여확인하였다. 중성지방함량분석 INS-1 세포를 12-well plate에 cells/well로분주하여 24 시간배양후, 팔미트산과동일한방법으로올레익산을용해시키고, BSA와부피비 1:3 비율로섞어팔미트산 100 μm, 올레익산 200 μm 농도로화합물과함께처리하고 16시간동안배양하였다. PBS 세척후 lysis buffer(5% NP40 in D.W) 100 μl를넣어초음파분쇄기를이용하여세포를터트렸다. Triglyceride 용해도를높이기위해 80 o C에서 5분반응 /vortexing 5분과정을 2회반복하여원심분리하고 Triglyceride Quantification Colorimetric Kit(Biovision, CA, USA) 를이용하여반응시킨후, FlexStation III 장비를이용하여 535/587 nm 파장에서형광값을측정하였다. 실시간중합효소연쇄반응을통한정량분석 (Quantitative real-time PCR) INS-1 세포를 100 cm 2 plate에 개씩분주하여 24시간동안배양하고, HG/BSA 또는 HG/PA(25 mm glucose/300 μm palmitic acid) 및 20 μm TRIP-16 화합물을처리하여 24시간동안배양하였다. 세포를 PBS로 2회세척하고, Hybrid-R Total RNA kit(geneall, 대한민국 ) 를이용해전체 RNA를추출하여정량하였다. One Step RT-PCR Mix(Doctor Protein, 대한민국 ) 및 LightCycler 480(Roche Diagnostics, GmbH,. Mannheim, Germany) 장비를이용하여, 50 o C 30분, 95 o C 10분, 95 o C 5초 / 60 o C 30초 (40 cycle), 95 o C 5초, 65 o C 1분조건으로역전사반응과실시간중합반응을통해상대적인 mrna 양을비교분석하였다. 대조물질로서화합물을용해시킬때사용한 DMSO를화합물과동일부피로처리하였다. GAPDH 유전자에대한실험결과를이용하여데이터를보정하였으며, DMSO 처리한음성대조군의 mrna 발현율을 1로설정하여상대값을분석하였다. 모든실험절차는세번반복하였으며각각의실험은독립적으로수행하였다. 본실험에이용한프라이머서열은 Table I에정리하였다. 활성산소측정세포내산화적스트레스를측정하기위하여 DCFH 2 -DA (Carboxy-dichloro-dihydro-fluorescein diacetate-da; Sigmaaldrich, St Louis, MO, USA) 시약을이용한형광분석법을수행하였다. INS-1 세포 개를 96-well plate에분주하고다음날, HG/BSA 및 HG/PA(25 mm glucose/400 μm palmitic acid) 배지와화합물을처리하여 3시간반응시켰다. 100 μl HBSS로세포를 2회세척하고 20 μm DCFH 2 -DA를 45분간반응시킨후, Vol. 60, No. 6, 2016

4 330 박선미 정대연 구진모 황윤정 최성이 강엽 정귀완 Table I Sequences of primers used for quantitative real-time PCR Gene Primer Sequence (5' to 3') Forward CATGTCAAGCCAGACGAAGA CPT1a 20) Reverse TGGTAGGAGAGCAGCACCTT Forward AGGTCCCCAGGCAGTAGAT PGC1α2 21) Reverse CGTGCTCATTGGCTTCATA Forward GGGTCCGCGCAGCCTCTACAATG UCP2 22) Reverse TCCCTTCCTCTCGTGCAATGGTCT Forward GCTTCGGTGACAACACCA GAPDH 23) Reverse AGCTGCTCAATGGACTTTCC 포도당자극인슐린분비실험 INS-1 세포 개씩 24-well plate에분주하고, 200 μm 팔미트산이포함된배지에서 DMSO 또는 TRIP-16 화합물과함께 48시간동안배양하였다. KRB buffer(24 mm NaHCO 2, 1.2 mm MgCl 2, 1 mm HEPES, 129 mm NaCl, 4.8 mm KCl, KH 2 PO 4, 2.5 mm CaCl 2, 0.2% BSA, 0.2 mm glucose, ph 7.4) 에서 1시간동안배양후, 5.6 mm와 22.4 mm 포도당을처리하고 2시간동안반응시켰다. 상등액에배출된인슐린을 Insulin ELISA kit(shibayagi, Japan) 와 FlexStation III 장비를이용해 420 nm 흡광도를측정하였다. 별도로인슐린에대한정량그래프를그리고선형회귀분석식을통해인슐린양을산출하였다. FlexStation III 장비를이용, 485/535 nm 형광을측정하여활성산소를정량하였다. 팔미트산산화율측정 INS-1 세포 cells/100 μl를 XF plate에분주하고, 세포가안정적으로부착되도록 24시간동안배양하였다. 측정 24시간전프로브플레이트각 well에 calibrant 1 ml를넣어 CO 2 -free 배양기에서사전배양하였다. 측정 18시간전세포에화합물 3개농도와음성대조군 (DMSO), 양성대조물질 (500 μm AICAR) 을처리하였다. 화합물처리 18시간후, KRB buffer(5 mm NaHCO 3, 1 mm MgCl 2, 10 mm Hepes, 129 mm NaCl, 4.8 mm KCl, 1.2 mm KH 2 PO 4, 2.5 mm CaCl 2, 2% BSA) 1시간동안배양한다음, KHB-palmitate buffer(111 mm NaCl, 4.7 mm KCl, 2 mm MgSO4, 1.2 mm Na2HPO4, 2 mm glucose, 0.5 mm carnitine, 200 μm palmitate) 를넣고 CO 2 -free 배양기에서 1시간동안배양하였다. 제조사의매뉴얼을준수하여 XF analyzer (Seahorse bioscience, MD, USA) 를이용, 산소소비율 ( 산화율 ) 을측정하였다. 통계분석모든실험결과는세번의독립적인실험데이터의평균 ± 표준편차로표시하였다. 통계유의성분석은 Student's t-test 및 oneway ANOVA 분석법을이용하였으며, P<0.05인값에대하여유의성이있다고판정하였다. 실험결과및고찰당지질독성으로부터베타세포를보호하는물질을스크리닝하기위해한국화합물은행으로부터 6,400개의화합물을제공받았다. INS-1 세포에고농도의포도당과팔미트산을처리하여당지질독성을유발하고화합물처리후세포생존율을측정하여, 세포사멸억제활성을갖는 25종의물질을선별하였다. 그중하나인 TRIP 화합물에대한구조활성최적화연구를통해가장좋은효과를보인 TRIP-16을선정하여베타세포사멸억제기전규명을위한추가연구를진행하였다. TRIP-16 의베타세포보호효과검증을위하여, 농도별로화합물을처리하고 CCK-8 assay를수행한결과 EC 50 는약 μm Fig. 1 Protective effect of TRIP-16 on glucolipotoxicity-induced INS-1 cell death. (A) INS-1 cells were treated with 25 mm glucose and 400 μm palmitate (HG/PA) in combination with different concentration of TRIP-16 for 18 h. Cell viability was measured and doseresponse curve was plotted. The chemical structure of TRIP-16 is described. (B) INS-1 cells were treated with HG/PA in the presence of different concentration of AICAR or TRIP-16. After 18 h incubation, level of DNA fragmentation was measured. (C) Antiapoptotic activity of TRIP-16 was assessed by measuring level of cleaved caspase-3 and PARP using antibodies as indicated. DW denotes DW1182v compound, a positive control. * P<0.05, ** P<0.01. J. Pharm. Soc. Korea

5 TRIP-16 화합물의베타세포당지질독성해독기전분석 331 로, 농도의존적베타세포보호효과를확인하였다 (Fig. 1A). 또한같은실험조건에서세포사멸과정중일어나는 DNA 단편화를정량하는방법인 DNA fragmentation assay를통해화합물의효과를재검증하였다. AMPK activator로서당독성에의한 INS- 1E 세포사멸을저해하는효과를가진것으로알려진 AICAR 14) 와마찬가지로농도의존적세포사멸감소효과를확인하였다. 30 μm TRIP-16과 1000 μm AICAR가유사한정도의효과를보이는것으로보아 TRIP-16 은 AICAR와비교하여약 30배정도베타세포보호효력이큰것으로판단되었다 (Fig. 1B). 세포사멸기전의바이오마커로서잘알려진 PARP(Poly ADP-ribose polymerase) 과 caspase3 단백질의분절을확인한결과양성대조화합물인 DW1182v 24) 와마찬가지로팔미트산에의한두마커단백질의분절생성을저해하였다 (Fig. 1C). 위실험결과는 TRIP- 16이당지질독성으로부터베타세포를보호하여사멸을억제할수있음을의미한다. LXR agonist인 TO 은 SCD1 발현증가를통해팔미트산을 triglyceride로변환하고세포내부에축적시켜독성을완화하고베타세포를보호하는반면, 16) AICAR는팔미트산에의한 triglyceride 과다축적을억제하여 INS-1E 베타세포를보호한다고보고되었다. 14) 이에따라 TRIP-16이 INS-1 세포의 triglyceride 축적에어떠한영향을미치는지조사하였다. 우선 TRIP-16을단독으로처리하는경우와 300 μm 팔미트산을처리하여독성유도후 TRIP-16을처리한결과세포내 triglyceride 양에는변화가없었다 (data not shown). 다음 100 μm 팔미트산과 200 μm 올레익산을동시에처리하여 triglyceride 축적을유도하고, 5, 10, 30 μm의 TRIP-16을처리한결과각각 45%, 60%, 94% 감소효 과를보였으며, 1 mm AICAR를처리한경우에는약 44% 의감소효과를보였다 (Fig. 2). 이러한결과는 AICAR와마찬가지로 triglyceride의세포내축적억제가 TRIP-16의베타세포보호기전중하나로설명될수있음을시사한다. 지방산을 triglyceride로변환하여축적하는기전이아니고오히려그반대라면지방산을미토콘드리아에서산화시켜소비하는기전을통해에너지항상성을조절할것으로예측되었다. 또한 PPAR agonist인 bezafibrate는포도당및지방산산화를증가시킴으로써베타세포를보호한다고알려져있으므로, 11) TRIP- 16 또한이러한효과가있는지를알아보기위하여 XF analyzer 를통한포도당및팔미트산산화율을측정하였다. 우선 500 μm 의 bezafibrate를처리한결과 43% 의산화율증가가관찰되었다. TRIP-16을 2μM, 10 μm 처리시에는각각 23%, 45% 의농도의존적인증가율을보였다 (Fig. 3). 이러한결과는 TRIP-16 이베타세포를보호하기위하여포도당및팔미트산의산화율을증가시키는것으로해석될수있다. 그러나 TRIP-16이포도당, 팔미트산또는두에너지원모두의산화를촉진시키는지구체적으로밝히기위해서는후속연구가필요하다. 미토콘드리아의에너지대사가증가하면필연적으로활성산소가증가하여세포에독성으로작용할수있다. 이에따라 TRIP- 16이팔미트산처리에따른활성산소생성에미치는영향을조사하였다. 400 μm의팔미트산을처리하면대조군에비하여활성산소가 10% 증가하였고여기에과산화수소 1μM을처리한결과 31% 로더욱증가하였다. 활성산소저해제로알려진 NAC를처리하면활성산소발생이 5% 로감소하였고 10 μm의 TRIP-16 을처리하면 2% 로현저히낮아졌다. 이결과는 TRIP-16이포도당및지방산산화를증가시킴에도불구하고활성산소생성은오히려낮추었음을나타낸다 (Fig. 4). 위실험결과에의하면 TRIP-16 은미토콘드리아의에너지대 Fig. 2 TRIP-16 reduced triglyceride accumulation in INS-1 cells. Twenty five millimolar glucose, 100 μm palmitate and 200 μm oleate in conjunction with indicated dose of AICAR or TRIP-16 was treated for 16 h. Triglyceride content in cells were determined by TG quantification kit (n=3). ** P<0.01. Fig. 3 TRIP-16 increased oxygen consumption rate in INS-1 cells. INS-1 cells were treated with bezafibrate or TRIP- 16 for 18 h. After treatment with KHB-palmitate buffer for 1 h, oxygen consumption rates were analyzed by the XF analyzer (n=3). * P<0.05; ** P<0.01. Vol. 60, No. 6, 2016

6 332 박선미 정대연 구진모 황윤정 최성이 강엽 정귀완 Fig. 4 TRIP-16 reduced ROS level in HG/PA-treated INS-1 cells. INS-1 cells were treated with H 2 O 2, NAC or TRIP-16 for 3 h in the presence or absence of 400 μm palmitate. Forty five minutes after DCFH 2 -DA staining, ROS levels were analyzed by measuring fluorescence at 485 ex /535 em nm using the FlexStation III (n=3). * P<0.05; *** P< 사효율을증가시켜당지질독성으로부터베타세포를보호한다고추측할수있으므로, 미토콘드리아내 LC-CoA의수송을담당하는 CPT1a, 미토콘드리아의기능조절과신생 (biogenesis) 및지질대사에관여하는 PGC1α, 25) 미토콘드리아의활성산소생성조절과관련있는 UCP2 26) 등유전자의발현에 TRIP-16 이미치는영향을 real-time PCR 기법을이용하여알아보았다. 우선 CPT1a 의발현은다른연구논문에서보고된수치와유사하게팔미트산처리시 6.2배증가하였다 (Fig. 5A). 27,28) TRIP-16을처리하면팔미트산유무와관계없이 1.5배정도로유의성있게증가하였다. PGC1α의발현은팔미트산처리에거의영향을받지않고 TRIP- 16에의해팔미트산이없을때 2.3배, 있을때 1.9배증가하는결과를보였다 (Fig. 5B). UCP2는팔미트산에의해 1.3배증가하고, 팔미트산이없을때는 TRIP-16 에의해 1.7배증가하지만팔미트산존재하에서는증가율이 10% 정도로미미하였다 (Fig. 5C). 따 라서 TRIP-16 의팔미트산에의한활성산소생성저해효과는 UCP2 뿐아니라다른미지의기전을통해서나타난효과로사료된다. 이상의결과를종합해볼때 TRIP-16은 CPT1a 발현을증가시켜팔미트산의산화를촉진시키고, PGC1α 발현또한증가시켜지질대사및미토콘드리아의기능활성화와신생을돕는다고할수있다. TRIP-16 의베타세포보호작용외인슐린분비기능에미치는영향을추가적으로조사하고자포도당자극인슐린분비실험을수행하였다. DMSO 조건에서는팔미트산이없으면고농도포도당자극에의해 56% 의인슐린분비가증가되는반면, 200 μm 팔미트산존재하에서는 42% 증가하였다 (P<0.001). 고농도포도당자극실험군끼리비교해보면 10 µm의 TRIP-16을처리하면 DMSO 처리군에비하여팔미트산이없을경우 26%, 있을경우 23% 의인슐린분비증가효과를보여주었다 (P<0.01). 결과적으로 TRIP-16은팔미트산존재여하에상관없이그자체로포도당유도인슐린분비를증가시키는것으로확인되었다 (Fig. 6). 이상의실험결과를종합하면, TRIP-16 은 triglyceride 축적억제, 지방산산화활성화및활성산소생성억제를통해고농도포도당과지질에의한당지질독성을해소함으로써베타세포를보호하였으며, 이러한활성은미토콘드리아에너지대사에관련된유전자발현을증가시키는기전에의한효과로일부설명할수있다. TRIP-16은베타세포보호뿐만아니라추가적으로베타세포의인슐린분비기능을높이는효과또한가지고있었다. 향후 TRIP-16의직접적인표적단백질을규명하기위한연구와약물성을충족시키기위한구조최적화연구및비임상연구를통해베타세포보호를주요기전으로하는 2형당뇨치료제개발로이어질수있기를기대한다. 결론본연구는당지질독성으로부터베타세포보호효과를갖는화 Fig. 5 TRIP-16 activated expression of genes involved in the beta oxidation and mitochondrial biogenesis. INS-1 cells treated with either 20 μm TRIP-16 or DMSO were incubated in the media containing either 300 μm palmitate (HG/PA) or BSA (HG/BSA) for 24 h. Total RNA was isolated and mrna expression of CPT1a (A), PGC1α (B) and UCP2 (C) were determined by quantitative real time PCR (n=3). GAPDH was used as a control gene. Data represent means±sd. * P<0.05; ** P<0.01. J. Pharm. Soc. Korea

7 TRIP-16 화합물의베타세포당지질독성해독기전분석 333 요한물질합성및실험에사용된기기및시설은경기과학기술진흥원의도움으로연구되었음에감사드립니다. 아울러한국화합물은행의화합물라이브러리지원에감사드립니다. References Fig. 6 TRIP-16 augmented GSIS regardless of palmitate. INS-1 cells were treated with 200 μm palmitate in combination with DMSO or TRIP-16 for 48 h. The cells were incubated with KRB buffer for 1 h and stimulated with either low glucose (5.6 mm glucose) or high glucose (22.4 mm glucose) for 2 h. Insulin released into the supernatant was measured using the rat insulin ELISA kit (n=3). Data represent means±sd. ** P<0.01; *** P< 합물을스크리닝하고, 그중뚜렷한효과를보인 TRIP 화합물의구조활성최적화연구를통해얻어진 TRIP-16 의활성평가및작용기전을탐색하기위하여수행되었다. INS-1 세포에당지질독성을유도하고 TRIP-16을처리한결과 EC 50 =10.61 μm의세포사멸억제효과를보였으며, DNA fragmentation assay 및 PARP 과 caspase3에대한웨스턴블랏실험을통해활성을검증하였다. TRIP-16 과지질및에너지대사의상관관계를분석한결과, TRIP-16 은 triglyceride로변환된지질의세포내축적을억제하고세포의산화대사를촉진함과동시에활성산소생성을억제하였다. 이러한사실은 TRIP-16이독소로작용할수있는과도한에너지원을동화작용 (metabolism) 이아닌이화작용 (catabolism) 에의해소비하는방향으로유도함으로써베타세포를보호하는것으로짐작할수있다. 더불어 TRIP-16 은 CPT1a, PGC1α, UCP2 유전자의발현을증가시켰으며, 이러한작용을통해미토콘드리아의대사효율을향상시킨것으로볼수있다. TRIP-16 은포도당자극에의한인슐린분비를증가시키는효과도보여주었다. 이상의결과로부터당지질독성으로부터베타세포를보호하고인슐린분비기능을향상시키는 TRIP-16 의효능및작용기전이확인되었으며, 보다세밀한약물표적규명과추가적인구조최적화및비임상연구가진행된다면새로운기전의 2형당뇨치료제로서개발될수있을것이다. 감사의말씀 이논문은 경기도의지원에의해수행 되었으며, 실험에필 1) Prentki, M. and Nolan, C. J. : Islet beta cell failure in type 2 diabetes. J. Clin. Invest. 116, 1802 (2006). 2) Montane, J., Cadavez, L. and Novials, A. : Stress and the inflammatory process: a major cause of pancreatic cell death in type 2 diabetes. Diabetes Metab. Syndr. Obes. 7, 25 (2014). 3) Robertson, R. P., Harmon, J., Tran, P. O., Tanaka, Y. and Takahashi, H. : Glucose toxicity in beta-cells: type 2 diabetes, good radicals gone bad, and the glutathione connection. Diabetes 52, 581 (2003). 4) Park, J. H., Shim, H. M., Na, A. Y., Bae, K. C., Bae, J. H., Im, S. S., Cho, H. C. and Song, D. K. : Melatonin prevents pancreatic beta-cell loss due to glucotoxicity: the relationship between oxidative stress and endoplasmic reticulum stress. J. Pineal. Res. 56, 143 (2014). 5) Tanaka, Y., Gleason, C. E., Tran, P. O., Harmon, J. S. and Robertson, R. P. : Prevention of glucose toxicity in HIT-T15 cells and Zucker diabetic fatty rats by antioxidants. Proc. Natl. Acad. Sci. U. S. A. 96, (1999). 6) Tanaka, Y., Tran, P. O., Harmon, J. and Robertson, R. P. : A role for glutathione peroxidase in protecting pancreatic beta cells against oxidative stress in a model of glucose toxicity. Proc. Natl. Acad. Sci. U. S. A. 99, (2002). 7) Choi, S. E., Lee, Y. J., Jang, H. J., Lee, K. W., Kim, Y. S., Jun, H. S., Kang, S. S., Chun, J. and Kang, Y. : A chemical chaperone 4-PBA ameliorates palmitate-induced inhibition of glucose-stimulated insulin secretion (GSIS). Arch. Biochem. Biophys. 475, 109 (2008). 8) Gehrmann, W., Elsner, M. and Lenzen, S. : Role of metabolically generated reactive oxygen species for lipotoxicity in pancreatic beta-cells. Diabetes Obes. Metab. 12 Suppl 2, 149( 2010). 9) Maedler, K., Oberholzer, J., Bucher, P., Spinas, G. A. and Donath, M. Y. : Monounsaturated fatty acids prevent the deleterious effects of palmitate and high glucose on human pancreatic beta-cell turnover and function. Diabetes 52, 726 (2003). 10) Prentki, M., Joly, E., El-Assaad, W. and Roduit, R. : Malonyl- CoA signaling, lipid partitioning, and glucolipotoxicity: role in beta-cell adaptation and failure in the etiology of diabetes. Diabetes 51 Suppl 3, S405 (2002). 11) Choi, S. E., Lee, Y. J., Hwang, G. S., Chung, J. H., Lee, S. J., Lee, J. H., Han, S. J., Kim, H. J., Lee, K. W., Kim, Y., Jun, H. S. and Kang, Y. : Supplement of TCA cycle intermediates Vol. 60, No. 6, 2016

8 334 박선미 정대연 구진모 황윤정 최성이 강엽 정귀완 protects against high glucose/palmitate-induced INS-1 beta cell death. Arch. Biochem. Biophys. 505, 231 (2011). 12) Poitout, V., Amyot, J., Semache, M., Zarrouki, B., Hagman, D. and Fontes, G. : Glucolipotoxicity of the pancreatic beta cell. Biochim. Biophys. Acta. 1801, 289 (2010). 13) Wang, H., Maechler, P., Antinozzi, P. A., Herrero, L., Hagenfeldt-Johansson, K. A., Bjorklund, A. and Wollheim, C. B. : The transcription factor SREBP-1c is instrumental in the development of beta-cell dysfunction. J. Biol. Chem. 278, (2003). 14) Dai, Y. L., Huang, S. L. and Leng, Y. : AICAR and Metformin Exert AMPK-dependent Effects on INS-1E Pancreatic betacell Apoptosis via Differential Downstream Mechanisms. Int. J. Biol. Sci. 11, 1272 (2015). 15) Tiano, J. P., Delghingaro-Augusto, V., Le May, C., Liu, S., Kaw, M. K., Khuder, S. S., Latour, M. G., Bhatt, S. A., Korach, K. S., Najjar, S. M., Prentki, M. and Mauvais-Jarvis, F. : Estrogen receptor activation reduces lipid synthesis in pancreatic islets and prevents beta cell failure in rodent models of type 2 diabetes. J. Clin. Invest. 121, 3331 (2011). 16) Hellemans, K. H., Hannaert, J. C., Denys, B., Steffensen, K. R., Raemdonck, C., Martens, G. A., Van Veldhoven, P. P., Gustafsson, J. A. and Pipeleers, D. : Susceptibility of pancreatic beta cells to fatty acids is regulated by LXR/PPARalpha-dependent stearoylcoenzyme A desaturase. PLoS One 4, e7266 (2009). 17) Wu, L., Zhou, L., Lu, Y., Zhang, J., Jian, F., Liu, Y., Li, F., Li, W., Wang, X. and Li, G. : Activation of SIRT1 protects pancreatic beta-cells against palmitate-induced dysfunction. Biochim. Biophys. Acta. 1822, 1815 (2012). 18) Stukenbrock, H., Mussmann, R., Geese, M., Ferandin, Y., Lozach, O., Lemcke, T., Kegel, S., Lomow, A., Burk, U., Dohrmann, C., Meijer, L., Austen, M. and Kunick, C. : 9-cyano- 1-azapaullone (cazpaullone), a glycogen synthase kinase-3 (GSK-3) inhibitor activating pancreatic beta cell protection and replication. J. Med. Chem. 51, 2196 (2008). 19) Wang, W., Liu, Y., Chen, Y., Cao, C., Xiang, Y., Zhang, D., Han, L., Zhao, H. and Liu, G. : Inhibition of Foxo1 mediates protective effects of ghrelin against lipotoxicity in MIN6 pancreatic beta-cells. Peptides 31, 307(2010). 20) Li, G., Hernandez-Ono, A., Crooke, R. M., Graham, M. J. and.ginsberg, H. N. : Effects of antisense-mediated inhibition of 11beta-hydroxysteroid dehydrogenase type 1 on hepatic lipid metabolism. J. Lipid Res. 52, 971 (2011). 21) Zhang, Y., Liu, C., Zhu, L., Jiang, X., Chen, X., Qi, X., Liang, X., Jin, S., Zhang, P., Li, Q., Wang, D., Liu, X., Zeng, K., Zhang, J., Xiang, Y. and Zhang, C. Y. PGC-1alpha inhibits oleic acid induced proliferation and migration of rat vascular smooth muscle cells. PLoS One 2, e1137 (2007). 22) Ostrowski, J., Klimek-Tomczak, K., Wyrwicz, L. S., Mikula, M., Schullery, D. S. and Bomsztyk, K. : Heterogeneous nuclear ribonucleoprotein K enhances insulin-induced expression of mitochondrial UCP2 protein. J. Biol. Chem. 279, (2004). 23) Muhlhausler, B. S., Cook-Johnson, R., James, M., Miljkovic, D., Duthoit, E. and Gibson, R. : Opposing effects of omega-3 and omega-6 long chain polyunsaturated Fatty acids on the expression of lipogenic genes in omental and retroperitoneal adipose depots in the rat. J. Nutr. Metab (2010). 24) Lee, S. J., Choi, S. E., Hwang, Y. C., Jung, I. R., Yi, S. A., Jung, J. G., Ku, J. M., Jeoung, K., Han, S. J., Kim, H. J., Kim, D. J., Lee, K. W. and Kang, Y. : A compound (DW1182v) protecting high glucose/palmitate-induced glucolipotoxicity to INS-1 beta cells preserves islet integrity and improves hyperglycemia in obese db/db mouse. Eur. J. Pharmacol. 696, 187 (2012). 25) Liang, H. and Ward, W. F. : PGC-1alpha: a key regulator of energy metabolism. Adv. Physiol. Educ. 30, 145 (2006). 26) Produit-Zengaffinen, N., Davis-Lameloise, N., Perreten, H., Becard, D., Gjinovci, A., Keller, P. A., Wollheim, C. B., Herrera, P., Muzzin, P. and Assimacopoulos-Jeannet, F. : Increasing uncoupling protein-2 in pancreatic beta cells does not alter glucose-induced insulin secretion but decreases production of reactive oxygen species. Diabetologia 50, 84 (2007). 27) Busch, A. K., Cordery, D., Denyer, G. S. and Biden, T. J. : Expression profiling of palmitate- and oleate-regulated genes provides novel insights into the effects of chronic lipid exposure on pancreatic beta-cell function. Diabetes 51, 977 (2002). 28) Xiao, J., Gregersen, S., Kruhoffer, M., Pedersen, S. B., Orntoft, T. F. and Hermansen, K. : The effect of chronic exposure to fatty acids on gene expression in clonal insulin-producing cells: studies using high density oligonucleotide microarray. Endocrinology 142, 4777 (2001). J. Pharm. Soc. Korea