한수지 49(6), , 2016 Note Korean J Fish Aquat Sci 49(6), ,2016 마루자주새우 [Crangon hakodatei (Rathbun, 1902)] 의전장미토콘드리아유전체에대한분석연구 김경률 1 김현우 1,2

Size: px
Start display at page:

Download "한수지 49(6), , 2016 Note Korean J Fish Aquat Sci 49(6), ,2016 마루자주새우 [Crangon hakodatei (Rathbun, 1902)] 의전장미토콘드리아유전체에대한분석연구 김경률 1 김현우 1,2"

Transcription

1 한수지 49(6), , 2016 Note Korean J Fish Aquat Sci 49(6), ,2016 마루자주새우 [Crangon hakodatei (Rathbun, 1902)] 의전장미토콘드리아유전체에대한분석연구 김경률 1 김현우 1,2 * 1 부경대학교의생명기계전기융합공학협동과정, 2 부경대학교자원생물학과 Complete Mitochondrial Genome of Crangon hakodatei (Rathbun, 1902) (Crustacea: Decapoda: Crangonidae) Gyungryul Kim 1 and Hyun-Woo Kim 1,2 * 1 Interdisciplinary Program of Biomedical, Mechanical and Electrical Engineering, Pukyong National University, Busan 48513, Korea 2 Department of Marine Biology, Pukyong National University, Busan 48513, Korea Although shrimps belonging to family Crangonidae are known to be genetically divergent and ecologically important among the various benthos, any of their mitochondrial genome has not been reported yet. We here determined the complete mitochondrial genome sequence of Crangon hakodatei (Rathbun, 1902), which was collected from East China Sea (124 E and 34.5 N). Total mitochondrial genome length of C. hakodatei was 16,060 bp, in which 13 proteins, 2 ribosomal RNAs, 22 transfer RNAs and a putative control region were encoded. Secondary structure prediction analysis showed that twenty trna genes exhibit the conserved structure but two genes, trna Cys and trna Ser (AGN), lack T and D arm, respectively. Based on the sequence similarity of the COI region from the currently reported five species belonging to genus Crangonidae, C. hakodatei was most closely related to Crangon crangon. Phylogenetic analysis of full COXI genes belonging to infraorder Caridea showed that only crangonid shrimps were clustered together with those of Dendrobranchiata. Gene order were well conserved from Penaeoidea to Caridea but trna Pro and trna Thr in Palaemonid shrimp were flipped each other by the recombination. Further study about mitochondrial genome sequences of shrimps belonging to Crangonidae should be made to know better about their evolutional relationships with other those in infraorder Caridea. Key words: Crangonidae, Decapod crustacean, Barcode, Mitochondrial genome 서론 (Fabricius, 1798) 24 (Hayashi and Kim, 1999). (gastric spine), 3 (maxilliped) (arthrobranch), (pereopod) (merus) 1 (ventral spine) (Hayashi and Kim, 1999). [Crangon hakodatei (Rathbun, 1902)],,, 200 m (Cha et al., 2001; Han and Li, 2015; Hayashi and Kim, 1999). 3 5 (abdominal somites) (dorsomedial carina) (Han and Li, 2015; Maher et al., 2013). C. hakodatei (Han and Li, 2015). Korean J Fish Aquat Sci 49(6) , December 2016 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial Licens ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Received 8 December 2016; Accepted 19 December 2016 *Corresponding author: Tel: Fax: address: kimhw@pknu.ac.kr Copyright 2016 The Korean Society of Fisheries and Aquatic Science 867 pissn: , eissn:

2 868 김경률ㆍ김현우. cytochrome oxidase subunit I (COXI) COI DNA (Folmer et al., 1994), (Lang and Burger, 2007; Ma et al., 2015; Yamauchi et al., 2002). Sanger (Dideoxy termination reaction) (~15 kb), (NGS) (Williams et al., 2014; Zhou et al., 2013)., ,319 GenBank ( (Matzen da Silva et al., 2011),. PCR C. hakodatei. 샘플링및 DNA 추출 재료및방법 (124 DNA lva. 99% (SK, ) -20%. genomic DNA Tissue Lyser II (QIAGEN). genomic DNA AccuPrep Genomic DNA Extraction Kit (Bioneer, ). DNA -70. MiSeq 시스템을이용한전장미토콘드리아게놈분석 PCR, COXI b (cyt b) PCR. COXI LCO1490 HCO2198 (Folmer et al., 1994) cytb Crus-mt-F10 Crus-mt-R10 (Table 1). IDT SciTools Table 1. The primer sequences used in the study Name Crus-mt-F10 Crus-mt-R10 Crh-F1 Crh-R1 Crh-F2 Crh-R2 Crh-F3 Crh-R3 Crh-F41 Crh-R4 Crh-F5 Crh-R5 Crh-F6 Crh-F7 Crh-R7 M13-F M13-R Sequences (5' 3') GCWATACAYTAYACDGC TTRTTDGGRATDGAHCG CGCCCGCTAAACTAGAAGCAGAG CTCTGCTTCTAGTTTAGCGGGCG CCTCCTCTCTCAGCAGGAATTGCTCAC TAAAGAAGAATGAAGCGCCGTTGGC CTTAGAAATGAGAGCGACGGGCG AGTATGTACACATCGCCCGTCGC CGAACTATTCATGCCAACGGCGC AGCTCCTAGAATGGAAGATACACCAGC GTTAGTATAACCGCGGATGCTGGCAC CCTGCATTATGTTTTGGTGTAAAGGCACG GCTTCATGGTTTACGGCTTGACTTGG GCGACGGGCGATGTGTACATAC CAGGCCGACTACCATGTTCCATCTC GTAAAACGACGGCCAGT GCGGATAACAATTTCACACAGG ( (Macrogen, Korea). PCR Gel Extraction Kit (Bioneer, Daejeon, Korea) pgem-t Easy vector (Promega, Madison, WI). DH5d 37. M13 PCR PCR (Table 1). DNA. PCR (Yamauchi et al., 2002) Crh-F2 Crh-R2 Crh-F4 Crh-R4 PCR (Table 1). 2 PCR Covaris M220 (Covaris Inc, Woburn, MA, USA) 600 bp. TruSeq Sample Preparation V2, (Illumina, San Diego, USA). PCR, 2%. 500 bp 700 bp MiniElute PCR (Qiagen, Hilden, Germany). MiSeq System 염기서열조합및생물정보학적분석 MiSeq sequencer CLC Ge-

3 마루자주새우의전장미토콘드리아게놈 869 nomic Workbench v.8.0 (CLC Bio Aarhus, ) QV Mothur (v ) 7 bp. Geneious R8 (Biomatters, Auckland, New Zealand) 20 bp 100%. C. hakodatei PCR (Table 1) rrna mtdna. 22 trna trnascan-se (Lowe and Ward, 1997) ARWEN (Laslett and Canbäck, 2008). C. hakodatei Organellar Genome DRAW (Laslett and Canbäck, 2008). Evolutionary Genetics Analysis (MEGA6, Minimum Evolution. 결과및고찰 Crangon hakodatei 의전장미토콘드리아게놈 Crangon hakodatei. C. hakodatei 16,060 bps (GenBank Accession Number, KU641481) 13, 22 trna 2 rrna (Fig. 1, Table 2). 9 (atp6, atp8, cox1, cox2, cox3, cob, nad2, nad3 nad6) H 4 (nad1, nad4, nad4l nad5) L (Table 2). ACG COI ATN Nad4 Cytb (Table 2). COXI COXII 11 7 bp (Cook, 2005; Yamauchi et al., 2003). C. hakodatei LrRNA SrRNA 1297 bp 853 bp. LrRNA trna Leu trna- Val, SrRNA trna Val (control region). C. hakodatei A/T (85.1 %) Table 2. Location of genes in the mitochondrial genome of the Crangon hakodatei Featrures (anticodon) Start Stop Str. L nt In./term. L aa COI ACG/TA- 511 trnl1 (taa) CO ATG/TAA 228 trnk (ttt) trnd (gtc) Atp ATC/TAG 52 Atp ATG/TAA 225 CO ATG/TAA 262 trng (tcc) Nad ATG/TAG 117 trna (tgc) trnr (tcg) trnn (gtt) trns1 (tct) trne (ttc) trnf (gaa) Nad ATG/TAA 574 trnh (gtg) Nad ATG/ Nad4L ATG/TAA 99 trnt (tgt) trnp (tgg) Nad ATC/TAA 171 Cyt b ATG/ trns2 (tga) Nad ATA/TAA 319 trnl2 (tag) rrnl trnv (tac) rrns CR(non-coding) trni (gat) trnq (ttg) trnm (cat) Nad ATT/TAA 333 trnw (tca) trnc (gca) trny (gta) ,138 bp. trna 63 70

4 870 김경률ㆍ김현우 Fig. 1. The Map of Crangon hakodatei mitochondrial genome. Genes encoded by the heavy strand were shown outside the circle, and encoded by the light strand were shown inside the circle respectively. The gray arrow indicate the direction of transcription for the two DNA strands. The inner circle denotes the GC content of this genome. The map of complete mitochondria genome was drawn using OGDRAW (Lohse et al., 2013). (Table 2). 20 trna trnascan-se (Lowe and Eddy, 1997) ARWEN ARWEN (Laslett and Canback, 2008) 2. trna Ser (AGN) D arm (Wolstenholme, 1992) T arm trna Cys 2 C. hakodatei (Fig. 2). (Malacostraca) (Abascal et al., 2006). (Abascal et al., 2006), C. hakodatei (Fig. 3). World Class of Marine Species (WoRMS;

5 마루자주새우의전장미토콘드리아게놈 871 Fig. 2. Predicted secondary structure of 22 trnas of the Crangon hakodatei mitochondrial genome. The trnas are labeled with the three letters of abbreviations for each corresponding amino acids. GenBank. (Fig. 3)., trna Pro trna Thr (Fig. 3). 미토콘드리아게놈을통한 Crangon hakodatei 의분자계통학적분석 C. hakodatei %, (superfamily Bresilioidea) Opaepele loihi.. COI (Folmer et al., 1994), C.hakodatei Crangon crangon 94% (Fig. 4A). COXI, C. hakodatei

6 872 김경률ㆍ김현우 Fig. 3. Gene orders of mitochondrial genomes from Decapoda. All genes are transcribed from left to right except for those underlined to indicate opposite orientation. trna genes are designed by the corresponding single-letter amino acid code. Red colars indicate genes that are located differently from their positions in Crangon hakodatei mitochondrial genome. (A) (B) Fig. 4. Phylogenetic trees of mitochondrial COXI genes (A) and COI regions (B) from shrimps belonging to Caridea with other decapod crustaceans. Molecular Evolutionary Genetics Analysis ver. 6.0 (MEGA6) program was used for constructing phylogenetic tree with the minimum evolution algorithm. The evolutionary distances were computed using the Kimura 2-parameter method

7 마루자주새우의전장미토콘드리아게놈 873 (Fig. 4B). (Bracken et al., 2009; Lin et al., 2012; Shen et al., 2013; Shen et al., 2015). (Penaeoidea) (Liu and Cui, 2011). PCR NGS C. hakodatei.. 사사 (2015 ) References Abascal F, Posada D, Knight RD and Zardoya R Parallel evolution of the genetic code in arthropod mitochondrial genomes. PLoS Biol 4, e Bracken HD, De Grave S and Felder DL Decapod Crustacean Phylogenetics. In: Phylogeny of the infraorder Caridea based on mitochondrial and nuclear genes (Crustacea: Decapoda). CRC press, NewYork, U.S.A., Cha H, Lee J, Park C, Baik C, Hong S, Park J, Lee D, Choi Y, Hwang K and Kim Z Shrimps of the Korean waters. National Fisheries Research and Development Institute, Busan, Korea, Cook CE The complete mitochondrial genome of the stomatopod crustacean Squilla mantis. BMC Genomics 6, Folmer O, Black M, Hoeh W, Lutz R and Vrijenhoek R DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Biotechnol 3, Han Q and Li X Review of the ecology of Crangon hakodatei Rathbun, 1902 in the Yellow Sea and Bohai Gulf. Crustaceana 88, Hayashi KI and Kim JN Revision of the East Asian species of Crangon (Decapoda: Caridea: Crangonidae). Crustacean Res 28, Lang BF and Burger G Purification of mitochondrial and plastid DNA. Nature Protocols 2, org/ /nprot Laslett D and Canbäck B ARWEN: a program to detect trna genes in metazoan mitochondrial nucleotide sequences. Bioinformatics 24, Lin FJ, Liu Y, Sha Z, Tsang LM, Chu KH, Chan TY, Liu R and Cui Z Evolution and phylogeny of the mud shrimps (Crustacea: Decapoda) revealed from complete mitochondrial genomes. BMC genomics 13, org/ / Liu Y and Cui Z Complete mitochondrial genome of the Chinese spiny lobster Panulirus stimpsoni (Crustacea: Decapoda): genome characterization and phylogenetic considerations. Mol Biol Rep 38, org/ /s Lohse M, Drechsel O, Kahlau S and Bock R Organellar Genome DRAW--a suite of tools for generating physical maps of plastid and mitochondrial genomes and visualizing expression data sets. Nucleic Acids Res 41, W Lowe JB and Ward PA Therapeutic inhibition of carbohydrate-protein interactions in vivo. J Clin Invest 100, S Lowe TM and Eddy SR trnascan-se: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res 25, Ma H, Ma C, Li C, Lu J, Zou X, Gong Y, Wang W, Chen W, Ma L and Xia L First mitochondrial genome for the red crab (Charybdis feriata) with implication of phylogenomics and population genetics. Sci Rep 5, org/ /srep Maher I, Song KJ, Park HM and Oh CW Feeding ecology of the sand shrimp Crangon hakodatei Rathbun, 1902 (Decapoda: Crangonidae) in the East Sea of Korea. Animal Cells Systems 17, Matzen da Silva J, Creer S, dos Santos A, Costa AC, Cunha MR, Costa FO and Carvalho GR Systematic and evolutionary insights derived from mtdna COI barcode diversity in the Decapoda (Crustacea: Malacostraca). PLoS ONE 6, e Shen H, Braband A and Scholtz G Mitogenomic analysis of decapod crustacean phylogeny corroborates traditional views on their relationships. Mol Phylogenet Evol 66, Shen X, Tian M, Yan B and Chu K Phylomitogenomics of Malacostraca (Arthropoda: Crustacea). Acta Oceanologica Sinica 34, htt://dx.doi.org/ /s Williams S, Foster P and Littlewood D The complete mitochondrial genome of a turbinid vetigastropod from MiSeq Illumina sequencing of genomic DNA and steps towards a resolved gastropod phylogeny. Gene 533, dx.doi.org/ /j.gene Yamauchi M, Miya M and Nishida M Complete mito-

8 874 김경률ㆍ김현우 chondrial DNA sequence of the Japanese spiny lobster, Panulirus japonicus (Crustacea: Decapoda). Gene 295, Yamauchi MM, Miya MU and Nishida M Complete mitochondrial DNA sequence of the swimming crab, Portunus trituberculatus (Crustacea: Decapoda: Brachyura). Gene 311, Zhou X, Li Y, Liu S, Yang Q, Su X, Zhou L, Tang M, Fu R, Li J and Huang Q Ultra-deep sequencing enables highfidelity recovery of biodiversity for bulk arthropod samples without PCR amplification. Gigascience 2, 4. org/ / x-2-4.

ƯÇãû

ƯÇãû '' - 1 - - 2 - - 3 - - 4 - - 5 - ' - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - Super-Bio Co., Ltd. KWON, Suk-Tae Thermostable DNA Polymerase-encoding Gene from Thermus sp. X-1 an d Amino Acid Sequence

More information

Technical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Len

Technical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Len Technical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Length Sequencing (Primer walking) 길이가긴 insert 를포함한 plasmid

More information

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770> Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

2 : (JEM) QTBT (Yong-Uk Yoon et al.: A Fast Decision Method of Quadtree plus Binary Tree (QTBT) Depth in JEM) (Special Paper) 22 5, (JBE Vol. 2

2 : (JEM) QTBT (Yong-Uk Yoon et al.: A Fast Decision Method of Quadtree plus Binary Tree (QTBT) Depth in JEM) (Special Paper) 22 5, (JBE Vol. 2 (Special Paper) 22 5, 2017 9 (JBE Vol. 22, No. 5, Sepember 2017) https://doi.org/10.5909/jbe.2017.22.5.541 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) (JEM) a), a), a) A Fast Decision Method of Quadtree

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4) THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method

More information

<31325FB1E8B0E6BCBA2E687770>

<31325FB1E8B0E6BCBA2E687770> 88 / 한국전산유체공학회지 제15권, 제1호, pp.88-94, 2010. 3 관내 유동 해석을 위한 웹기반 자바 프로그램 개발 김 경 성, 1 박 종 천 *2 DEVELOPMENT OF WEB-BASED JAVA PROGRAM FOR NUMERICAL ANALYSIS OF PIPE FLOW K.S. Kim 1 and J.C. Park *2 In general,

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

인문사회과학기술융합학회

인문사회과학기술융합학회 Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun

More information

F. Sequencing FSequencing 01. Sequencing Service DNA sequencing Phone: (ext.4 4)

F. Sequencing FSequencing 01. Sequencing Service DNA sequencing Phone: (ext.4 4) FSequencing 01. DNA sequencing Phone: 1588-9788 (ext.4 4) E-mail: sequencing@bioneer.co.kr 01. 242 FAQs 247 개요 상세 설명 바이오니아는 국내 최초로 를 시작하였으며, 매년 개선된 high-throughput sequencing service를 제공하고 있습니다. Plasmid

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 901 무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 (A Effective Sinkhole Attack Detection Mechanism for LQI based Routing in WSN) 최병구 조응준 (Byung

More information

09권오설_ok.hwp

09권오설_ok.hwp (JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis

More information

(

( 317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,

More information

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*

More information

(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016) ISSN 228

(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016)   ISSN 228 (JBE Vol. 1, No. 1, January 016) (Regular Paper) 1 1, 016 1 (JBE Vol. 1, No. 1, January 016) http://dx.doi.org/10.5909/jbe.016.1.1.60 ISSN 87-9137 (Online) ISSN 16-7953 (Print) a), a) An Efficient Method

More information

Chapter 26

Chapter 26 11 주 RNA 합성 11.1 DNA-dependent synthesis of RNA: Bacteria에서의 transcription l RNA polymerase (5 subunits로구성 : 2α, β, β, σ) l 효소에의한 RNA 합성의특징 - Complementary sequence to template DNA - RNA chain의합성방향 : 5

More information

대한한의학원전학회지24권6호-전체최종.hwp

대한한의학원전학회지24권6호-전체최종.hwp 小兒藥證直訣 의 五臟辨證에 대한 小考 - 病證과 處方을 중심으로 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 ㆍ 韓醫學古典硏究所 白裕相1,2*1)2) A study on The Diagnosis and Treatment Using The Theory of Five Organs in Soayakjeungjikgyeol(小兒藥證直訣) 1 Dept. of Oriental

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: * The

Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI:   * The Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.243-268 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.243 * - 2001 2015 - The Research Trends on Peer Counseling in Elementary and

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   * A Research Trend Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities

More information

뉴스레터6호F?2??訝

뉴스레터6호F?2??訝 February 2009 No.06 Roche Diagnostics Korea Co., Ltd. Focus Tech EDITORIAL February 2009 No.06 Contents Editorial 03 Focus 04 Product 10 Talk 12 Tech 14 Activity 19 Style 22 February 2009 No.06 02 03 FOCUS

More information

歯kjmh2004v13n1.PDF

歯kjmh2004v13n1.PDF 13 1 ( 24 ) 2004 6 Korean J Med Hist 13 1 19 Jun 2004 ISSN 1225 505X 1) * * 1 ( ) 2) 3) 4) * 1) ( ) 3 2) 7 1 3) 2 1 13 1 ( 24 ) 2004 6 5) ( ) ( ) 2 1 ( ) 2 3 2 4) ( ) 6 7 5) - 2003 23 144-166 2 2 1) 6)

More information

14.531~539(08-037).fm

14.531~539(08-037).fm G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social

More information

저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,

More information

<BFA9BAD02DB0A1BBF3B1A4B0ED28C0CCBCF6B9FC2920B3BBC1F62E706466>

<BFA9BAD02DB0A1BBF3B1A4B0ED28C0CCBCF6B9FC2920B3BBC1F62E706466> 001 002 003 004 005 006 008 009 010 011 2010 013 I II III 014 IV V 2010 015 016 017 018 I. 019 020 021 022 023 024 025 026 027 028 029 030 031 032 033 034 035 036 037 038 039 040 III. 041 042 III. 043

More information

Analysis of teacher s perception and organization on physical education elective courses Chang-Wan Yu* Korea Institute of curriculum and evaluation [Purpose] [Methods] [Results] [Conclusions] Key words:

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con

Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI:   (NCS) Method of Con Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency

More information

IKC43_06.hwp

IKC43_06.hwp 2), * 2004 BK21. ** 156,..,. 1) (1909) 57, (1915) 106, ( ) (1931) 213. 1983 2), 1996. 3). 4) 1),. (,,, 1983, 7 12 ). 2),. 3),, 33,, 1999, 185 224. 4), (,, 187 188 ). 157 5) ( ) 59 2 3., 1990. 6) 7),.,.

More information

12È«±â¼±¿Ü339~370

12È«±â¼±¿Ü339~370 http://www.kbc.go.kr/ k Si 2 i= 1 Abstract A Study on Establishment of Fair Trade Order in Terrestrial Broadcasting Ki - Sun Hong (Professor, Dept. of Journalism & Mass Communication,

More information

182 동북아역사논총 42호 금융정책이 조선에 어떤 영향을 미쳤는지를 살펴보고자 한다. 일제 대외금융 정책의 기본원칙은 각 식민지와 점령지마다 별도의 발권은행을 수립하여 일본 은행권이 아닌 각 지역 통화를 발행케 한 점에 있다. 이들 통화는 일본은행권 과 等 價 로 연

182 동북아역사논총 42호 금융정책이 조선에 어떤 영향을 미쳤는지를 살펴보고자 한다. 일제 대외금융 정책의 기본원칙은 각 식민지와 점령지마다 별도의 발권은행을 수립하여 일본 은행권이 아닌 각 지역 통화를 발행케 한 점에 있다. 이들 통화는 일본은행권 과 等 價 로 연 越 境 하는 화폐, 분열되는 제국 - 滿 洲 國 幣 의 조선 유입 실태를 중심으로 181 越 境 하는 화폐, 분열되는 제국 - 滿 洲 國 幣 의 조선 유입 실태를 중심으로 - 조명근 고려대학교 BK21+ 한국사학 미래인재 양성사업단 연구교수 Ⅰ. 머리말 근대 국민국가는 대내적으로는 특정하게 구획된 영토에 대한 배타적 지배와 대외적 자주성을 본질로 하는데, 그

More information

01-15(3)-12(최장경).fm

01-15(3)-12(최장경).fm Res. Plant Dis. 15(3) : 165-169 (2009) Research in Plant Disease The Korean Society of Plant Pathology GM s ü š w Cucumber mosaic virus v y 1 Á y Á»x 1 Á * w w, 1 w y w Comparative Analysis of Coat Protein

More information

example code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for

example code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for 2003 Development of the Software Generation Method using Model Driven Software Engineering Tool,,,,, Hoon-Seon Chang, Jae-Cheon Jung, Jae-Hack Kim Hee-Hwan Han, Do-Yeon Kim, Young-Woo Chang Wang Sik, Moon

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic

More information

<5B313132385D32303039B3E220C1A634B1C720C1A632C8A320B3EDB9AEC1F628C3D6C1BE292E687770>

<5B313132385D32303039B3E220C1A634B1C720C1A632C8A320B3EDB9AEC1F628C3D6C1BE292E687770> 디지털 영상에서의 자막추출을 이용한 자막 특성 분석에 관한 연구 이세열 * 요약 본 연구는 방송 프로그램 제작에 있어서 중요한 역할을 담당하고 있는 영상 자막의 특성과 영상 커 뮤니케이션 기능적인 관점에서 나타나고 있는 현상을 살펴본다. 다양한 방송 프로그램에서 활용되고 있는 디지털 영상 자막의 기능은 단순하게 간략한 정보를 전달하는 기능적인 역할을 수행하였다.

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)

More information

45-51 ¹Ú¼ø¸¸

45-51 ¹Ú¼ø¸¸ A Study on the Automation of Classification of Volume Reconstruction for CT Images S.M. Park 1, I.S. Hong 2, D.S. Kim 1, D.Y. Kim 1 1 Dept. of Biomedical Engineering, Yonsei University, 2 Dept. of Radiology,

More information

Journal of Educational Innovation Research 2016, Vol. 26, No. 2, pp DOI: * Experiences of Af

Journal of Educational Innovation Research 2016, Vol. 26, No. 2, pp DOI:   * Experiences of Af Journal of Educational Innovation Research 2016, Vol. 26, No. 2, pp.201-229 DOI: http://dx.doi.org/10.21024/pnuedi.26.2.201608.201 * Experiences of After-school Class Caring by Married Early Childhood

More information

step 1-1

step 1-1 Written by Dr. In Ku Kim-Marshall STEP BY STEP Korean 1 through 15 Action Verbs Table of Contents Unit 1 The Korean Alphabet, hangeul Unit 2 Korean Sentences with 15 Action Verbs Introduction Review Exercises

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol

More information

공급 에는 3권역 내에 준공된 프라임 오피스가 없었다. 4분기에는 3개동의 프라임 오피스가 신규로 준공 될 예정이다.(사옥1개동, 임대용 오피스 2개동) 수요와 공실률 2014년 10월 한국은행이 발표한 자료에 따르면 한국의 2014년 경제성장률 예측치는 3.5%로 지

공급 에는 3권역 내에 준공된 프라임 오피스가 없었다. 4분기에는 3개동의 프라임 오피스가 신규로 준공 될 예정이다.(사옥1개동, 임대용 오피스 2개동) 수요와 공실률 2014년 10월 한국은행이 발표한 자료에 따르면 한국의 2014년 경제성장률 예측치는 3.5%로 지 Savills World Research 브리핑 서울 프라임 오피스 사진 : Yeouido, Seoul 개요 삼성SDS가 지난 2분기 준공한 잠실 사옥 주변으로의 이전을 지속하고 증권업계의 임차면적 감소가 계속되어 GBD와 YBD 의 수요는 감소하였고 에서는 소폭의 수요 증가가 나타났다. 의 수요 회복에도 불구하고 GBD, YBD의 수요 감소로 서울프라임오피스의

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 16 Jul.; 27(7), 64662. http://dx.doi.org/./kjkiees.16.27.7.646 ISSN 1226-3133 (Print)ISSN 2288-226 (Online) 2D Microwave Image

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI:   : Researc Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education

More information

135 Jeong Ji-yeon 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 머리말 협저불상( 夾 紵 佛 像 )이라는 것은 불상을 제작하는 기법의 하나로써 삼베( 麻 ), 모시( 苧 ), 갈포( 葛 ) 등의 인피섬유( 靭 皮 纖 維 )와 칠( 漆 )을 주된 재료

135 Jeong Ji-yeon 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 머리말 협저불상( 夾 紵 佛 像 )이라는 것은 불상을 제작하는 기법의 하나로써 삼베( 麻 ), 모시( 苧 ), 갈포( 葛 ) 등의 인피섬유( 靭 皮 纖 維 )와 칠( 漆 )을 주된 재료 MUNHWAJAE Korean Journal of Cultural Heritage Studies Vol. 47. No. 1, March 2014, pp.134~151. Copyright 2014, National Research Institute of Cultural Heritage 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 정지연 a 明 珍 素 也

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Original Article Journal of Apiculture 32(2) : 119~131 (217) DOI: 1.17519/apiculture.217.6.32.2.119 Development of Rapid Detection System for Small Hive Beetle (Aethina tumida) by using Ultra-Rapid PCR

More information

A Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran

More information

13장문현(541~556)ok

13장문현(541~556)ok A Study on the Spatial Distribution of Local Foods and Regional Products in the Seomjin River Area* Jeong-ok Kim**Mal-shick Shin***Jeong-rock Lee****Mun-hyun Jang*****,,,,,,,,,. 36, 15, 14, 5, 19. 32,

More information

歯1.PDF

歯1.PDF 200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)

More information

- 2 -

- 2 - - 2 - - 3 - - 4 - ➀ - 5 - - 6 - α - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - μ - 21 - ➀ - 22 - - 23 - - 24 - α - 25 - - 26 - - 27 - μ - 28 - μ μ - 29

More information

<32382DC3BBB0A2C0E5BED6C0DA2E687770>

<32382DC3BBB0A2C0E5BED6C0DA2E687770> 논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학

More information

02양은용

02양은용 The filial piety of Won-Buddhism in the tradition of filial piety Yang, Eun-Yong Dept. of Korean Culture, Wonkwang University Keyword : Filial piety, Fourfold Grace, the grace of parents, Xiao Jing (),

More information

한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26

한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26 2015 한국전지학회 춘계학술대회 2일차 한국전지학회 춘계 학술대회(신소재 및 시장동향 관련 주제 발표) 시간 제목 비고 세션 1 차세대 이차전지용 in-situ 분석기술 좌장 : 윤성훈 09:00~09:30 Real-time & Quantitative Analysis of Li-air Battery Materials by In-situ DEMS 김동욱(한국화학연구원)

More information

06_ÀÌÀçÈÆ¿Ü0926

06_ÀÌÀçÈÆ¿Ü0926 182 183 184 / 1) IT 2) 3) IT Video Cassette Recorder VCR Personal Video Recorder PVR VCR 4) 185 5) 6) 7) Cloud Computing 8) 186 VCR P P Torrent 9) avi wmv 10) VCR 187 VCR 11) 12) VCR 13) 14) 188 VTR %

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Feb.; 29(2), 93 98. http://dx.doi.org/10.5515/kjkiees.2018.29.2.93 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) UHF-HF

More information

` Companies need to play various roles as the network of supply chain gradually expands. Companies are required to form a supply chain with outsourcing or partnerships since a company can not

More information

232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특

232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특 한국도시행정학회 도시행정학보 제25집 제4호 2012. 12 : pp.231~251 생활지향형 요소의 근린주거공간 분포특성 연구: 경기도 시 군을 중심으로* Spatial Distribution of Daily Life-Oriented Features in the Neighborhood: Focused on Municipalities of Gyeonggi Province

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Sep.; 30(9), 712 717. http://dx.doi.org/10.5515/kjkiees.2019.30.9.712 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) MOS

More information

<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>

<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770> J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2

More information

07_Àü¼ºÅÂ_0922

07_Àü¼ºÅÂ_0922 176 177 1) 178 2) 3) 179 4) 180 5) 6) 7) 8) 9) 10) 181 11) 12) 182 13) 14) 15) 183 16) 184 185 186 17) 18) 19) 20) 21) 187 22) 23) 24) 25) 188 26) 27) 189 28) 29) 30)31) 32) 190 33) 34) 35) 36) 191 37)

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jun.; 27(6),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jun.; 27(6), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Jun.; 27(6), 495 503. http://dx.doi.org/10.5515/kjkiees.2016.27.6.495 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Design

More information

jaeryomading review.pdf

jaeryomading review.pdf 4 5 6 7 8 9 10 11 12 13 1. S. Kim, H. Y. Jeong, S. K. Kim, S. Y. Choi and K. J. Lee, Nano Lett. 11, 5438 (2011). 2. E. Menard, K. J. Lee, D. Y. Khang, R. G. Nuzzo and J. A. Rogers, Appl. Phys. Lett. 84,

More information

Stage 2 First Phonics

Stage 2 First Phonics ORT Stage 2 First Phonics The Big Egg What could the big egg be? What are the characters doing? What do you think the story will be about? (큰 달걀은 무엇일까요? 등장인물들은 지금 무엇을 하고 있는 걸까요? 책은 어떤 내용일 것 같나요?) 대해 칭찬해

More information

Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI: * Suggestions of Ways

Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI:   * Suggestions of Ways Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp.65-89 DOI: http://dx.doi.org/10.21024/pnuedi.29.1.201903.65 * Suggestions of Ways to Improve Teaching Practicum Based on the Experiences

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   3 * The Effect of H Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales

More information

- 2 -

- 2 - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 - - 27 - - 28 - - 29 - - 30 -

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp DOI: * A Study on Teache

Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp DOI:   * A Study on Teache Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp.149-171 DOI: http://dx.doi.org/10.21024/pnuedi.27.4.201712.149 * A Study on Teachers and Parents Perceptions on the Introduction of Innovational

More information

10(3)-09.fm

10(3)-09.fm w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½

More information

(5차 편집).hwp

(5차 편집).hwp (215), 54(1), 17-3 211 STEAM,.. STEAM, STEAM, 5~6 11.,., 5~6...,. (, 21)., 29. (,, 212). 211 STEAM * :, E-mail: njkwon@hanmail.net http://dx.doi.org/1.15812/ter.54.1.2153.17 (215), 54(1), 17-3,. (Arts)

More information

04_이근원_21~27.hwp

04_이근원_21~27.hwp 1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일

More information

mau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions

More information

49-9분동안 표지 3.3

49-9분동안 표지 3.3 In the ocean, humans create many noises. These noises disturb the waters. People do not know that manmade sound harms the creatures living in the sea. In the end, disturbing the ocean affects each one

More information

세종대 요람

세종대 요람 Sejong University 2016 2016 Sejong University 4 SEJONG UNIVERSITY www.sejong.ac.kr 5 8 SEJONG UNIVERSITY 2016 Sejong University 10 SEJONG UNIVERSITY www.sejong.ac.kr 11 12 SEJONG UNIVERSITY www.sejong.ac.kr

More information

- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α

More information

433대지05박창용

433대지05박창용 Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This

More information

<B1A4B0EDC8ABBAB8C7D0BAB8392D345F33C2F75F313032362E687770>

<B1A4B0EDC8ABBAB8C7D0BAB8392D345F33C2F75F313032362E687770> 광고에 나타난 가족가치관의 변화 : 97년부터 26년까지의 텔레비전 광고 내용분석* 2) 정기현 한신대학교 광고홍보학과 교수 가족주의적 가치관을 사회통합의 핵심 중의 핵심으로 올려놓았던 전통이 현대사회에서 아직 영향력을 미치는 점을 감안할 때, 한국에서의 가족변동은 사회전반의 변동으로 직결된다고 해도 크게 틀리지 않을 것이다. 97년부터 26년까지 텔레비전에서

More information

09-감마선(dh)

09-감마선(dh) Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected

More information

<313120B9DABFB5B1B82E687770>

<313120B9DABFB5B1B82E687770> 한국민족문화 40, 2011. 7, 347~388쪽 1)중화학공업화선언과 1973년 공업교육제도 변화* 2)박 영 구** 1. 머리말 2. 1973년, 중화학공업화선언과 과학기술인력의 부족 3. 1973년 전반기의 교육제도 개편과 정비 1) 계획과 개편 2) 기술교육 개선안과 인력개발 시책 4. 1973년 후반기의 개편과 정비 5. 정비된 정규교육제도의 특징

More information

09È«¼®¿µ 5~152s

09È«¼®¿µ5~152s Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,

More information

Output file

Output file 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 An Application for Calculation and Visualization of Narrative Relevance of Films Using Keyword Tags Choi Jin-Won (KAIST) Film making

More information

<313630313032C6AFC1FD28B1C7C7F5C1DF292E687770>

<313630313032C6AFC1FD28B1C7C7F5C1DF292E687770> 양성자가속기연구센터 양성자가속기 개발 및 운영현황 DOI: 10.3938/PhiT.25.001 권혁중 김한성 Development and Operational Status of the Proton Linear Accelerator at the KOMAC Hyeok-Jung KWON and Han-Sung KIM A 100-MeV proton linear accelerator

More information

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 김진주 김수연. 초등학생대상장애이해교육에활용된동화에나타난장애인관분석. 특수교육, 2013, 제12권, 제2호, 135-160... 20.,,. 4.,,.,..... 주제어 : 장애이해교육, 동화, 장애인관 1. ( 1 ) Incheon Munhak Elementary School ( )(, E-mail: sooyoun@ginue.ac.kr) Dept. of

More information

04김호걸(39~50)ok

04김호걸(39~50)ok Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*

More information

Microsoft Word - eco1201.doc

Microsoft Word - eco1201.doc 분지론의 과거, 현재, 미래 Past, present and future of the Cladistics 최 세 웅 목포대학교 환경교육학과 1. 서론 2. 본론 2-1. 과거 - 계통학의 역사 및 분지론의 탄생 2-2. 현재 - 분지론 2-3. 미래 및 결론 3. 참고문헌 1 1. 서론 우리나라에서는 매년 여름 비무장지대를 중심으로 말라리아가 말썽을

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 25(3),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 25(3), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2014 Mar.; 25(3), 304310. http://dx.doi.org/10.5515/kjkiees.2014.25.3.304 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

Chapter 6. Nucleotides and Nucleic Acids 세포대사에서뉴클레오타이드 (nucleotide) 의기능은무엇인가? Objective 유전체학 (genomics) 과단백체학 (proteomics) 기본개념이해 재조합 DNA 기술 (recombin

Chapter 6. Nucleotides and Nucleic Acids 세포대사에서뉴클레오타이드 (nucleotide) 의기능은무엇인가? Objective 유전체학 (genomics) 과단백체학 (proteomics) 기본개념이해 재조합 DNA 기술 (recombin Chapter 6. Nucleotides and Nucleic Acids 세포대사에서뉴클레오타이드 (nucleotide) 의기능은무엇인가? Objective 유전체학 (genomics) 과단백체학 (proteomics) 기본개념이해 재조합 DNA 기술 (recombinant DNA technology) 란? - 효소의보조인자, 대사중간산물구성성분, 유전정보함유등

More information

08김현휘_ok.hwp

08김현휘_ok.hwp (Regular Paper) 21 3, 2016 5 (JBE Vol. 21, No. 3, May 2016) http://dx.doi.org/10.5909/jbe.2016.21.3.369 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a), a) An Audio Coding Technique Employing the Inter-channel

More information

216 동북아역사논총 41호 인과 경계공간은 설 자리를 잃고 배제되고 말았다. 본고에서는 근세 대마도에 대한 한국과 일본의 인식을 주로 영토와 경계인 식을 중심으로 고찰하고자 한다. 이 시기 대마도에 대한 한일 양국의 인식을 살펴볼 때는 근대 국민국가적 관점에서 탈피할

216 동북아역사논총 41호 인과 경계공간은 설 자리를 잃고 배제되고 말았다. 본고에서는 근세 대마도에 대한 한국과 일본의 인식을 주로 영토와 경계인 식을 중심으로 고찰하고자 한다. 이 시기 대마도에 대한 한일 양국의 인식을 살펴볼 때는 근대 국민국가적 관점에서 탈피할 전근대시기 한국과 일본의 대마도 인식 215 전근대시기 한국과 일본의 대마도 인식 하우봉 전북대학교 사학과 교수 Ⅰ. 머리말 브루스 배튼(Bruce Batten)의 정의에 따르면 전근대의 국경에는 국경선으로 이루어진 boundary가 있고, 공간으로 이루어진 frontier란 개념이 있다. 전자 는 구심적이며 내와 외를 격리시키는 기능을 지니고, 후자는 원심적이며

More information

- 2 -

- 2 - - 2 - α - 3 - - 4 - α - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - 번호 유효성분 차나무오일 코퍼설페이트펜타하이드레이트 폴리옥신디 - 12 - - 13 - μ - 14 - α m α α μ - 15 - μ μ - 16 - m μ - 17 - - 18 - - 19 - μ - 20 - μ μ μ - 21 - -

More information