한수지 49(6), , 2016 Note Korean J Fish Aquat Sci 49(6), ,2016 마루자주새우 [Crangon hakodatei (Rathbun, 1902)] 의전장미토콘드리아유전체에대한분석연구 김경률 1 김현우 1,2

Size: px

Start display at page:

Download "한수지 49(6), , 2016 Note Korean J Fish Aquat Sci 49(6), ,2016 마루자주새우 [Crangon hakodatei (Rathbun, 1902)] 의전장미토콘드리아유전체에대한분석연구 김경률 1 김현우 1,2"

진운 채
5 years ago
Views:

1 한수지 49(6), , 2016 Note Korean J Fish Aquat Sci 49(6), ,2016 마루자주새우 [Crangon hakodatei (Rathbun, 1902)] 의전장미토콘드리아유전체에대한분석연구 김경률 1 김현우 1,2 * 1 부경대학교의생명기계전기융합공학협동과정, 2 부경대학교자원생물학과 Complete Mitochondrial Genome of Crangon hakodatei (Rathbun, 1902) (Crustacea: Decapoda: Crangonidae) Gyungryul Kim 1 and Hyun-Woo Kim 1,2 * 1 Interdisciplinary Program of Biomedical, Mechanical and Electrical Engineering, Pukyong National University, Busan 48513, Korea 2 Department of Marine Biology, Pukyong National University, Busan 48513, Korea Although shrimps belonging to family Crangonidae are known to be genetically divergent and ecologically important among the various benthos, any of their mitochondrial genome has not been reported yet. We here determined the complete mitochondrial genome sequence of Crangon hakodatei (Rathbun, 1902), which was collected from East China Sea (124 E and 34.5 N). Total mitochondrial genome length of C. hakodatei was 16,060 bp, in which 13 proteins, 2 ribosomal RNAs, 22 transfer RNAs and a putative control region were encoded. Secondary structure prediction analysis showed that twenty trna genes exhibit the conserved structure but two genes, trna Cys and trna Ser (AGN), lack T and D arm, respectively. Based on the sequence similarity of the COI region from the currently reported five species belonging to genus Crangonidae, C. hakodatei was most closely related to Crangon crangon. Phylogenetic analysis of full COXI genes belonging to infraorder Caridea showed that only crangonid shrimps were clustered together with those of Dendrobranchiata. Gene order were well conserved from Penaeoidea to Caridea but trna Pro and trna Thr in Palaemonid shrimp were flipped each other by the recombination. Further study about mitochondrial genome sequences of shrimps belonging to Crangonidae should be made to know better about their evolutional relationships with other those in infraorder Caridea. Key words: Crangonidae, Decapod crustacean, Barcode, Mitochondrial genome 서론 (Fabricius, 1798) 24 (Hayashi and Kim, 1999). (gastric spine), 3 (maxilliped) (arthrobranch), (pereopod) (merus) 1 (ventral spine) (Hayashi and Kim, 1999). [Crangon hakodatei (Rathbun, 1902)],,, 200 m (Cha et al., 2001; Han and Li, 2015; Hayashi and Kim, 1999). 3 5 (abdominal somites) (dorsomedial carina) (Han and Li, 2015; Maher et al., 2013). C. hakodatei (Han and Li, 2015). Korean J Fish Aquat Sci 49(6) , December 2016 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial Licens ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Received 8 December 2016; Accepted 19 December 2016 *Corresponding author: Tel: Fax: address: kimhw@pknu.ac.kr Copyright 2016 The Korean Society of Fisheries and Aquatic Science 867 pissn: , eissn:

2 868 김경률ㆍ김현우. cytochrome oxidase subunit I (COXI) COI DNA (Folmer et al., 1994), (Lang and Burger, 2007; Ma et al., 2015; Yamauchi et al., 2002). Sanger (Dideoxy termination reaction) (~15 kb), (NGS) (Williams et al., 2014; Zhou et al., 2013)., ,319 GenBank ( (Matzen da Silva et al., 2011),. PCR C. hakodatei. 샘플링및 DNA 추출 재료및방법 (124 DNA lva. 99% (SK, ) -20%. genomic DNA Tissue Lyser II (QIAGEN). genomic DNA AccuPrep Genomic DNA Extraction Kit (Bioneer, ). DNA -70. MiSeq 시스템을이용한전장미토콘드리아게놈분석 PCR, COXI b (cyt b) PCR. COXI LCO1490 HCO2198 (Folmer et al., 1994) cytb Crus-mt-F10 Crus-mt-R10 (Table 1). IDT SciTools Table 1. The primer sequences used in the study Name Crus-mt-F10 Crus-mt-R10 Crh-F1 Crh-R1 Crh-F2 Crh-R2 Crh-F3 Crh-R3 Crh-F41 Crh-R4 Crh-F5 Crh-R5 Crh-F6 Crh-F7 Crh-R7 M13-F M13-R Sequences (5' 3') GCWATACAYTAYACDGC TTRTTDGGRATDGAHCG CGCCCGCTAAACTAGAAGCAGAG CTCTGCTTCTAGTTTAGCGGGCG CCTCCTCTCTCAGCAGGAATTGCTCAC TAAAGAAGAATGAAGCGCCGTTGGC CTTAGAAATGAGAGCGACGGGCG AGTATGTACACATCGCCCGTCGC CGAACTATTCATGCCAACGGCGC AGCTCCTAGAATGGAAGATACACCAGC GTTAGTATAACCGCGGATGCTGGCAC CCTGCATTATGTTTTGGTGTAAAGGCACG GCTTCATGGTTTACGGCTTGACTTGG GCGACGGGCGATGTGTACATAC CAGGCCGACTACCATGTTCCATCTC GTAAAACGACGGCCAGT GCGGATAACAATTTCACACAGG ( (Macrogen, Korea). PCR Gel Extraction Kit (Bioneer, Daejeon, Korea) pgem-t Easy vector (Promega, Madison, WI). DH5d 37. M13 PCR PCR (Table 1). DNA. PCR (Yamauchi et al., 2002) Crh-F2 Crh-R2 Crh-F4 Crh-R4 PCR (Table 1). 2 PCR Covaris M220 (Covaris Inc, Woburn, MA, USA) 600 bp. TruSeq Sample Preparation V2, (Illumina, San Diego, USA). PCR, 2%. 500 bp 700 bp MiniElute PCR (Qiagen, Hilden, Germany). MiSeq System 염기서열조합및생물정보학적분석 MiSeq sequencer CLC Ge-

3 마루자주새우의전장미토콘드리아게놈 869 nomic Workbench v.8.0 (CLC Bio Aarhus, ) QV Mothur (v ) 7 bp. Geneious R8 (Biomatters, Auckland, New Zealand) 20 bp 100%. C. hakodatei PCR (Table 1) rrna mtdna. 22 trna trnascan-se (Lowe and Ward, 1997) ARWEN (Laslett and Canbäck, 2008). C. hakodatei Organellar Genome DRAW (Laslett and Canbäck, 2008). Evolutionary Genetics Analysis (MEGA6, Minimum Evolution. 결과및고찰 Crangon hakodatei 의전장미토콘드리아게놈 Crangon hakodatei. C. hakodatei 16,060 bps (GenBank Accession Number, KU641481) 13, 22 trna 2 rrna (Fig. 1, Table 2). 9 (atp6, atp8, cox1, cox2, cox3, cob, nad2, nad3 nad6) H 4 (nad1, nad4, nad4l nad5) L (Table 2). ACG COI ATN Nad4 Cytb (Table 2). COXI COXII 11 7 bp (Cook, 2005; Yamauchi et al., 2003). C. hakodatei LrRNA SrRNA 1297 bp 853 bp. LrRNA trna Leu trna- Val, SrRNA trna Val (control region). C. hakodatei A/T (85.1 %) Table 2. Location of genes in the mitochondrial genome of the Crangon hakodatei Featrures (anticodon) Start Stop Str. L nt In./term. L aa COI ACG/TA- 511 trnl1 (taa) CO ATG/TAA 228 trnk (ttt) trnd (gtc) Atp ATC/TAG 52 Atp ATG/TAA 225 CO ATG/TAA 262 trng (tcc) Nad ATG/TAG 117 trna (tgc) trnr (tcg) trnn (gtt) trns1 (tct) trne (ttc) trnf (gaa) Nad ATG/TAA 574 trnh (gtg) Nad ATG/ Nad4L ATG/TAA 99 trnt (tgt) trnp (tgg) Nad ATC/TAA 171 Cyt b ATG/ trns2 (tga) Nad ATA/TAA 319 trnl2 (tag) rrnl trnv (tac) rrns CR(non-coding) trni (gat) trnq (ttg) trnm (cat) Nad ATT/TAA 333 trnw (tca) trnc (gca) trny (gta) ,138 bp. trna 63 70

4 870 김경률ㆍ김현우 Fig. 1. The Map of Crangon hakodatei mitochondrial genome. Genes encoded by the heavy strand were shown outside the circle, and encoded by the light strand were shown inside the circle respectively. The gray arrow indicate the direction of transcription for the two DNA strands. The inner circle denotes the GC content of this genome. The map of complete mitochondria genome was drawn using OGDRAW (Lohse et al., 2013). (Table 2). 20 trna trnascan-se (Lowe and Eddy, 1997) ARWEN ARWEN (Laslett and Canback, 2008) 2. trna Ser (AGN) D arm (Wolstenholme, 1992) T arm trna Cys 2 C. hakodatei (Fig. 2). (Malacostraca) (Abascal et al., 2006). (Abascal et al., 2006), C. hakodatei (Fig. 3). World Class of Marine Species (WoRMS;

5 마루자주새우의전장미토콘드리아게놈 871 Fig. 2. Predicted secondary structure of 22 trnas of the Crangon hakodatei mitochondrial genome. The trnas are labeled with the three letters of abbreviations for each corresponding amino acids. GenBank. (Fig. 3)., trna Pro trna Thr (Fig. 3). 미토콘드리아게놈을통한 Crangon hakodatei 의분자계통학적분석 C. hakodatei %, (superfamily Bresilioidea) Opaepele loihi.. COI (Folmer et al., 1994), C.hakodatei Crangon crangon 94% (Fig. 4A). COXI, C. hakodatei

872 김경률ㆍ김현우 Fig. 3. Gene orders of mitochondrial genomes from Decapoda. All genes are transcribed from left to right except for those underlined to indicate opposite orientation.

Red colars indicate genes that are located differently from their positions in Crangon hakodatei mitochondrial genome. (A) (B) Fig. 4.

6 872 김경률ㆍ김현우 Fig. 3. Gene orders of mitochondrial genomes from Decapoda. All genes are transcribed from left to right except for those underlined to indicate opposite orientation. trna genes are designed by the corresponding single-letter amino acid code. Red colars indicate genes that are located differently from their positions in Crangon hakodatei mitochondrial genome. (A) (B) Fig. 4. Phylogenetic trees of mitochondrial COXI genes (A) and COI regions (B) from shrimps belonging to Caridea with other decapod crustaceans. Molecular Evolutionary Genetics Analysis ver. 6.0 (MEGA6) program was used for constructing phylogenetic tree with the minimum evolution algorithm. The evolutionary distances were computed using the Kimura 2-parameter method

7 마루자주새우의전장미토콘드리아게놈 873 (Fig. 4B). (Bracken et al., 2009; Lin et al., 2012; Shen et al., 2013; Shen et al., 2015). (Penaeoidea) (Liu and Cui, 2011). PCR NGS C. hakodatei.. 사사 (2015 ) References Abascal F, Posada D, Knight RD and Zardoya R Parallel evolution of the genetic code in arthropod mitochondrial genomes. PLoS Biol 4, e Bracken HD, De Grave S and Felder DL Decapod Crustacean Phylogenetics. In: Phylogeny of the infraorder Caridea based on mitochondrial and nuclear genes (Crustacea: Decapoda). CRC press, NewYork, U.S.A., Cha H, Lee J, Park C, Baik C, Hong S, Park J, Lee D, Choi Y, Hwang K and Kim Z Shrimps of the Korean waters. National Fisheries Research and Development Institute, Busan, Korea, Cook CE The complete mitochondrial genome of the stomatopod crustacean Squilla mantis. BMC Genomics 6, Folmer O, Black M, Hoeh W, Lutz R and Vrijenhoek R DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Biotechnol 3, Han Q and Li X Review of the ecology of Crangon hakodatei Rathbun, 1902 in the Yellow Sea and Bohai Gulf. Crustaceana 88, Hayashi KI and Kim JN Revision of the East Asian species of Crangon (Decapoda: Caridea: Crangonidae). Crustacean Res 28, Lang BF and Burger G Purification of mitochondrial and plastid DNA. Nature Protocols 2, org/ /nprot Laslett D and Canbäck B ARWEN: a program to detect trna genes in metazoan mitochondrial nucleotide sequences. Bioinformatics 24, Lin FJ, Liu Y, Sha Z, Tsang LM, Chu KH, Chan TY, Liu R and Cui Z Evolution and phylogeny of the mud shrimps (Crustacea: Decapoda) revealed from complete mitochondrial genomes. BMC genomics 13, org/ / Liu Y and Cui Z Complete mitochondrial genome of the Chinese spiny lobster Panulirus stimpsoni (Crustacea: Decapoda): genome characterization and phylogenetic considerations. Mol Biol Rep 38, org/ /s Lohse M, Drechsel O, Kahlau S and Bock R Organellar Genome DRAW--a suite of tools for generating physical maps of plastid and mitochondrial genomes and visualizing expression data sets. Nucleic Acids Res 41, W Lowe JB and Ward PA Therapeutic inhibition of carbohydrate-protein interactions in vivo. J Clin Invest 100, S Lowe TM and Eddy SR trnascan-se: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res 25, Ma H, Ma C, Li C, Lu J, Zou X, Gong Y, Wang W, Chen W, Ma L and Xia L First mitochondrial genome for the red crab (Charybdis feriata) with implication of phylogenomics and population genetics. Sci Rep 5, org/ /srep Maher I, Song KJ, Park HM and Oh CW Feeding ecology of the sand shrimp Crangon hakodatei Rathbun, 1902 (Decapoda: Crangonidae) in the East Sea of Korea. Animal Cells Systems 17, Matzen da Silva J, Creer S, dos Santos A, Costa AC, Cunha MR, Costa FO and Carvalho GR Systematic and evolutionary insights derived from mtdna COI barcode diversity in the Decapoda (Crustacea: Malacostraca). PLoS ONE 6, e Shen H, Braband A and Scholtz G Mitogenomic analysis of decapod crustacean phylogeny corroborates traditional views on their relationships. Mol Phylogenet Evol 66, Shen X, Tian M, Yan B and Chu K Phylomitogenomics of Malacostraca (Arthropoda: Crustacea). Acta Oceanologica Sinica 34, htt://dx.doi.org/ /s Williams S, Foster P and Littlewood D The complete mitochondrial genome of a turbinid vetigastropod from MiSeq Illumina sequencing of genomic DNA and steps towards a resolved gastropod phylogeny. Gene 533, dx.doi.org/ /j.gene Yamauchi M, Miya M and Nishida M Complete mito-

8 874 김경률ㆍ김현우 chondrial DNA sequence of the Japanese spiny lobster, Panulirus japonicus (Crustacea: Decapoda). Gene 295, Yamauchi MM, Miya MU and Nishida M Complete mitochondrial DNA sequence of the swimming crab, Portunus trituberculatus (Crustacea: Decapoda: Brachyura). Gene 311, Zhou X, Li Y, Liu S, Yang Q, Su X, Zhou L, Tang M, Fu R, Li J and Huang Q Ultra-deep sequencing enables highfidelity recovery of biodiversity for bulk arthropod samples without PCR amplification. Gigascience 2, 4. org/ / x-2-4.

Æ¯ÇãÃ»

Æ¯ÇãÃ» '' - 1 - - 2 - - 3 - - 4 - - 5 - ' - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - Super-Bio Co., Ltd. KWON, Suk-Tae Thermostable DNA Polymerase-encoding Gene from Thermus sp. X-1 an d Amino Acid Sequence