41(3)-7(p ).fm

Size: px

Start display at page:

Download "41(3)-7(p ).fm"

우빈 시
5 years ago
Views:

1 The Korean Journal of Microbiology, Vol. 41, No. 3, September 2005, p Copyrightc2005, The Microbiological Society of Korea Helicobacter pylori 감염의치료와 Clarithromycin 내성간의연관성 손승규 이종화 1 이정훈 이상희 * 명지대학교자연과학대학생명과학정보학부, 1 단국대학교의과대학소화기연구소 본연구를수행하기전에 H. pylori 에대한어떠한치료도받지않은 114 명의소화기궤양환자들을내시경검사를하는동안, 114 개의 H. pylori 균주를위전정부로부터분리하였다. H. pylori 를검출하기위하여 rapid urease test, SSA 와 caga 유전자의 PCR 증폭을수행하였고, CagA 발현검출을위하여 Western blot 을수행하였다. H. pylori 에감염된환자들은 omeprazole, clarithromycin (a macrolide), amoxicillin 을모두사용하는 3 제요법 (triple therapy) 으로치료하였다. 치료가중단되고 6 주후에내시경검사에서세균박멸률을측정하였다. 내성률은각각 clarithromycin 이 20.2%, amoxicillin 이 0.0% 였다. Clarithromycin 내성은 H. pylori 의 23S rrna 유전자에있는 A2142G 돌연변이에의한것이 87% 이었다. A2142G 돌연변이의 clarithromycin 의 MIC 값 (32~>256 µg/ml) 은 A2143G 돌연변이의 MIC 값 (4~128 µg/ml) 보다더높았다. Clarithromycin 에감수성을가진 H. pylori 는박멸되었으나 clarithromycin 내성을가진 H. pylori 는박멸되지않았다 (P = ). 이러한결과들은 CagA 발현에는어떠한영향도받지않았으며 H. pylori 의 clarithromycin 내성은치료실패의가장중요한이유임을제시하였다. 우선적으로실시되는생검배양에대한 H. pylori 의항생제감수성시험은감염된환자들에대한 3 제요법을선택하기이전에필히실시되어야하며국내에서 clarithromycin 에대한 1 차내성의높은빈도는 H. pylori 의감염증치료에심각한문제점을야기시켰다. Key words clarithromycin resistance, eradication rate, H. pylori, peptic ulcer, triple therapy 세계인구의 50% 가감염되어있는 Helicobacter pylori는위염, 위궤양, 십이지장궤양, 그리고위암발병에매우중요한요인이다 (9, 10, 21). 한국성인의약 60~70% 가 H. pylori에감염되어있다 (6). H. pylori 감염에대한최근의보고에의하면 (3), 기질성질환의소화기징후를갖는환자의임상적검사시에선호되는방법은생체조직검사를포함한위장의내시경검사이다. 위궤양또는십이지장궤양의환자및 H. pylori에감염된모든환자들에게항생제를투여하여 H. pylori를박멸 (eradication) 시켜서소화기궤양을치유하는것이재발을방지하기위한효과적인방법으로널리인정되었다 (3). H. pylori에감염된성인환자에게는 proton pump inhibitor (PPI, omeprazole) 와 amoxicillin(β-lactam antibiotic) 과 clarithromycin (macrolide antibiotic) 또는 metroni- dazole(5-nitroimidazole antibiotic) 을혼합한 3제요법 (triple therapy) 이추천되고있다 (5). Metronidazole 내성 (resistance) 은유럽에서 50% 이상으로높고, 박멸률 (eradication rate) 은 metroni- dazole에감수성인 H. pylori 보다 metronidazole에내성인 H. pylori에감염된성인환자에서더낮다 (1). 그리고 CagA (cytotoxin-associated gene) 를생성하는 H. pylori의존재는 H. pylori의박멸을어렵게한다 (12). 첫번째치료후에도박멸되지않고여전히감염되어잔존하는 H. pylori에대한적합한치료는배양및항생제감수성시험을병행하는내시경검사가추천되 *To whom correspondence should be addressed. Tel: (031) , Fax: (031) sangheelee@mju.ac.kr 고있다 (3). 새로운 clarithromycin에대한내성을가진 H. pylori 가어느정도로만연되어있고소화기궤양환자의치료를어느정도로어렵게하는지는불명확하지만 clarithromycin에대한내성을가진 H. pylori의만연도가 1.7% (17) 에서 23.4% (16) 로증가하고있다. 본연구는첫번째로, 치료전과후에, H. pylori에감염된소화기궤양환자들로부터분리한 H. pylori 균주에서 clarithromycin 내성의기전과이환율 (prevalence) 를분석하였다. 두번째로, 환자들에감염되어있는 H. pylori의박멸에미치는 clarithromycin 내성의영향과 H. pylori에감염된소화기궤양환자들에게적당한치료법을선택하기전에실시하는위생검배양 (gastric biopsy culture) 을이용한항생제감수성시험의유용성을재평가하였다. 모든환자들의 CagA 발현양상은 clarithromycin 내성만의효과를고찰하기위해서조사하였다. 재료및방법환자의선별 2000년 1월부터 2002년 3월까지단국대학교병원에서위장내시경검사를통해소화불량증상을겪고있는 114명의환자들을연구대상으로하였다. 모든환자들로부터동의를받았고, 환자들에대한세부적인사항은 Table 1과같다. 조직학적검사 (histology), rapid urease test(rut), H. pylori 의 26-kDa 세포표면항원 (SSA) 유전자의탐색, 그리고분리된 H. pylori의배양 177

2 178 Seung Ghyu Sohn et al. Kor. J. Microbiol Table 1. Details of 114 patients referred for endoscopy Characteristic a No. of patients Percentage of patients Age, years > Gender Male Female Indications for endoscopy Duodenal ulcer Gastric ulcer RUT 114 (positive) 100 PCR SSA 114 (positive) 100 caga 59 (positive) (negative) 48.2 a Abbreviations: RUT, rapid urease test for Helicobacter pylori detection; SSA, 26-kDa cell surface antigen gene of H. pylori; caga, cytotoxin-associated gene encoding the virulence factor of H. pylori. 을통해위또는십이지장에 H. pylori의감염여부를판단하였다. 모든환자는내시경검사를받았고생검 (biopsy) 을시료로이용하여 RUT (CLO test, Delta West Pty Ltd., Bentley, Western Australia, Australia), 조직학적검사및배양을실시하였다. 조직학적검사를위해, 생검조직을중성의포르말린 (fomalin) 에서고정시키고파라핀 (paraffin) 에담가놓았다. Giemsa (Giemsa concen- tration, Difco Laboratories, Detroit, Mi., USA) 와 hematoxylineosin으로염색하여 H. pylori를검출하였다. 환자의선별시제외기준은다음과같다. 18세이하와 90세이상의연령인환자 ; 본연구가시작된시기보다 8주전에 PPIs (omeprazole, lansoprazole, pantoprazole), H 2 -blockers (cimetidine, ranitidine, nizatidine, famotidine, roxatidine) 그리고항생제 (clarithromycin, metronidazole, amoxicillin) 로치료받은환자 ; 위장의악성종양인환자 ; 심각한다른질병을동반하는환자 ; 알러 지 (allergy) 의병력이있는환자 ; 위의외과수술을받은환자 ; 임신중이거나수유기 (lactation) 인환자 ; 알코올중독및약물중독인환자 ; corticosteroid 또는비스테로이드 (non-steroid) 계열의항염증제를상습적으로사용하는환자는실험대상에서제외하였다. 미생물학적연구방법내시경검사를하는동안생검조직으로부터 114개의 H. pylori를분리및배양하였다. 위전정부 (antrum) 의생검시료는선택배지 (Helicobacter selective agar plus 7% defibrinated horse blood, Becton Dickinson, Cockeysville, Md., USA) 에서배양되었다. 배양 plate는 100% 상대습도와 microaerobic 상태 (Campy Pak Plus, BBL, Becton Dickinson) 에서 37 o C 5~7일동안배양되었다. 분리된균주는 Brucella broth(difco Laboratories, Detroit, Mi., USA) 에배양하여 -70 o C에보관하였다. Amoxicillin(Sigma, St. Louis, Mo., USA) 과 clarithromycin(abbott Laboratories, Queensborough, UK) 의최소저해농도 (MIC) 측정은 E-test (AB Biodisk, Uppsala, Sweden) 에의해서이루어졌다. 현탁액은 McFarland no. 2의혼탁도 (turbidity) 가되게조정하였다. MIC 측정용 plate는 37 o C에서미호기성 (microaerobic) 상태로 72시간동안배양되었다. 분리된균주는 MIC값이 amoxicillin인경우는 0.5 µg/ml, clarithromycin인경우는 1.0 µg/ml 이상이면두항생제에대해서내성을가지는것으로판단하였다 (8). H. pylori ATCC 43504는 MIC 측정을위한대조구로사용되었다. H. pylori 감염여부의진단은, Mikula (7) 등의방법으로써, 분리된균주의게놈 (genome) DNA를주형 (template) 으로사용하여 H. pylori 의 SSA 유전자를증폭하는 PCR (polymerase chain reaction) 증폭법을사용하였고, 사용된 primer는 Table 2와같다. 분리된 H. pylori로부터 caga gene와 CagA protein의검출은새롭게고안된 primer (Table 2) 를이용하는 PCR 증폭법 (23) 과 Western blot kit인 Helicoblot 2.0 (Genelabs, Singapore, Republic of Singapore) 에의해수행되었다. Clarithromycin 내성기전분석 H. pylori의 23S rrna 유전자에형성되는 A2142G와 A2143G 돌연변이가 clarithromycin 내성의기전으로보고되었다 (20). Table 2. Nucleotide sequences of the oligonucleotides used for PCR amplifications and DNA sequencing Primer (orientation) a Sequence (5' 3') Position Amplicon size (bp) SSA-F b (F) TGGCGTGTCTATTGACAGCGAG SSA-R b (R) CCTGCTGGGCATACTTCACCAT 522 (SSA-F/-R) e CagA-F c (F) AGTAAGGAGAAACAATG CagA-R c (R) AATAAGCCTTAGAGTCTTTTTGGAAAT (CagA-F/-R) Cla-F d (F) AGTATTCTAAGGCGCGTGAAAG Cla-R d (R) GACCTGCATGAATGGCGTAAC 2946 (Cla-F/-R) a Orientation of each primer: F, forward; R, reverse. b Designed according to the sequence of 26-kDa cell surface antigen gene (SSA; GenBank accession no. M55507) from H. pylori. c Designed according to the sequence of cytotoxin-associated gene A (caga; GenBank accession no. AF282853) from H. pylori. d Designed according to the sequences of H. pylori 23S rrna gene (GenBank accession no. U27270) associated with clarithromycin (Cla) resistance. e Primer pair for PCR amplification.

3 H. pylori 감염 및 clarithromycin 내성 179 Vol. 41, No. 3 23S rrna 유전자의 점 돌연변이(point mutation)는 PCR-restriction fragment length polymorphism (RFLP)에 의해 분석했다. H. pylori로부터 Wizard genomic DNA purification kit에 의해 분리 된 게놈 DNA를 주형(template) DNA로 사용하였으며, 고안된 primer (Table 2)로 PCR증폭 하였다 bp의 증폭된 DNA조 각은 MboII 와 BsaI 제한효소를 이용하여 A2142G와 A2143G 돌연변이를 각각 검출하였다. PCR 증폭 산물은 자동 DNA 서열 분석기(automated DNA sequencer, ABI PRISM3100, Applied Biosystems, Weiterstadt, Germany)를 사용하여 양쪽 가닥의 DNA 서열을 직접 분석 하였다. 치료(treatment)와 치료 후 처리(follow-up) 본 연구의 대상인 모든 성인은 조직학 검사, 배양, RUT, SSA 유전자의 PCR 검출 방법을 이용하여 H. pylori 에 양성 반응을 나타내는지를 검사하였다. 대상 성인 환자들은 10일 동안 PPI인 omeprazole (20 mg twice a day [BID]), amoxicillin(1 g BID) 및 clarithromycin (500 mg BID)을 투여하였다. 치료가 끝나고 6주 후에, 임상적 증상을 검사하였고 내시경 검사를 수행하면서 얻은 생체조직을 이용하여 조직학적 검사, 세균학적 검사, 생화학적 검사 그리고 분자생물학적 검사를 수행하였다. 상기 4가지 검사 에 음성이면 H. pylori가 박멸되었음을 의미한다. 통계학적 분석 통계학적 분석을 위해서 SPSS software(version 11.5 for Windows, SPSS Inc., Chicago, Il., USA)를 이용하였다. 세균 박 Fig. 1. Representative electrophoresis of SSA (A) and caga (B) gene PCR products and Western blot analysis (C) of CagA protein expression. Lane M1 and M2, molecular weight marker 100-bp and 1kb DNA ladder, respectively; lane N: negative control (distilled water); lanes 1-3: three isolates of H. pylori A2143G mutants; lanes 4-6: three representative isolates among H. pylori wild-type; lanes 79: three representative isolates among H. pylori A2142G mutants. CagA protein was expressed in all caga gene-positive isolates (lanes 2, 3, and 6-9 of Fig. 1B). 멸률의 그룹간 차이는 chi-square test(χ test)에 의해 평가되었으 2 며 P 값이 0.05이하이면 그룹간의 관련성이 의미 있다고 판단하 을 나타내었다(Table 3). 이태리, 미국 및 캐나다 에서도 였다. amoxicillin에 대한 내성이 매우 드물게 나타났다(16). 1차 내성률 (primary resistance rate)은 20.2%이고, 2차 내성률(3제 요법이 실 결 과 소화기 궤양 환자에 감염된 H. pylori 의 특성 패인 환자에서 분리한 H. pylori 의 내성률)은 100%였다. 나이, 성별, 위궤양 또는 십이지장 궤양의 존재와 clarithromycin 내성 사이의 상호관계는 나타나지 않았다. 연구 대상 기준에 적합한 총 114명의 환자들을 선택하였다. 총 114명 중 위궤양, 십이지장 궤양 환자는 각각 64명(56.1%)과 50 Clarithromycin 내성 기전 명(43.9%)이었다(Table 1 및 Fig. 1B). Rapid urease test (RUT) 모든 H. pylori의 23S rrna 유전자 돌연변이의 분석은 PCR- 와 SSA 유전자의 PCR증폭에 관한 실험 결과에 의하면 모든 환 RFLP 방법에 의해서 수행되었다(Fig. 2). MboII에 의해 완전히 자들은 H. pylori 에 감염된 것으로 나타났다(Table 1 및 Fig. 절단된 A2142G 돌연변이는 clarithromycin에 내성인 23개의 H. 1A). caga 유전자의 PCR증폭 실험 결과에 의하면 114명의 환자 pylori 중 20개(87.0%)에서 검출되었다. Bsal에 의해 완전히 절단 들 중 59명의 환자들(51.8%)이 caga-양성 (table 1)이고 caga-양 된 A2143G 돌연변이는 clarithromycin에 내성인 23개의 H. 성인 모든 H. pylori는 CagA 단백질(128 kda, Fig. 1C)을 발현 pylori 중 3개(13.0%)에서 검출되었다(Table 3). 이러한 결과들은 시켰다. CagA-양성 환자 59명중 42명(71.2%)의 환자와 CagA-음 모든 PCR 산물(amplicons)의 DNA 서열 분석에 의하여 확증되 성 환자들 55명중 41명(74.5%)의 환자에서 H. pylori가 박멸 었다. A2142G 돌연변이인 H. pylori의 clarithromycin에 대한 (eradication)되었다(p = 0.1). MIC값(256 µg/ml)은 A2143G 돌연변이인 H. pylori의 MIC값(16 µg/ml) 보다 더 높았다(P = 0.001). Clarithromycin 내성 현황 치료 전과 후에 분리된 clarithromycin 내성(MIC > 1.0 µg/ml) Clarithromycin 내성과 H. pylori 박멸간의 연관성 인 H. pylori 는 114명의 환자중 23명(20.2%)에서 검출되었고, Clarithromycin에 내성인 H. pylori에 감염된 환자에서는 H. 분리된 모든 H. pylori는 amoxicillin (MIC<0.5 ug/ml)에 감수성 pylori가 박멸(eradication)되지 않았으나 clarithromycin에 감수성

4 180 Seung Ghyu Sohn et al. Kor. J. Microbiol Table 3. The relationship between A-to-G mutations of clarithromycin-resistant H. pylori isolates and the failed eradication after clarithromycinbased therapy against 114 patients suffering gastric or duodenal ulcer Isolate a (No.) No. of patients b No. of eradication MIC (µg/ml) b (%) failure (%) Amoxicillin Clarithromycin Wild-type (91) 91 (79.83) 0 (0.00) (S) (S) A2142G (20) 20 (17.54) 20 c (17.54) (S) 32->256 (R) A2143G (3) 3 (2.63) 3 c (2.63) (S) (R) a Sequence and PCR-RFLP analyses of the 23S rrna gene from each H. pylori isolated from each patient revealed mutations (A G) at residues 2142 and b Results presented for each isolate before treatment are same as those after treatment. c P = compared to wild-type group. Abbreviations: S, susceptible; R, resistant. Fig. 2. MboII and BsaI restriction analysis of 1,204-bp amplicons from 23S rrna gene. Lane M, molecular weight marker 100-bp DNA ladder; lanes 1-3: the BsaI-digestion products of three H. pylori A2143G mutants with two clearly distinguishable bands of 401 and 803 bp; lanes 4-6: the MboII/BsaI-digestion products of three representative isolates among H. pylori wild-type showing one band of 1,204 bp with no cleavage; lanes 7-9: the MboII-digestion products of three representative isolates among H. pylori A2142G mutants showing two fragments, respectively of 409 and 795 bp. 인 H. pylori에감염된환자에서만박멸 (eradication) 되었다. Clarithromycin에감수성인 H. pylori 감염환자에서의박멸률은 100% 이고 clarithromycin 비감수성과감수성을모두합한경우의박멸률은 79.8% 이었다. 박멸률은 79.8% 였다 (Table 3). A2142G 돌연변이그룹과 A2143G 돌연변이그룹에서의 H. pylori의박멸실패율 (eradi- cation failure rate) 은각각 100% 였다 (P = 0.001). 고찰 본연구는한국에서 clarithromycin에내성인경우는 H. pylori 를박멸하기위한치료제로는 clarithromycin가부적합하다는것과 H. pylori에감염되어소화기궤양의증상이있는환자를치료하기전에, 우선적으로실시하는, 생검에서배양된 H. pylori의항생제감수성시험의필요성을재확인하였다. 본연구에서밝혀진 clarithromycin에대한내성의빈도 (incidence) 는북동이탈리아 (1.8%)(11), 네덜란드 (1.7%)(17) 그리고독일 (3.3%)(22) 보다는높았지만중부이탈리아 (23.4%)(16) 에서보고된것과비슷하였다. Clarithromycin을사용하는 3제요법 (triple therapy) 을수행하기 전의 clarithromycin에대한내성빈도와 3제요법을수행한후의 clarithromycin에대한내성빈도는동일하였다. 이는 3제요법의실시로인하여내성이획득되지않았음을의미하며이탈리아에서의보고와유사하였다 (5). Clarithromycin에대한 H. pylori의내성은 23S rrna 유전자에서 A2142G와 A2143G의염기전위돌연변이 (transition mutation) 가발생하여리보솜 (ribosome) 에 clarithromycin이결합하는정도의감소에기인한다. 몇연구자들은가장중요한 clarithromycin 에대한 1차내성 (primary resistance) 기전이 A2143G 돌연변이임을최근보고하였다 (18). 그러나본연구에서는 A2142G 돌연변이가 1차내성의중요한기전이었다. H. pylori 게놈 (genome) 은높은유전적다양성 (genetic variability) 을나타내기때문에 (14) 한국에서의 clarithromycin에대한 1차내성기전은서양의경우와는다른양상을나타내었다. A2142G 돌연변이인 H. pylori의 clarithromycin에대한 MIC 값은 A2143G 돌연변이인 H. pylori의경우보다더높으며이런결과는 Versalovic 등 (19) 에의해보고된내용과일치하였다. Clarithromycin에대해내성인경우는치료의실패율이 100% 였다 (H. pylori의박멸률은 0%). 본연구결과와는대조적으로, 다른보고 (2) 에서는평균 55% 였다 (H. pylori의박멸률은 45%). Clarithromycin에대한높은수준의내성인경우는, Graham 등 (4) 이이미보고한바와같이, clarithromycin 투여의양을늘리거나또는치료기간을연장하는것으로는해결될수없다. 따라서, 치료약에대한내성문제가없이, H. pylori 감염을치료하고억제또는예방하는넓은의미의새로운치료법을찾아내는것이중요하다. 우리는이전에 H. pylori 감염에대한항생제치료 (antibiotic treatment) 를대신할수있는계란의난황을이용한 H. pylori 항체 (IgY-HP) 에대해서보고하였다 (13). H. pylori가인간의위암세포주 (cell line) 인 AGS에부착하는정도가 IgY-HP에의해분명하게감소하였다. Mongolian gerbil 모델에서 H. pylori 에감염된위염발생군은 IgY-HP 를경구투입할시에성공적으로치료되었다 (13). 항생제치료의실패시에는즉각적인내시경검사, H. pylori 배양그리고항생제감수성시험을수행하여야한다. 재치료 (retreatment) 시에는내성이획득된항생제는사용할수없다. 많은연구자들은재치료의어려움과제일효과적인 1차치료법의중요함을보고하였다 (5). H. pylori 박멸률은항생제감수성시험의결과를토대로항생제치료법을수행하였을때주목

5 Vol. 41, No. 3 H. pylori 감염및 clarithromycin 내성 181 할만하게향상되었다 ( 다른보고 (15) 에서는 17% 의향상그리고우리의예비결과에서는 18% 의향상을보임 ). 본연구에서는 clarithromycin-감수성인 H. pylori에감염된환자와 clarithromycin-내성인 H. pylori에감염된환자들간의 H. pylori 박멸률은현저하게다름이확인되었다. 이런결과는, 양쪽그룹에서 CagA의발현양상이유사한이유로, 병원성 (pathogenicity) 의차이에기인하지는않는것으로판단된다. 우리는또한 H. pylori에감염된환자를치료시 clarithromycin 이포함된 3제요법을선택하기전에실시하는생검배양 (biopsy culture) 의항생제감수성시험의필요성을재확인하였으며항생제감수성시험결과로부터 clarithromycin의 1차내성 (primary resistance) 이높은빈도로나타남을확인하였다. 감사의글 본연구는농촌진흥청바이오그린21사업의지원으로이루어졌으며, 이에감사드립니다. 참고문헌 1. Debets-Ossenknopp, Y.J., A.J. Herscheid, R.G. Pot, E.J. Kuipers, J.G. Kusters, and C.M. Vandenbroucke-Grauls Prevalence of Helicobacter pylori resistance to metronidazole, clarithromycin, amoxicillin, tetracycline, and trovafloxacin in The Netherlands. J. Antimicrob. Chemother. 43, Dore, M.P., G. Leandro, G. Realdi, A.R. Sepulveda, and D.Y. Graham Effect of pretreatment antibiotic resistance to metronidazole and clarithromycin on outcome of Helicobacter pylori therapy. Dig. Dis. Sci. 45, Drumm, B.S., S. Koletzko, and G. Oderda, on behalf of the European Pediatric Task Force on Helicobacter pylori Helicobacter pylori infection in children: a consensus statement. J. Pediatr. Gastroenterol. Nutr. 30, Graham, D.Y. and W.A. Qureshi Antibiotic-resistant H. pylori infection and its treatment. Curr. Pharm. Des. 15, Kalach, N., P.H. Benhamou, F. Campeotto, M. Bergeret, C. Doupont, and J. Raymond Clarithromycin resistance and eradication of Helicobacter pylori in children. Antimicrob. Agents Chemother. 45, Kim, J.H., H.Y. Kim, N.Y. Kim, S.W. Kim, J.G. Kim, J.J. Kim, J.K. Seo, J.G. Sim, I.H. Roe, H.S. Ahn, B.C. Yoon, S.W. Lee, Y.C. Lee, I.S. Chung, H.Y. Jung, W.S. Hong, and K.W. Choi Seroprevalence of Helicobacter pylori infection in asymptomatic people in Korea. Kor. J. Med. 59, Mikula, M., A. Dzwonek, K. Jagusztyn-Krynicka, and J. Ostrowski Quantitative detection for low levels of Helicobacter pylori infection in experimentally infected mice by realtime PCR. J. Microbiol. Meth. 55, National Committee for Clinical Laboratory Standards (NCCLS) Performance standards for antimicrobial susceptibility testing. Ninth informational supplement M100-S9. Villanova, PA. 9. NIH Consensus Conference Helicobacter pylori in peptic ulcer disease. NIH consensus development panel on Helicobacter pylori in peptic ulcer disease. J. Am. Med. Assoc. 272, Parsonnet, J., G.D. Friedman, D.P. Vandersteen, Y. Chang, J.H. Vogelman, N. Orentreich, and R.K. Sibley Helicobacter pylori infection and the risk of gastric carcinoma. N. Engl. J. Med. 325, Pilotto, A., M. Rassu, G. Leandro, M. Franceschi, and F.Di Mario Prevalence of Helicobacter pylori resistance to antibiotics in Northeast Italy: a multicentre study. Dig. Liver Dis. 32, Raymond, J., N. Kalach, M. Bergeret, P.H. Benhamou, J.P. Barbet, Gendrel, and C. Dupont Effect of metronidazole resistance on bacterial eradication of Helicobacter pylori in infected children. Antimicrob. Agents Chemother. 42, Shin, J.-H., M. Yang, S.W. Nam, J.T. Kim, N.H. Myung, W.-G. Bang, and I.H. Roe Use of egg yolk-derived immunoglobulin as an alternative to antibiotic treatment for control of Helicobacter pylori infection. Clin. Diagn. Lab. Immunol. 9, Taylor, D.E., M. Eaton, N. Chang, and S.M. Salama Construction of Helicobacter pylori genome map and demonstration of diversity at the genome level. J. Bacteriol. 174, Toracchio, S., L. Cellini, D.I. Campli, G. Cappello, M.G. Malatesta, A. Ferri, A.F. Ciccaglione, L. Grossi, and L. Marzio Role of antimicrobial susceptibility testing on efficacy of triple therapy in Helicobacter pylori eradication. Aliment. Pharmacol. Ther. 14, Toracchio, S. and L. Marzio Primary and secondary antibiotic resistance of Helicobacter pylori strains in central Italy during the years Dig. Liver Dis. 35, Tucci, A., O. Varoli, R. Corinaldesi, V. Stanghellini, S. Gasperoni, G.F. Paparo, M. Ricci-Maccarini, M. La Placa, and L. Barbara Evaluation of Helicobacter pylori sensitivity to amoxicillin and metronidazole in dyspeptic patients. Ital. J. Gastroenterol. 25, van Doorn, L.-J., Y. Glupczinski, J.G. Kusters, F. Mégraud, P. Midolo, N. Maggi-Solcà, D.M.M. Queiroz, N. Nouhan, E. Stet, and W.G.V. Quint Accurate prediction of macrolide resistance in Helicobacter pylori by a PCR line probe assay for detection of mutations in the 23S rrna gene: multicenter validation study. Antimicrob. Agents Chemother. 45, Versalovic, J., M.S. Osato, K. Spakovsky, M.P. Dore, R. Reddy, G.G. Stone, D. Shortridge, R.K. Flamm, S.K. Tanaka, and D.Y. Graham Point mutations in the 23S rrna gene of Helicobacter pylori associated with different levels of clarithromycin resistance. J. Antimicrob. Chemother. 40, Wang, G.E., M.S. Rahman, M.Z. Humayun, and D.E. Raylor. Multiplex sequence analysis demonstrates the competitive growth advantage of the A-to-G mutants of clarithromycin-resistant Helicobacter pylori. Antimicrob. Agents Chemother. 43, Warren, J.R. and B.J. Marshall Unidentified curved bacilli on gastric epithelium in active chronic gastritis. Lancet 1, Wolle, K., M. Nilius, A. Leodolter, W.A. Muller, P. Malfertheiner, and W. Koning Prevalence of Helicobacter pylori resistance to several antimicrobial agents in a region of Germany. Eur. J. Clin. Microbiol. Infect. Dis. 17, Xiang, Z., S. Censini, P.F. Bsyeli, Y. Chang, J.H. Vogelman, N. Orentrich, and R.K. Sibley Analysis of expression of caga and vaca virulence factors in 43 strains of Helicobacter pylori reveals that clinical isolates can be divided into two major types and that caga is not necessary for expression of the vacuolating cytotoxin. Infec. Immum. 63, (Received July 1, 2005/Accepted August 19, 2005)

6 182 Seung Ghyu Sohn et al. Kor. J. Microbiol ABSTRACT : Relationship between Eradication of Helicobacter pylori Infection and Clarithromycin Resistance Seung Ghyu Sohn, Jong Hwa Lee 1, Jung Hun Lee, and Sang Hee Lee * (Department of Biological Sciences, Myongji University, San 38-2 Namdong, Yongin, Kyunggido, , Korea, 1 Research Center of Gastroenterology, College of Medicine, Dankook University, Cheonan , Korea) H. pylori strains were isolated from antral biopsies taken during upper endoscopy in 114 dyspeptic patients with no previous therapy against H. pylori. Rapid urease test, PCR amplification of SSA and caga gene for H. pylori detection, and Western blot for CagA expression detection were performed. H. pylori infected patients were treated with omeprazole, clarithromycin (a macrolide), and amoxicillin. At 6 weeks after the discontinuation of therapy, the bacterial eradication rate was determined by endoscopy. The resistance rate to clarithromycin and amoxicillin was 20.2% and 0.0%, respectively. The clarithromycin resistance was mainly caused by the A2142G mutation in the 23S rrna gene of H. pylori. MICs of clarithromycin for the A2142G mutant isolates were significantly higher than MICs for the A2143G mutant isolates. H. pylori eradication was obtained in all patients with clarithromycin-susceptible isolates but not in patients with clarithromycin-resistant isolates (P = ). These results did not appear to be biased by any differences in CagA expression. The resistance of H. pylori to clarithromycin included in the therapeutic regimens is the most important reason for treatment failure. H. pylori antimicrobial susceptibility testing of the gastric biopsy culture should be performed before choosing the first triple therapy in infected patients and the increase in prevalence of clarithromycin resistance in Korea was problematic.

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar