<30345F D D FBFF8C0FA5FC1B6BFB5BCAE2CB1E8C1A6B7E62E687770>
|
|
- 유미 심
- 5 years ago
- Views:
Transcription
1 대한내분비학회지 : 제 24권제 1 호 2009 원 저 /jkes 갑상선암에서 mirna 146a/b, 221 및 222 의발현에대한연구 충남대학교병원내과, 외과 1 조영석 이인석 홍우정 송인상 1 송민호 김제룡 1 Expression of mirna 146a/b, 221 and 222 in Thyroid Cancer Young Suk Jo, Ihn Suk Lee, Woojeong Hong, In Sang Song 1, Minho Shong, Je Ryoung Kim 1 Department of Internal Medicine and Surgery 1, Chungnam National University Hospital ABSTRACT Background: mirnas can be diagnostic markers and therapeutic targets in cancers, but few studies have been conducted in thyroid cancer. We investigated the expression levels of mirna 146a/b, 221, and 222 which are important mirnas in papillary thyroid cancers (PTCa), and verified their impact on clinicopathological factors. Methods: We measured the expression of pre-mirnas 146a/b, 221, and 222 in NPA cells treated with 10% fetal bovine serum (FBS) or in HEK293T cells transfected with RET/PTC3 or BRAF V600E expression vectors. We also investigated the relationship between mirna expression levels in thyroid cancer tissue specimens and clinicopathological parameters. Results: Growth stimulation with 10% FBS induced mirna expressions in NPA cells, and transfection of RET/PTC3 and BRAF V600E also increased the expression of these mirnas in HEK293T cells. Most (25 cases; 50%) of PTCa showed increased expression of mirna-146a/b and 30 cases (60%) had elevated expression of mirna-221 and mirna-222 compared to normal thyroid samples from the contralateral lobe. However, increased mirna expression did not correlate with clinicopathological factors. Conclusion: Expression of mirna 146a/b, 221, and 222 was increased by BRAF V600E and RET/PTC3 rearrangement and might have a role in tumorigenesis in PTCa. However, expression levels of these mirnas did not correlate with clinicopathological parameters of patients with PTCa. (J Korean Endocr Soc 24:17~24, 2009) ꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏ Key Words: microrna, prognosis, thyroid neoplasm 서론 1) microrna는 22개정도의염기쌍 (basepair) 으로구성된 non-coding RNA로 1993년 Ambros와 Ruvkun 등이 C. elegans에서 lin-4를클로닝하여기능을분석함으로써알려지기시작하였다 [1,2]. 최근에는다양한 mirnas가존재하는것이밝혀지고있으며 mirnas의생성과정과생물학적의접수일자 : 2008년 8월 13일통과일자 : 2009년 1월 7일책임저자 : 김제룡, 충남대학교병원외과 의가규명되고있다 [3]. 이들 mirnas의생성과정을살펴보면 DNA로부터 pri-mrnas의형태로전사되어 endonucleolytic cleavage, nuclear export 및 strand seletion 과정을거쳐 mature mirnas로전환된다 [4]. 이렇게생성된 mature mirna는 RNA-induced silencing complexes (RISC) 를이루어표적유전자의발현을억제하게되며, 이를통해세포의증식, 분화또는세포자연사등의생명활동에 negative regulator' 로작용하게된다 [5,6]. 암의생성과정에서 mirna는표적유전자에따라종양억제유전자 (tumor suppressor) 또는종양유전자 (oncogene) 로작용하게되는데 [7,8], 종양의원발부위와아형 (subtype)
2 대한내분비학회지 : 제 24 권제 1 호 2009 에따라이들 mirna의발현양상이달라서이를활용한종양의분류방법이꾸준히연구되고있다 [9]. 이와더불어, 폐암, 유방암및고환암등과같은악성종양에서이들 mirnas의발현양상및기능에대한연구가활발히수행되고있으며이를통해진단, 예후예측및치료등에활용이가능한표지자를발굴하고있다 [10~12]. 갑상선유두암에서도 mirna-146a/b, mirna-221 및 mirna-222 등과같은특정 mirnas의발현이증가되어있다는보고가있었으며 [13], BRAF V600E 돌연변이나 RET/PTC1 재배열에의해 mirna-128a/b, mirna-185, mirna-200a/b 및 mirna-213 등의발현이유도된다는연구결과도있었다 [14,15]. 그러나, 아직은일부연구자들에의해수행된제한적인결과이고, 이들 mirna의임상적의의가충분히규명되지않은상태이다. 이에본연구에서는 mirna-146a/b, mirna-221 및 mirna-222의발현이갑상선암세포주에서유의하게증가되어있는지확인하고, 우태아혈청및종양유전자와같은성장유발신호에의해조절되는지알아보고자하였다. 또한, 수술을통해확보된갑상선유두암조직에서이들 mirnas의발현이증가되어있는지확인하고, 이미알려진예후인자와연관성이있는지규명하고자하였다. 대상및방법 1. 세포배양및항체갑상선암세포주인 TPC1, NPA, FRO 및 ARO를이용하여 mirnas의발현과 10% 우태아혈청 (Invitrogen Life Technologies, Carlsbad, CA) 처리에따른변화를확인하였으며, HEK293T 세포주를이용하여종양유전자의도입에의한 mirnas의발현변화를관찰하였다. 이들의배양은이미기술된방법을사용하였으며성장을위한배지는 TPC1과 HEK293T 세포주는 Dulbecco's Modified Eagle Medium (Invitrogen Life Technologies) 을, NPA, FRO 및 ARO 세포주는 RPMI 1640 (Invitrogen Life Technologies) 을사용하였다. Anti-phospho-p44/42-MAPK (pt202/y204) 항체와 Anti-p44/42-MAPK 항체는 New England Biolabs, Inc. (Danvers, MA) 로부터구입하였으며, Anti-pY 항체및 anti-actin 항체는 Santa Cruz Biotechnology, Inc. (CA) 로부터구입하였다. 2. 플라스미드및형질도입 pcdna3.1-ret/ptc3 및 pcdna3.1-braf는 PCR을통해제작하였으며, pcdna3.1-ret/ptc3 K284M, pcdna3.1 -BRAF V600E 및 pcdna3.1-braf G469A 는 Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) 를사용하여제작하였다 [16~18]. 형질도입은 LipofectAMINE (Invitrogen Life Technologies) 을사용하여제조사의사용설명서에따라시행하였다. 3. 역전사중합효소연쇄반응및 Western Blot 분석 각각의세포주, 갑상선유두암조직및반대편정상조직에서 Trizol Reagent (Invitrogen Life Technologies) 를이용하여 RNA를추출하였다. Maxime TM RT-PCR Premix Kit 와 Maxime TM PCR Premix Kit (intron Biotechnology, Korea) 를사용하여표준조건에서역전사중합효소연쇄반응을수행하였으며, 사용된 primer는 Table 1과같다. 정량적분석을위해 U6 snrna를 mirvana TM qrt-pcr Primer Sets (Ambion, Austin, TX) 를사용하여증폭한후, end-point RT-PCR product를사용하였다. HEK293T 세포에 IPH 완충액 (50 mm Tris-HCl, ph 8.0, 150 mm NaCl, 5 mm EDTA, 1% NP-40, 100 μm PMSF), 1 μg/ml 단백질분해효소억제제 (Luepetin, Aprotinin), 1 mm DTT를처리하여단백질을추출하였으며, Sodium dodecyl sulfate -polyacrylamide 겔에서전기영동하여단백질을크기별로분리한후 Immobilon-P transfermembrane (Milipore, Billerica, MA) 으로이동시켰다. 차단완충액 (blocking buffer) 과 30분간반응시킨후 Anti-phospho-p44/42-MAPK (pt202/y204) 항체, Anti-p44/42-MAPK 항체, Anti-pY 항체및 anti-actin 항체로 4 에서 16시간반응시키고, horseradish peroxidase 가표지된이차항체로상온에서 1시간반응시켰다. Phototope-HRP Western Blot Detection Kit (New England Biolabs) 를사용하여단백질발현을확인하였다. 4. 연구대상및예후인자분석 2005년 1월부터 12월까지충남대학교병원에서갑상선유두암으로갑상선절제술을시행받은 50명의환자로부터갑상선암조직및종양발생부위의반대편엽에서정상갑상선조직을얻어 RNA를추출하였으며, 추출된 RNA를정량한 Table 1. Primers for RT-PCR Name Forward primer Reverse primer mir-146a CCGATGTGTATCCTCAGCTTT TGACAGAGATATCCCAGCTGAA mir-146b CCTGGCACTGAGAACTGAAT GGCACCAGAACTGAGTCCAC mir-221 TGAATGCAGTAGGCAGTTGTG GGGGTAGCATTGGTGAGACA mir-222 GCTAGAAGATGCCATCAGAGAC AGGTACCCTCAATGGCTCAG
3 - 조영석외 5 인 : 갑상선암에서 mirna 146a/b, 221 및 222 의발현에대한연구 - 후, pre-mirna-146a/b, pre-mirna-221 및 pre-mirna-222 의발현정도를 RT-PCR을통하여확인하였다. 생성된 RT-PCR 산물을 Gel Pro Analyzer 3.1 (Media Cybernetics, Silver spring, MD) 을활용하여 U6의발현과정량적으로비교한후, pre-mirna-146a/b, pre-mirna-221 및 pre-mirna -222의발현이정상조직에비해증가된군및감소된군으로분류하고, 양군의임상적특징을후향적방법으로비교, 분석하였다. 5. 통계분석 그룹간의빈도를비교하기위해서카이제곱검정 (chi-square test) 을이용하였으며평균의비교를위해서는 independent samples T-test를사용하였다. 모든연속변수는평균 ± 표준편차로기술하였으며, 제시된 P값은양측검정을통하여산출하였다. 통계프로그램은 SPSS Versions 12.0 (for Windows) 을이용하였다. 결 과 1. 갑상선암세포주에서 mirna 의발현과우태아혈청처리에따른발현유도 갑상선암세포주에서내인성 mirna의발현을확인하기위해, TPC1, NPA, FRO 및 ARO 세포주를배양한후 RNA 를추출하여 RT-PCR을이용하여 precursor mirna의발현을확인하였다. mirna 146a/b의발현은 TPC1 및 FRO 세포주에서증가되어있고 mirna 221 및 mirna 222의발현은 FRO 세포주에서증가되어있었다 (Fig. 1A). 내인성 mirnas의발현이적은 NPA 세포주를이용하여 10% 우태아혈청처리에따른 mirnas의발현변화를관 찰하였다. 우태아혈청처리후 1시간째부터 MAPK의인산화가증가함을알수있었으며, 이와더불어 mirna-146a와 mirna-221의발현이 1시간째부터증가하여 4시간을정점으로 6시간째까지유지됨을알수있었다 (Fig. 1B). mirna -146b와 mirna-222도 10% 우태아혈청을처리하였을때 mirna-146a와 mirna-221과유사한발현증가를확인할수있었다 (data not shown). 2. RET/PTC3 rearrangement 와 V600E BRAF 에의한 mirnas 의발현유도 갑상선유두암의종양유전자인 RET/PTC3 rearrangement 와 V600E BRAF에의한 mirna의발현조절을확인하기위하여 HEK293T 세포주에이들종양유전자를형질도입하였다. RET/PTC3 rearrangement와 BRAF V600E 의도입에의해각각 tyrosine 또는 MAPK의인산화가증가하였고 (Fig. 2A), mirna-146a 및 mirna-221의발현도 RET/PTC3 rearrangement와 BRAF, BRAF V600E 및 BRAF G469A 에의해증가하였다 (Fig. 2B). 특히, mirna-146a의발현은다른종양유전자와비교하여 BRAF V600E 에의해더욱증가함을알수있었다. mirna-146b와 mirna-222도 RET/PTC3 rearrangement와 BRAF, BRAF V600E, BRAF G469A 에의해 mirna-146a와 mirna-221과유사한양상의발현증가가있음을관찰하였다 (data not shown). 키나아제활성이없는 RET/PTC3 KM 발현벡터를사용했을경우 mirna-146a 와 mirna-221의발현에변화가없었다 (Fig. 2B). 이는 RET/PTC3 rearrangement에의한 mirna-146a와 mirna -221의발현유도가키나아제활성에의존적임을시사하는자료로사료된다. A B Fig. 1. mirna expression in human thyroid cancer cell lines and induction of mirna expression by serum stimulation. A. mirna expression in human thyroid cancer cell lines. To find out the endogenous expression of mirna-146a and mirna-221, we performed RT-PCR targeting precursor mirnas of these mirnas. B. Induction of mirna expression by serum stimulation. As we treated NPA cells with 10% fetal bovine serum, mirna-146a/b, -221 and -222 were induced at 1 hour
4 대한내분비학회지 : 제 24 권제 1 호 2009 A B Fig. 2. RET/PTC3 rearrangement and BRAF induced expression of mirna-146a and mirna-221. A. RET/PTC3 and activating mutant BRAF constructs induced tyrosine phopsphorylation and erk activation, respectively. B. RET/PTC3 rearrangement and BRAF induced expression of mirna-146a and mirna -221, whereas kinase-dead form of RET/PTC3 rearrangement did not. A B C D Fig. 3. Differential expression of mirna in human papillary thyroid cancer. Expression levels of mirna-146a(a), -146b(B), -221(C) and -222(D) were classified into increased or decreased group. 3. mirnas와예후인자와의관계세포주를이용한실험에서 10% 우태아혈청과같은성장인자나종양유전자들과 mirna 146a/b, mirna-221 및 mirna-222의발현이연관이있음을확인한본연구진은갑상선유두암조직및반대편엽의정상조직에서 RNA를추출한후, 이들 mirnas의발현여부를확인하였다. 그리고, 반정량적분석을통해암조직에서정상조직보다이들 mirnas의발현비율이높은군과낮은군으로분류하였다 (Fig. 3). 양군의나이, 성별, 진단당시의종양의크기, 다발성유무, 현미경적주변조직으로의침윤여부, T 병기, 림프절전이여부및 TNM 병기등을비교, 분석하였으나, mirna-146a/b, mirna-221 및 mirna-222의발현에따른예후인자의의미있는차이를관찰할수없었다 (Table 2,3)
5 - 조영석외 5 인 : 갑상선암에서 mirna 146a/b, 221 및 222 의발현에대한연구 - Table 2. Relationship between expression of mirna-146a/b and clinicopathological factors Decreased Group Increased Group n (%) n (%) P value Age (years) 49.7 ± ± Sex Male 3 (12) 3 (12) 1 Female 22 (88) 22 (88) Size (mm) 10.9 ± ± Multifocality Negative 20 (80) 22 (88) 0.44 Positive 5 (20) 3 (12) Capsule invasion (microinvasion) Negative 7 (28) 9 (36) 0.54 Positive 18 (72) 16 (64) T-stage I 6 (24) 10 (40) 0.23 III 19 (76) 15 (60) Lymph node metastasis N0 18 (72) 21 (84) 0.31 N1a 7 (28) 4 (16) TNM stage I 9 (36) 15 (60) 0.09 III 16 (64) 10 (40) Table 3. Relationship between expression of mirna-221/222 and clinicopathological factors Decreased Group Increased Group n (%) n (%) P value Age (years) 49.5 ± ± Sex Male 1( 5) 5(16.7) 0.21 Female 19(95) 25(83.3) Size (mm) 10.5 ± ± Multifocality Negative 17(85) 25(83.3) 0.87 Positive 3(15) 5(16.7) Capsule invasion (microinvasion) Negative 7(35) 9(30) 0.71 Positive 3(15) 21(60) T-stage I 6(30) 10(33.3) 0.8 III 14(70) 20(66.7) Lymph node metastasis N0 15(75) 24(80) 0.68 N1a 5(25) 6(20) TNM stage I 7(35) 17(56.7) 0.13 III 13(65) 13(43.3) 고찰최근들어, BRAF V600E 돌연변이, RET/PTC 재배열을비롯한갑상선유두암의종양유전자가규명되면서이를이용한진단방법이다양하게제시되고있다 [19~22]. 그러나, 갑상선유두암환자에서임상적예후인자와연관된분자수준의조절물질은명확히규명되지않은상태이다. 본연구에서는 갑상선유두암에서 mirnas의발현양상을조사하여새로운분자표지자로서의활용가능성을살펴보고자하였다. mirna의임상적의의는폐암에서 let-7 mirna의발현이수술후생존기간의감소와연관성이있으며 [10], pre -mirnas에서 mirnas의생성에관여하는 RNAse III 효소인 Dicer의발현이감소되어있는경우나쁜예후를시사하는것으로도보고된바있다 [23]. 이러한연구를바탕으로
6 대한내분비학회지 : 제 24 권제 1 호 2009 갑상선암을비롯한다양한암에서 mirnas의진단및예후인자적가치가연구되고있으나, 폐암을제외한나머지암에서는진단및예후인자와연관된새로운 mirnas가발굴되지못한상태이다 [8]. He 등 [13] 이갑상선유두암에서 mirna 146a/b, mirna 221 및 mirna 222의발현이정상조직에비해 11배내지 19배증가되어있으며, KIT의발현을조절한다고보고한이후이들 mirnas와갑상선암세포의성장과의연관성이연구되고있다 [24]. 본연구에서도 mirna 146a/b, mirna 221 및 mirna 222가갑상선암세포주및갑상선암조직에서증가되어있는지확인하고증가된 mirnas의예후인자적가치를규명하고자하였다. 그결과 mirna 146a/b, mirna 221 및 mirna 222는 TPC1 및 FRO와같은특정갑상선암세포주에서발현되고있으며, NPA에 10% 우태아혈청을처리할경우발현이유도됨을확인할수있었다. 또한, HEK293T세포주에 RET/PTC3 rearrangement와 BRAF V600E 와같은종양유전자를도입할경우이들 mirnas의발현이증가됨도확인하였다. 이러한결과는우태아혈청이나종양유전자와같은성장신호가이들 mirnas의발현을유도하며, 비록증가된이들 mirnas의발현이세포의성장에미치는영향을본연구에서직접규명하지는못하였으나, 기간의연구와종합하여판단할때이들 mirnas가세포의성장과증식에연관성이있음을시사하는자료라고사료된다 [13,25]. 또한, 50예의갑상선암조직에서이들 mirnas의발현을조사한결과, mirna-146a/b의경우는 25예 (50%) 에서그리고 mirna-221과 mirna-222의경우에는 30예 (60%) 에서이들 mirnas의발현이정상조직에비해 2배내지 6 배정도로증가되어있음을확인하였다. 앞서언급한바와같이, 종양에서발현이증가하거나감소하는 mirnas는종양의진단및임상예후를반영하는중요한수단으로주목을받고있다 [26,27]. 예를들어, let-7/ mir-98과같은 mirnas의발현이감소하면, 이들 mirnas 에의한 Ras 종양유전자의발현을억제하는기능이상쇄되어세포의성장신호가증폭되는것으로알려져있다 [28]. 반대로, mirna-17과같은 mirnas는 myc의발현을증가시켜종양유전자와같은역할을하게된다 [29]. 본연구에서관찰한 mirna-221및 mirna-222의경우, 갑상선유두암에서 p27(kip) 의발현을억제하는것으로보고되고있으며, p27의발현이이들 mirnas의발현과역의상관관계를가짐이입증된바있다. 또한, TPC-1과같은갑상선암세포주에 mirna-221 및 mirna-222의발현을유도할경우, 세포주기가 S phase로진행하게된다 [25]. 흥미롭게도, 암주변정상조직에서도 mirna-221 및 mirna -222의발현이증가되어있는경우가확인되고있는데, 이는조직학적으로는정상인조직이지만분자수준에서암세포와 유사한변형이시작되었음을시사하는소견이라할수있겠다 [13]. 이러한연구결과는갑상선암의발생과정에서종양주변부의조직학적정상조직이종양의 epigenetic alteration에유사한변화를가지고있으며, 이러한과정에서 mirna-221과 mirna-222가종양의생성을유도함을반영한다고할수있다. mirna-146a/b는면역반응에서중요한역할을하는것으로알려지고있는데, IL-1 receptor-associated kinase 1과 TNF receptor-associated factor 6의발현을감소시켜 Toll-like receptor와연관된신호체계의 negative regulator 로작용한다 [30]. 갑상선암에서는이들 mirna의발현이증가되어있다는보고와더불어, pre-mirna-146a의다형성 (polymorphism) 이갑상선유두암의유전학적소인으로제시된바있다 [31]. 본연구에서는갑상선암세포주에서성장인자나종양유전자의도입에의해 mirna-146a/b, mirna-221 및 mirna -222의발현이증가되며, 갑상선유두암조직에서도이들 mirna가증가된경우가상당수존재함을입증할수있었다. 이러한결과는 mirnas가갑상선세포의변형에중요한역할을하며갑상선암의진단에유용한방법으로이용될가능성을시사하는것으로, 향후갑상선유두암과연관된새로운 mirnas를발굴하고, 이들의분자생물학적역할및임상적의의를규명하는연구가꾸준히수행되어야하겠다. 요약연구배경 : 최근들어, mirnas을진단표지자또는치료표적으로활용하고자하는연구들이활발히수행중이다. 그러나, 갑상선암에서이들 mirnas와관련된연구는미미한실정이다. 이에저자들은갑상선암에서증가되어있는것으로보고된바있는 mirna 146a/b, 221 및 222과성장인자또는종양유전자와의연관성을조사하고, 이들 mirnas가예후인자에미치는영향을규명하고자하였다. 방법 : 성장신호및종양유전자와의연관성을확인하기위하여 NPA 세포주에 10% 우태아혈청을처리하거나 HEK293T 세포주에 RET/PTC3 또는 BRAF V600E 발현벡터를형질도입한후한후, pre-mirnas 146a/b, 221과 222의발현량을측정하였다. 또한, 예후에미치는영향을파악하기위하여갑상선유두암조직에서이들 mirnas의발현량을측정한후다양한임상예후인자와의연관성을후향적으로분석하였다. 결과 : TPC1, NPA, FRO 및 ARO 세포주에서 mirna -146a/b와 mirna-221/222가발현되고있음을확인하였다. 또한, 10% 우태아혈청을 NPA 세포주에처리할경우 mirna-146a과 mirna-221 의발현이유도됨을알수있었다. HEK293T 세포주에 RET/PTC3 rearrangement와
7 - 조영석외 5 인 : 갑상선암에서 mirna 146a/b, 221 및 222 의발현에대한연구 - BRAF V600E 을발현시킨경우에도이들 mirnas의발현이증가되었다. 임상연구에서도정상조직과비교하여갑상선유두암의 50% (25예) 와 60% (30예) 에서 mirna-146a/b와 mirna -221/222가각각증가되어있었다. 그러나, 이들 mirnas의발현증가와임상예후인자들과의연관성은확인할수없었다. 결론 : 갑상선유두암의종양유전자인 BRAF V600E 와 RET/PTC3 rearrangement에의해 mirna 146a/b, 221 및 222의발현이증가됨을확인하였으며, 이에따라이들 mirna가갑상선유두암의암화과정에관여할것으로추측할수있었다. 그러나, 갑상선유두암환자의임상조직학적예후인자들과의연관성은확인할수없었다. 참고문헌 1. Lee RC, Feinbaum RL, Ambros V: The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75: , Wightman B, Ha I, Ruvkun G: Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell 75: , Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ: mirbase: microrna sequences, targets and gene nomenclature. Nucleic Acids Res 34:D140-D144, Zeng Y: Principles of micro-rna production and maturation. Oncogene 25: , Hammond SM, Boettcher S, Caudy AA, Kobayashi R, Hannon GJ: Argonaute2, a link between genetic and biochemical analyses of RNAi. Science 293: , Cerutti H, Casas-Mollano JA: On the origin and functions of RNA-mediated silencing: from protists to man. Curr Genet 50:81-99, Chen CZ: MicroRNAs as oncogenes and tumor suppressors. N Engl J Med 353: , Esquela-Kerscher A, Slack FJ: Oncomirs - micrornas with a role in cancer. Nat Rev Cancer 6: , Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J, Peck D, Sweet-Cordero A, Ebert BL, Mak RH, Ferrando AA, Downing JR, Jacks T, Horvitz HR, Golub TR: MicroRNA expression profiles classify human cancers. Nature 435: , Takamizawa J, Konishi H, Yanagisawa K, Tomida S, Osada H, Endoh H, Harano T, Yatabe Y, Nagino M, Nimura Y, Mitsudomi T, Takahashi T: Reduced expression of the let-7 micrornas in human lung cancers in association with shortened postoperative survival. Cancer Res 64: , Iorio MV, Ferracin M, Liu CG, Veronese A, Spizzo R, Sabbioni S, Magri E, Pedriali M, Fabbri M, Campiglio M, Menard S, Palazzo JP, Rosenberg A, Musiani P, Volinia S, Nenci I, Calin GA, Querzoli P, Negrini M, Croce CM: MicroRNA gene expression deregulation in human breast cancer. Cancer Res 65: , Voorhoeve PM, le Sage C, Schrier M, Gillis AJ, Stoop H, Nagel R, Liu YP, van Duijse J, Drost J, Griekspoor A, Zlotorynski E, Yabuta N, De Vita G, Nojima H, Looijenga LH, Agami R: A genetic screen implicates mirna-372 and mirna-373 as oncogenes in testicular germ cell tumors. Cell 124: , He H, Jazdzewski K, Li W, Liyanarachchi S, Nagy R, Volinia S, Calin GA, Liu CG, Franssila K, Suster S, Kloos RT, Croce CM, de la Chapelle A: The role of microrna genes in papillary thyroid carcinoma. Proc Natl Acad Sci U S A 102: , Cahill S, Smyth P, Denning K, Flavin R, Li J, Potratz A, Guenther SM, Henfrey R, O'Leary JJ, Sheils O: Effect of BRAF V600E mutation on transcription and post-transcriptional regulation in a papillary thyroid carcinoma model. Mol Cancer 6:21, Cahill S, Smyth P, Finn SP, Denning K, Flavin R, O'Regan EM, Li J, Potratz A, Guenther SM, Henfrey R, O'Leary JJ, Sheils O: Effect of ret/ptc 1 rearrangement on transcription and post-transcriptional regulation in a papillary thyroid carcinoma model. Mol Cancer 5:70, Jung HS, Kim DW, Jo YS, Chung HK, Song JH, Park JS, Park KC, Park SH, Hwang JH, Jo KW, Shong M: Regulation of protein kinase B tyrosine phosphorylation by thyroid-specific oncogenic RET/ PTC kinases. Mol Endocrinol 19: , Kim DW, Chung HK, Park KC, Hwang JH, Jo YS, Chung J, Kalvakolanu DV, Resta N, Shong M: Tumor suppressor LKB1 inhibits activation of signal transducer and activator of transcription 3 (STAT3) by thyroid oncogenic tyrosine kinase rearranged in
8 대한내분비학회지 : 제 24 권제 1 호 2009 transformation (RET)/papillary thyroid carcinoma (PTC). Mol Endocrinol 21: , Wan PT, Garnett MJ, Roe SM, Lee S, Niculescu -Duvaz D, Good VM, Jones CM, Marshall CJ, Springer CJ, Barford D, Marais R: Mechanism of activation of the RAF-ERK signaling pathway by oncogenic mutations of B-RAF. Cell 116: , Jo YS, Huang S, Kim YJ, Lee IS, Kim SS, Kim JR, Oh T, Moon Y, An S, Ro HK, Kim JM, Shong M: Diagnostic value of pyrosequencing for the BRAF (V600E) mutation in ultrasound-guided fine-needle aspiration biopsy samples of thyroid incidentalomas. Clin Endocrinol (Oxf) 70: , Xing M: BRAF mutation in papillary thyroid cancer: pathogenic role, molecular bases, and clinical implications. Endocr Rev 28: , Nikiforova MN, Nikiforov YE: Molecular genetics of thyroid cancer: implications for diagnosis, treatment and prognosis. Expert Rev Mol Diagn 8:83-95, Chung KW, Yang SK, Lee GK, Kim EY, Kwon S, Lee SH, Park do J, Lee HS, Cho BY, Lee ES, Kim SW: Detection of BRAF V600E mutation on fine needle aspiration specimens of thyroid nodule refines cyto-pathology diagnosis, especially in BRAF600E mutation-prevalent area. Clin Endocrinol (Oxf) 65: , Karube Y, Tanaka H, Osada H, Tomida S, Tatematsu Y, Yanagisawa K, Yatabe Y, Takamizawa J, Miyoshi S, Mitsudomi T, Takahashi T: Reduced expression of Dicer associated with poor prognosis in lung cancer patients. Cancer Sci 96: , Pallante P, Visone R, Ferracin M, Ferraro A, Berlingieri MT, Troncone G, Chiappetta G, Liu CG, Santoro M, Negrini M, Croce CM, Fusco A: MicroRNA deregulation in human thyroid papillary carcinomas. Endocr Relat Cancer 13: , Visone R, Russo L, Pallante P, De Martino I, Ferraro A, Leone V, Borbone E, Petrocca F, Alder H, Croce CM, Fusco A: MicroRNAs (mir)-221 and mir-222, both overexpressed in human thyroid papillary carcinomas, regulate p27kip1 protein levels and cell cycle. Endocr Relat Cancer 14: , Cuellar TL, McManus MT: MicroRNAs and endocrine biology. J Endocrinol 187: , Dalmay T, Edwards DR: MicroRNAs and the hallmarks of cancer. Oncogene 25: , Johnson SM, Grosshans H, Shingara J, Byrom M, Jarvis R, Cheng A, Labourier E, Reinert KL, Brown D, Slack FJ: RAS is regulated by the let-7 microrna family. Cell 120: , O'Donnell KA, Wentzel EA, Zeller KI, Dang CV, Mendell JT: c-myc-regulated micrornas modulate E2F1 expression. Nature 435: , Taganov KD, Boldin MP, Chang KJ, Baltimore D: NF-kappaB-dependent induction of microrna mir-146, an inhibitor targeted to signaling proteins of innate immune responses. Proc Natl Acad Sci U S A 103: , Jazdzewski K, Murray EL, Franssila K, Jarzab B, Schoenberg DR, de la Chapelle A: Common SNP in pre-mir-146a decreases mature mir expression and predisposes to papillary thyroid carcinoma. Proc Natl Acad Sci U S A 105: ,
Jkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
More informationJkbcs032.hwp
Clinical Correlation of HER-2/neu Overexpression in Patients with Breast Cancer Sung Yong Kim, Tae Yoon Kim, Jae Jun Kim, Chang Ho Kim, Ok Pyung Song, Min Hyuk Lee, Eui Han Kim 1, and Moo Sik Cho Departments
More informationKaes017.hwp
갑상선의 Poorly Differentiated (Insular) Carcinoma Insular Carcinoma: An Aggressive Subtype of Differentiated Thyroid Neoplasms Seok-Jin Nam, M.D., Sang-Dal Lee, M.D., Hal-lin Park, M.D., Young-Ryun Oh, M.D.
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information김범수
Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세
본문제에대한지적소유권은동국대학교에있습니다. 본교의서면허락없이무단으로출판, 게재, 사용할수없습니다. 문제 2 2016 학년도약학대학면접문제 아래의질문에 3-4 분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신 인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세포의생존과증식
More informationKaes010.hwp
갑상선자극호르몬이갑상선암세포의 VEGF, 신생혈관형성, 성장, 침윤및전이에미치는영향 Effects of TSH on the Production of VEGF, Angiogenesis, Growth, Invasion and Metastasis in Thyroid Cancer Cells Euy Young Soh, M.D., Hee Boong Park, M.D.,
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More informationKaes025.hwp
고위험군유두상갑상선암환자에대한방사성옥소최대허용선량측정법및치료법의검증 Verification of Measurement Methods and Therapeutic Efficacy of Maximum Permissible Dose of I-131 in High Risk Patients with Differentiated Papillary Thyroid Cancer
More informationMHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
More informationKbcs002.hwp
Does Real-time Compound Imaging Improve Evaluation of reast Cancer Compared to Conventional Sonography? o Kyoung Seo, M.D., Yu Whan Oh, M.D., Kyu Ran Cho, M.D., Young Hen Lee, M.D., Hyung Joon Noh, M.D.,
More information( )Jkstro011.hwp
비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy
More informationΔ Epidermal growth factor receptor (EGFR) is well established target for cancer treatment and EGFR tyrosine kinase (TK) inhibitors such as gefinitib and elotinib have been developed as anti-cancer drugs.
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More information기관고유연구사업결과보고
기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More informationJkbcs042.hwp
Invasive Ductal Carcinoma Arising from Axillary Accessory Breast Tae Wan Kim, Sang Wook Kang, Ji Young Park 2, Seung Sang Ko 1, Min Hee Hur 1, Hae Kyung Lee 1, Sung Soo Kang 1, and Jee Hyun Lee 1 Department
More information석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
More informationuntitled
ORIGINAL ARTICLE pissn: 2384-3799 eissn: 2466-1899 Int J Thyroidol 2016 May 9(1): 29-34 http://dx.doi.org/10.11106/ijt.2016.9.1.29 하시모토 갑상선염을 동반한 갑상선유두암에서 BRAF V600E 돌연변이의 임상병리학적 의미 울산대학교 의과대학 서울아산병원 내과
More informationMicrosoft Word - 9-이경은.doc
Biomedical Science Letters 2013, 19(4): 348~352 eissn : 2288-7415 Brief Communication Down-regulation of mir-34a Expression in Cervical Intraepithelial Neoplasia with Human Papillomavirus Infection and
More information1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More information7.ƯÁýb71ÎÀ¯È« š
J KMA Special Issue Myelodysplastic Syndrome June Won Cheong, MD Yoo Hong Min, MD Department of Internal Medicine, Yonsei University College of Medicine E mail : jwcheong70@yumc.yonsei.ac.kr minbrmmd@yumc.yonsei.ac.kr
More informationuntitled
REVIEW ARTICLE ISSN: 2384-3799 Int J Thyroidol 2015 November 8(2): 153-160 http://dx.doi.org/10.11106/ijt.2015.8.2.153 세포학적으로진단이불확실한갑상선결절의분자진단 건국대학교의학전문대학원병리학교실 황태숙 Molecular Diagnosis for Cytologically
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More informationPowerPoint 프레젠테이션
Apr. 30. 2016. GBCC in JeJu Island Sensitization of breast cancer cells to chemotherapeutic drugs by metabolic regulation InChul Park, Ph. D. Korea Institute of Radiological & Medical Sciences (KIRAMS)
More information황지웅
Comparison of Laparoscopy and Exploration in the Distal Pancreatectomy BACKGROUND: To determine the benefits of laparoscopic surgery compared with exploration, the clinical outcomes of open and laparoscopic
More information:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( )
:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α=.83.91.,.,,..,,,.,. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ..,.,.,. Bandura(1997),.,,,,., (,,, 2009), (,,,, 2014).?.,,,.. Bandura (1995) (Resiliency
More informationCrt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
More informationAbstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
More information전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II)
전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) 전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) - i - - ii - - iii - - iv - - v - - vi - - vii - - viii - - ix - -
More information388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR
6 3 2000 ; 387-392 (3) Dysplastic Nodule Young Nyun Park, M.D., Chanil Park, M.D. Department of Pathology, Yonsei University College of Medicine BRIEF HISTORY 56. AST/ALT 72/73 IU/L, total bilirubin 0.7
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More information( )Kjhps043.hwp
Difference of Fistula Maturation Degree and Physical Property by the Types of Tube Material: An Experimental Study Sang Koo Kang, M.D. 1, Hee Chul Yu, M.D. 1,4, Woo Sung Moon, M.D. 2,4, Ju Hyoung Lee,
More information(49-54)Kjhps004.hwp
Biliary Cystadenoma and Cystadenocarcinoma of the Liver Jae Hoon Lee, M.D., Dong Ho Choi, M.D. 1, Kyeong Geun Lee, M.D., Hwon Kyum Park M.D. and Kwang Soo Lee, M.D. Department of Surgery, College of Medicine,
More informationTable 1. Distribution by site and stage of laryngeal cancer Supraglottic Glottic Transglottic Total Stage Total 20
KISEP Head and Neck Korean J Otolaryngol 1999;42:1284-9 후두암수술환자에대한치료성적 송달원 김희준 정현수 김영한 안재현 이복수 박선호 Treatment Result in Laryngeal Cancer Patients Submitted to Surgical Treatment Dal Won Song, MD, Hee Jun
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More informationDV690-N_KOR_110216.indd
P/NO : MFL63266772 3 1 4 1 5 7 1 2 3 4 5 6 7 6 1 7 7 r t y u i - - - -, 7 1, 8 1 1 3 6 8 10 11 13? 12 14 15 16 17 18 a 1 b B c d e f c/v g C/V h M i Z j z k l 2 4 5 7 9 m w/s/a/d n b o p x q [ ] } r?
More information연구분야 ( 코드 ) 과제번호 과제성격 ( 기초, 응용, 개발 ) 응용실용화대상여부비실용화 연구과제명 과제책임자 세부과제 지원목적과제프로그램공개가능여부공개 ( 공개, 비공개 ) ( 국문 ) 전장유전체유전자다형데이터를이용한표적유전자의발굴 ( 영문 ) Ide
연구분야 ( 코드 ) 과제번호 1210360 과제성격 ( 기초, 응용, 개발 ) 응용실용화대상여부비실용화 연구과제명 과제책임자 세부과제 지원목적과제프로그램공개가능여부공개 ( 공개, 비공개 ) ( 국문 ) 전장유전체유전자다형데이터를이용한표적유전자의발굴 ( 영문 ) Identification of disease-related target genes through
More information°ø±â¾Ð±â±â
20, 30, 40 20, 30, 40 1 2 3 4 5 6 7 8 9 10 3.1 6.3 9.4 12.6 15.7 18.8 22.0 25.1 28.3 31.4 2.4 4.7 7.1 9.4 11.8 14.1 16.5 18.8 21.2 23.6 7.1 14.1 21.2 28.3 35.3 42.4 49.5 56.5 63.6 70.7 5.9 11.9 17.8 23.7
More informationÀÇÇа�ÁÂc00Ì»óÀÏ˘
Common Allergic Diseases in Children Sang - Il Lee, M.D. Department of pediatrics Sungkyunkwan University School of Medicine, Samsung Medical Center E - mail : silee@smc.samsung.co.kr Abstract Allergy
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More informationMicrosoft PowerPoint - 김미영
암세포의위험한여행 한국과학기술원 김미영 강의개요 전이란무엇인가? 전이는어떤과정을통해진행될까? 전이예측방법은어떤것들이있을까? Cancer ( 악성종양 ) US South Korea 질병사망률질병사망률 1. 심장병 26% 1. Cancer 26.7% 2. Cancer 23% 2. 뇌출혈 12.7% 3. 뇌출혈 5.6% 3. 심장병 7.9% >20,000 환자가악성종양에의해매일사망함
More information16(1)-3(국문)(p.40-45).fm
w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More information09구자용(489~500)
The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal
More information<3230B1C733C8A32DB8F1C2F72E687770>
대한내분비학회지 : 제 20 권제 3 호 2005 원저 갑상선유두암에서의 BRAF 변이와예후인자와의관계 충남대학교의과대학내과학교실 나소영 이준철 권기현 이효진 김군순 조영석 구본정 송민호 김영건 노흥규 The Relationship between the BRAF Mutations in Thyroid Papillary Carcinomas and the Prognostic
More informationJkbcs030(10)( ).hwp
Treatment of Breast Fibroadenoma with Interstitial Laser Photocoagulation Doo Min Sohn, Hyo Won Lee, Tae Yun Kim, Dan Song, Sung Yong Kim, Chul Wan Lim and Min Hyuk Lee Department of Surgery, College of
More information44-4대지.07이영희532~
A Spatial Location Analysis of the First Shops of Foodservice Franchise in Seoul Metropolitan City Younghee Lee* 1 1 (R) 0 16 1 15 64 1 Abstract The foodservice franchise is preferred by the founders who
More information550호(01-09)
T H E K O R E A N D O C T O R S W E E K L Y www.docdocdoc.co.kr I N S I D E 38 3 5 6 8 11 13 24 25 27 29 31 38 41 42 2 Advertisement Government & Medicine 3 Government & Medicine 4 Government & Medicine
More information<4D F736F F F696E74202D20B1E8BCB120B1B3BCF6B4D420B0ADBFACC0DAB7E1>
Outline 2012. 1. 30 CS4HS 생물정보학 생물정보학및암정보의학 맟춤의학과생물정보학 김선 서울대학교컴퓨터공학부생물정보연구소생물정보학협동과정 유전체학, 후생유전체학을이용한암연구와맟춤의학 1 2 Central Dogma in Biology PART1. 생물정보학 http://en.wikipedia.org/wiki/central_dogma_of_molecular_biology
More information歯제7권1호(최종편집).PDF
********* (*, **, *** ).., 2002, 7, 1, 1-12. 2-5 80.,.,..,,... :,,. (naming).., (word finding), (lexical look- up), (lexical retrieval), (word recall) (Fried- Oken, 1987). (pause),,, (naming error) (Snyder
More information<30352EB0A3BAB4B8AE2E687770>
The Korean Journal of Hepatology 2007 ; 13 : 571-575 DOI: 10.3350/kjhep.2007.13.4.571 이번 호의 간 병리(32) 혼합 간세포-담관세포암종 순천향대학교병원 병리과 진윤미 진소영 Combined Hepatocellular-cholangiocarcinoma Yoon-Mi Jeen, M.D. and
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More information연하곤란
2015.03.04 부울경소화기내시경지회 Intramucosal gastric cancer: The rate of lymph node metastasis in signet ring cell carcinoma was as low as that in welldifferentiated adenocarcinoma 인제대부산백병원 소화기내과 지삼룡 Signet ring
More informationjaeryomading review.pdf
4 5 6 7 8 9 10 11 12 13 1. S. Kim, H. Y. Jeong, S. K. Kim, S. Y. Choi and K. J. Lee, Nano Lett. 11, 5438 (2011). 2. E. Menard, K. J. Lee, D. Y. Khang, R. G. Nuzzo and J. A. Rogers, Appl. Phys. Lett. 84,
More information<C7D1B1B9B1A4B0EDC8ABBAB8C7D0BAB85F31302D31C8A35F32C2F75F303132392E687770>
버스 외부 광고의 효과에 관한 탐색적 연구 : 매체 접촉률과 인지적 반응을 중심으로 1) 고한준 국민대학교 언론정보학부 조교수 노봉조 벅스컴애드 대표 이사 최근 몇 년 사이 옥외 광고나 인터넷 광고 등 BTL(Below the Line) 매체가 광고 시장에서 차지하 는 비중이 점점 높아지고 있다. 버스 외부 광고는 2004년 7월 서울시 교통체계개편 이후 이용자
More informationChapter 26
11 주 RNA 합성 11.1 DNA-dependent synthesis of RNA: Bacteria에서의 transcription l RNA polymerase (5 subunits로구성 : 2α, β, β, σ) l 효소에의한 RNA 합성의특징 - Complementary sequence to template DNA - RNA chain의합성방향 : 5
More informationA Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
More information<313920C0CCB1E2BFF82E687770>
韓 國 電 磁 波 學 會 論 文 誌 第 19 卷 第 8 號 2008 年 8 月 論 文 2008-19-8-19 K 대역 브릭형 능동 송수신 모듈의 설계 및 제작 A Design and Fabrication of the Brick Transmit/Receive Module for K Band 이 기 원 문 주 영 윤 상 원 Ki-Won Lee Ju-Young Moon
More informationMay 10~ Hotel Inter-Burgo Exco, Daegu Plenary lectures From metabolic syndrome to diabetes Meta-inflammation responsible for the progression fr
May 10~12 2012 Hotel Inter-Burgo Exco, Daegu Plenary lectures From metabolic syndrome to diabetes Meta-inflammation responsible for the progression from obesity to metabolic syndrome originates in the
More information04조남훈
Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache
More information19(1) 02.fm
Korean J. Crystallography Vol. 19, No. 1, pp.7~13, 2008 Ÿ (ICISS) w š t w (2): t w y w œw Surface Structure Analysis of Solids by Impact Collision Ion Scattering Spectroscopy (2): Atomic Structure of Semiconductor
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More information,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012). (2007) 26%., (,,, 2011;, 2006;
,,.. 400,,,,,,.,,, -, -, -., 3.. :, Tel : 010-9540-0640, E-mail : sunney05@hanmail.net ,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012).
More information현대패션의 로맨틱 이미지에 관한 연구
한지닥섬유제품의인체생리반응및쾌적성평가 임순 Evaluation of Thermal Physiological Responses and Comfort in Dox Fabric Soon Im Professor, Dept. of Fashion Industry, Incheon National University This study performed the evaluation
More informationuntitled
대한내분비외과학회지 : 제10권제3호 Vol. 10, No. 3, September 2010 원저 갑상선미세유두암에서종양크기의구분에따른임상병리학적특징의분석 가톨릭대학교의과대학대전성모병원외과학교실 조윤정ㆍ이동호ㆍ이상철ㆍ김세준ㆍ김정구ㆍ안창준ㆍ이관주 Analysis of Clinicopathologic Features of Papillary Thyroid Microcarcinoma
More information7월웹진
최근연구소식 최근의연구동향을이해할수있도록몇편의논문을요약하여하나의주제로소개합니다. 새로운항암치료타겟인 c-met 저해제의연구현황 Livio Trusolino, Andrea Bertotti and Paolo M. Comoglio (2010) MET signalling: principles and function in development, organ regeneration
More information2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285
13 2 ( 25 ) 2004 12 Korean J Med Hist 13 284 296 Dec 2004 ISSN 1225 505X 1) * ** ** 1 1920 1930 40 ( 1896-1973) 80 * ** 1) 2003 284 2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
More information02À±¼ø¿Á
Geomorphic Development of Marine Terraces at Jeongdongjin-Daejin area on the East Coast, Central Part of Korean Peninsula Soon-Ock Yoon*, Sang-Ill Hwang** and Hak-Kyun Ban*** Abstract : In this paper we
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More informationTrd022.hwp
김신태, 이선녕, 이석정, 정필문, 박홍준, 신명상, 김종환, 이부길, 김상하, 리원연, 신계철, 용석중 Shin-Tae Kim, M.D., Shun Nyung Lee, M.D., Seok Jeong Lee, M.D., Pil Moon Jung, M.D., Hong Jun Park, M.D., Myung Sang Shin, M.D., Chong Whan Kim,
More information27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
More informationStudy on the Improvement of Management System through Analysis of golf semi- market: Focus on Physical Education Facility Act Ji-Myung Jung 1, Ju-Ho Park 2 *, & Youngdae Lee 3 1 Korea Institute of Sport
More information<C8ADB7C220C5E4C3EBC0E52E687770>
하동 화력 7 8호기 건설부지 문화재 지표조사 결과보고서 2005. 01. ( 재) 우리문화재연구원 하동 화력 7 8호기 건설부지 문화재지표조사 결과보고서 Ⅰ. 조사개요 1. 조 사 명 : 하동 화력 78 호기 건설부지 문화재지표조사 2. 조사지역 : 경남 하동군 금성면 가덕리 1336답 일원 3. 조사 면적 : 134,204m2 4. 조사 목적 한국남부발전(
More information충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~ Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교
충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~5 2017 Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교의과대학마취통증의학교실, 의학연구소 (28644), happycat19@hanmail.net
More informationMinimally invasive parathyroidectomy
2013. 2. 2 대한간암연구학회 7차 심포지움 및 학술대회 Indication and Clinical Outcomes of Metachronous HCC Metastasectomy Shin Hwang Division of Liver Transplantation and Hepatobiliary Surgery, Department of Surgery, Asan
More informationhttp://www.kbc.go.kr/pds/2.html Abstract Exploring the Relationship Between the Traditional Media Use and the Internet Use Mee-Eun Kang This study examines the relationship between
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More information02이용배(239~253)ok
A study on the characteristic of land use in subcenter of Seoul. - Cases of Yeongdeungpo and Kangnam Ok Kyung Yuh* Yong-Bae Lee**,. 2010,,..,.,,,,.,,.,,.,,,, Abstract : This study analyzed the land use
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More information( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
More information목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적
用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure
More informationÀå¾Ö¿Í°í¿ë ³»Áö
Disability & Employment 55 Disability & Employment 56 57 Disability & Employment 58 59 Disability & Employment 60 61 Disability & Employment 62 63 Disability & Employment 64 65 Disability & Employment
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
More information포도.PDF
/ / / / 1. - 93 10a 26 (77%), (15 %), (11%), (10%),,,,. 10.,,,,,,,, 65.4 %, 5 4 6.6% 98 3 ha 90 2, 40 3. 97, 92.5 %, 90,,,,,,, 96 8% 96 2% 2. 8 9. 4 77% 95 < > ( : kg/ ) ( ) (%) 92 1,708 2,489 572 1,9
More information???춍??숏
Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY
More informationuntitled
대한내분비외과학회지 : 제12권제2호 Vol. 12, No. 2, June 2012 원저 세포흡인검사에서 Peptide Nucleic Acid-Mediated PCR Clamping 법을이용한 BRAF V600E 유전자변이검사 동아대학교의과대학 1 이비인후-두경부외과학교실, 5 외과학교실, 6 병리학교실 2 영상의학과학교실, 3 내분비내과학교실, 4 핵의학교실,
More information<B9AEC8ADB0E6C1A6BFACB1B820C1A63137B1C720C1A633C8A3283135303131332033C2F720BCF6C1A4BABB292E687770>
한국문화경제학회 문화경제연구 제17권 제3호, 2014년 12월, pp.189~223 드라마 제작 영유 기업들의 변화와 성장: 상장기업을 중심으로 7년간의 사업현황 검토 김 훈 * 김 정 훈 ** 목 차 Ⅰ. 서 론 Ⅱ. 국내 엔터테인먼트 시장규모 및 제작시장 현황 Ⅲ. 상장기업 경영 현황 조사결과 Ⅳ. 결론 및 시사점 한국 드라마산업은 한류를 이끄는 주요산업으로
More information