DBPIA-NURIMEDIA
|
|
- 승훈 뇌
- 5 years ago
- Views:
Transcription
1 J Korean Soc Food Sci Nutr 한국식품영양과학회지 (12), 1662~1667(11) 검정콩껍질유래안토시아닌의 RBL-2H3 세포에서탈과립화와사이토카인생성저해효과 정미자 1 하태정 2 최하나 1 이지선 1 박용일 1 1 가톨릭대학교생명공학과 2 농촌진흥청국립식량과학원기능성작물과 Inhibitory Effects of Anthocyanins Isolated from Black Soybean (Glycine max L.) Seed Coat on Degranulation and Cytokine Generation in RBL-2H3 Cells Mi Ja Chung 1, Tae Joung Ha 2, Ha Na Choi 1, Ji Sun Lee 1, and Yong Il Park 1 1 Dept. of Biotechnology, The Catholic University of Korea, Gyeonggi-do 4-743, Korea 2 Dept. of Functional Crop, National Institute of Crop Science (NCIS), Rural Development Administration (RDA), Gyeongnam 627-3, Korea Abstract Anthocyanins belong to a group of flavonoid compounds and are well known for their various health beneficial effects, which include antioxidative activities. Among them, the major anthocyanins isolated from seed coat of black soybean (Glycine max L.) were previously characterized as glycosides containing glucopyranose. Asthma is an allergic disease that is strongly associated with various immune cells, including basophils and mast cells. Eosinophils, basophils, and mast cells play important roles in allergic asthma through the release of inflammatory mediators such as asthma-specific T-helper 2 (Th2) cytokines and subsequent amplification of asthma symptoms via degranulation. Rat basophilic leukemia RBL-2H3 cells are the most common in vitro models for evaluating allergic reactions. In this study, we examined the effects of anthocyanin from seed coat of black soybean on antigen-stimulated degranulation and Th2 cytokine production in RBL-2H3 cells. Cell degranulation was evaluated by measuring the release of β-hexosaminidase. β-hexosaminidase release and Th2 cytokine production in RBL-2H3 cells was much higher upon stimulation with IgE-antigen complex than those in untreated control cells. Anthocyanins significantly suppressed IgE-antigen complex-induced degranulation of RBL-2H3 cells and inhibited IgE-antigen complex-mediated interleukin (IL)-4, IL-13, and tumor necrosis factor α (TNF-α) production in RBL-2H3 cells. These findings suggest that anthocyanins from seed coat of black soybean effectively inhibit allergic reactions and may have beneficial effects against allergic asthma. Key words: black soybean, anthocyanins, cytokines, RBL-2H3 cells, allergy 서론급속한산업발달에의한환경오염과바쁜현대인들은인공합성물질이함유되어있는다양한가공식품섭취로인해알레르기 (allergy) 를유발시키는알레르겐 (allergen) 이노출된환경에살아가고있다. 천식은면역글로불린 (immunoglobulin E, IgE) 관련 type I 알레르기반응으로 T helper 2(Th2) 세포에의해서조절되며비만세포, 호염기구그리고호산구가중요한역할을하는염증반응이다. 그발생기전을알아보면, 먼저 IgE 항체생성과감작의단계이며, 외부로부터천식의원인물질인항원이들어오면이항원을제거하기위해대식세포가활성화되고, 이대식세포는항체를생산하도록 B 세포를자극하여항원 특이성 IgE를생산한다. 생성된 IgE 항체는비만세포나호염기구의세포막표면에있는 FcƐRI 수용체에항원과결합되면비만세포및호염기구가활성화되어, 탈과립이일어나초기천식반응을유발하게된다 (1). 이후항원에노출된 B 세포는 CD4 T 세포를자극하여 Th2 세포로분화되고, 분화된 Th2 세포는 Interleukin(IL)-4, 5, 6 그리고 13 등과같은사이토카인등여러가지화학적매개물질이유리하여호산구를자극하고후기알레르기성기도반응인천식을유발하게된다 (2,3). IL-4는 B 세포를자극하여 IgE 생산을촉진시키고, 염증세포들을자극하여염증매개물질들을분비시켜기관지과민성과기도폐쇄를일으켜천식증상을일으키며, IL-13은 IL-4와동등한생물학적역할을수행한다 (4). 전염증성사이 Corresponding author. yongil382@catholic.ac.kr Phone: , Fax:
2 검정콩껍질유래안토시아닌의 RBL-2H3 세포에서탈과립화와사이토카인생성저해효과 1663 토카인 (proinflammatory cytokines) tumor necrosis factor α(tnf-α) 는천식유발모델마우스의폐조직, 기관지폐포세척액 (bronchoalveolar lavage fluid, BALF) 및 rat basophilic leukemia RBL-2H3 세포를이용한알레르기모델에서증가하였다 (5,6). 따라서알레르기성천식을예방, 개선및치료효과를가진천연물탐색에 IL-13, IL-4 그리고 TNFα가중요한지표로사용되고있다. 알레르기성질환으로는천식외에비염, 아토피성피부염등이있으며이들질병들은해마다증가하고있어, 심각한사회문제로대두되고있으나이들질병들을완전하게치료할수있는치료제는아직개발되지않았고, 시판되고있는치료제들중일부는부작용들이알려져있다 (5). 따라서이들질병들을예방, 개선및치료할수있고부작용을최소화할수있는천연물유래항알레르기천연소재발굴에대한연구들이활발하게진행되고있다 (6,7). 안토시아닌 (anthocyanins) 은검정콩을비롯한식품의꽃, 과실, 줄기, 잎, 뿌리등에존재하는수용성색소배당체 (glucoside) 로안토시아닌과결합된당의종류와아실기의종류및결합위치에따라수백종으로구분되며그생리활성도차이가있다 (8). 안토시아닌은장관에서의흡수도매우용이하며노화억제작용, 항균작용, 돌연변이성억제작용, 강력한항산화력에의한폐에서급성염증개선작용등이알려져있다 (8,9). 안토시아닌의다양한생리활성은보고되었지만검정콩껍질에서분리된안토시아닌의항알레르기효과에대해서는불명확하다. 따라서본연구에서는검정콩껍질에서분리한안토시아닌의항알레르기효과및분자생물학적기전을밝히기위하여 IgE-항원복합체자극에의해활성화된 rat basophilic leukemia RBL-2H3 세포에서탈과립화및천식관련사이토카인 (IL-4, IL-13 그리고 TNF-α) 발현억제효과를측정하여항알레르기효과와관련건강기능식품, 의약품등에검정콩껍질에서분리한안토시아닌이이용될수있을지그가능성을살펴보고자한다. 재료및방법시료의추출및분석본실험에사용된안토시아닌은농촌진흥청국립식량과학원 [National Institute of Crop Science(NICS)] 에의해품종개량한검정콩 [Glycine max(l.) Merr., cv. Cheongja 3] 껍질로부터 Lee 등 (1) 에의해서술된방법을사용하여분리하였다. 분리된안토시아닌은 cyanidin-3-o-glucoside(68.3 %), delphinidin-3-o-glucoside(25.2%) 및 petunidin-3-oglucoside(6.5%) 가함유되어있는혼합물이고그들의순도와조성은 HPLC로분석하였다 (1). DPPH 라디칼소거활성측정 DPPH 라디칼소거능은 Chung 등 (11) 의방법에의하여일정농도의안토시아닌과 1,1-diphenyl-2-picrylhydrazyl (DPPH) 용액을가하여잘혼합한다음 37 o C에서 3분간반응시킨후 517 nm에서흡광도를측정하였다. DPPH 라디칼소거활성은대조구에대한시료첨가구의흡광도를비교하여 (1-시료의흡광도 / 대조구의흡광도 ) 에의하여 % 로나타내었다. 세포배양 RBL-2H3세포는 Korea Cell Line Bank(Seoul, Korea) 에서구입하여 1% fetal bovine serum(gibco-brl, Grand Island, NY, USA) 과 1% penicillin-streptomycin을넣은 Eagle s minimum essential medium(mem; Gibco-BRL) 배양액으로 5% CO 2 가공급되는배양기에서 37 o C 조건으로배양한다. 세포생존율측정 RBL-2H3 세포는 96-well plates에 cells/ml의밀도로깔아주고 24시간동안배양한후세포를무혈청배지로세척하고안토시아닌처리 12시간전에 FBS가무첨가된배지로교체하였다. 세포생존율은 Huang 등 (12) 의방법과같이처리한후 MTT[3-(3,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide] 환원방법을이용하여측정하였다. Cellular antioxidant activity assay(caa assay) 세포내활성산소종 (reactive oxygen species, ROS) 의양을측정하는방법으로 ROS 수준은 2',7'-dichlorofluorescin diacetate(dcfh-da) probe를이용하여측정하였다. DCFH- DA는세포막을통과하여세포질에서세포내 esterase에의해비형광물질인 dichlorofluorescin(dcfh) 으로가수분해된다. DCFH는세포내활성산소종에의해형광을띄는 DCF로전환된다 (13). DNP-IgE(.5 μg/ml) 를함유한배지로 24시간배양하였고, Siraganian buffer(119 mm NaCl, 5 mm KCl, 25 mm PIPES, 5.6 mm glucose, 1 mm CaCl 2,.4 mm MgCl 2,.1% BSA, ph 7.2) 로 3회세척한후 Siraganian buffer를넣고 1분간배양한다음, 5, 1, 25 그리고 5 μg/ml의 anthocyanins이함유된 MEM로 2시간배양하였다. Siraganian buffer로세포를 3회세척한후 2시간동안 DNP-HSA(2 μg/ml) 를처리하였다. 배지를제거한후 1 μm DCFH-DA가함유된 PBS를넣어 37 C에서 45분동안인공배양시켰다. PBS로남아있는 DCFH-DA probe를제거한후 PBS를넣어 5분간 37 o C에서반응시킨후 DCF의형광은 fluorescence reader(biotek, Winooski, VT, USA) 로파장 495 nm(excitation) 와 525 nm(emission) 에서측정하였다. DCF 형광광도는안토시아닌과 DNP-BSA를처리하지않는대조군을 % 로하였을때상대적인양을계산하였다. β-hexosaminidase 측정및 RT-PCR 를위한시료준비 β-hexosaminidase 방출정도는 Huang 등 (12) 의방법을
3 1664 정미자 하태정 최하나 이지선 박용일 일부변경하여측정하였다. 즉, 24-well plates에 RBL-2H3 세포 (2 1 5 cells/ml) 를 24시간동안배양한후세포를무혈청배지로세척하고 FBS가무첨가된배지로교체하여 2시간배양하였다. DNP-IgE(.5 μg/ml) 를함유한배지로 24시간배양하였고, Siraganian buffer(119 mm NaCl, 5 mm KCl, 25 mm PIPES, 5.6 mm glucose, 1 mm CaCl 2,.4 mm MgCl 2,.1% BSA, ph 7.2) 로 3회세척한후 Siraganian buffer를넣고 1분간배양한다음, 5, 1, 25 및 5 μg/ml의안토시아닌이함유된 MEM로 2시간배양하였다. Siraganian buffer로세포를 3회세척한후 2시간동안 DNP-HSA(2 μg/ ml) 를처리하였다. 각 plate를 1분간 ice bath에서둠으로써반응을종결시켰고상층액은 β-hexosaminidase 방출정도를확인하기위해사용하였으며세포는 RT-PCR를위한시료로사용하였다. 96-well plate에상층액 μl와 substrate buffer[2 mm 4-p-nitrophenyl-N-acetyl-β-D-glucosaminide in.1 M sodium citrate buffer(ph 4.5)] μl를넣어섞은후 37 o C에서 1시간동안반응시켰다. 반응정지를위해.1 M Na 2CO 3/NaHCO 3(pH 1.) 용액 μl를더한후 microplate reader(versamax, Molecular Devices, Sunnyvale, CA, USA) 를이용하여 5 nm에서흡광도를측정하였다. Total RNA 추출및 RT-PCR 24-well plates에서배양한 RBL-2H3 세포에 TRIzol Reagent(Invitrogen, Carlsbad, CA, USA) 를.5 ml씩가하여완전히마쇄시킨후 Invitrogen사에서제공한제품사용설명서에따라 RNA를추출하였다. 본연구에 First-stand cdna를생산하기위하여 Power cdna synthesis kits (Intron, Seongnam, Korea) 와 oligo(dt) 15 primer(5 μg/ ml) 를이용하여 Intron사에서제공한제품사용설명서에따라 cdna를합성하였다. PCR를합성한 cdna 1 μl와각 primer 2 μl(forword와 reverse, 1 pmol/μl) 를 Maxime PCR PreMix kit(intron) 에더한후 RNase-free water 17 μl를넣어최종부피 μl로맞춘후 PCR를수행하였다. 본실험에사용한 primers는아래와같다. TNF-α, F, 5'- CGGAATTCGGCTCCCTCTCATCAGTTC 그리고 R, 5'- GCTCTAGACCCTTGAAGAGAACCTGGG; IL-4, F, 5'- ACCTTGCTGTCACCCTGTTC and R, 5'-TTGTGAGC- GTGGACTCATTC; and IL-13, F, 5'-GCTCTCGCTT- GCCTTGGTGGTC 그리고 R, 5'-CATCCGAGGCCTT- TTGGTTAGAG, GAPDH(F, 5'-ACCACAGTCCATGC- CATCAC 그리고 R, 5'-TCCACCACCCTGTTGCTGTA) 였다. TNF-α, IL-4 그리고 IL-13의 PCR 조건을보면, 94 o C 에서 2분, 94 o C에서 초, o C에서 3초, 72 o C에서 초, 72 o C에서 5분이었고, 내부표준유전자로사용한 GAPDH의 annealing 온도는 55 o C였다. PCR 산물은.2% ethidium bromide가첨가된 2% agarose gel에 V에서 3시간전기영동한후자외선광으로유전자발현정도를알아보았다. Cell viability (%) Anthocyanins (µg/ml) Fig. 1. Cytotoxic effect of anthocyanins on RBL-2H3 cells. The data are the means±sd (n=4). 그밴드의강도를 SigmaGel(Jandel Scientific, San Rafael, CA, USA) 소프트웨어에의해분석정량하였다. 통계처리 실험에서얻어진결과의통계적유의성은 GraphPad InStat Version 3.5(GraphPad, San Diego, CA, USA) 통계 package를이용하여평균 ± 표준오차로표시하였고, 각농도평균차의통계적유의성을 Tukey-Kramer multiple comparisons test에의해검정하였다. 결과및고찰 세포독성및세포내 ROS 생성에안토시아닌이미치는영향세포내세포독성을측정한결과, 5, 1, 25, 5 및 μg/ml 안토시아닌을처리했을때세포독성이나타나지않았다 (Fig. 1). 따라서, 5, 1, 25 및 5 μg/ml를계속되는실험에사용하였다. RBL-2H3 세포내에항원 (DNP-HSA) 처리시 ROS 생산이유도되었고, 안토시아닌처리시 ROS 생성이억제되었다 (Fig. 2A). 한편, 검정콩껍질에서분리된안토시아닌이 DPPH 라디칼소거작용이있는지확인한결과안토시아닌은농도의존적으로 DPPH 라디칼을소거하였다 (Fig. 2B). RBL-2H3 세포내에서 IgE+DNP-HSA와같은다양한자극에반응하여 ROS가발생할수있다 (13). Han 등 (13) 은구아바에틸아세테이트분획물이 DNP-HSA에의해유도된 ROS 생성을현저하게줄였다고보고하였다 (13). 카마로사 (Camarosa) 종의딸기로부터분리한안토시아닌은항산화효과가있고 (14), 검정콩껍질에서분리된안토시아닌역시 DPPH radical 소거작용, LDL 산화억제, thiobarbituric acid reactive substances(tbars) 생성억제효과가있는것으로알려져있으나 (15), 세포내 ROS를감소할수있는지에대한연구는전무하다. 본연구에서안토시아닌처리는항원에의해증가된세포내 ROS를감소시켰고, 이는검정콩껍
4 . 검정콩껍질유래안토시아닌의 RBL-2H3 세포에서탈과립화와사이토카인생성저해효과 1665 DCF fluoresence (% of control). DPPH radical scavenging ability (%) A Antho Antho + Antho 5 + Antho 1 + Antho 25 + Antho 5 + DNP-HSA DNP-HAS DNP-HAS DNP-HSA DNP-HAS DNP-HSA DNP-HAS DNP-HSA DNP-HSA DNP-HAS Antocyanins (Antho) (µg/ml) B Anthocyanins (µg/ml) Fig. 2. Effects of anthocyanins on antigen-induced intracellular ROS production (A) in RBL-2H3 cells and DPPH radical scavenger activity (B). The data are the means±sd (n=4). p<.5 vs. positive control (DNP-HSA); p<.1 vs. positive control (IgE+DNP-HSA); p<.1 vs. control. 질에서분리한안토시아닌의강한항산화효과에기인된것으로생각되며이와같은항산화력은알레르기질환개선에유익한영향력을미칠것으로생각된다. 안토시아닌이 β-hexosaminidase 방출에미치는영향 검정콩껍질에서분리한안토시아닌이 RBL-2H2 세포내 β-hexosaminidase 방출에미치는영향력을 Fig. 3에나타내었다. IgE 감작후 DNP-HSA 처리는현저하게 β-hexosaminidase 방출을증가시켰고, 이들증가는안토시아닌처리에의해농도의존적으로 β-hexosaminidase 방출을억제하였으며 5 μg/ml 안토시아닌처리에의해 43.8% 감소하였다 (Fig. 3). 항천식효과를알아보기위하여 IgE로부터감작된비만세포에항원을처리하여활성화된비만세포에서유리된히스타민의양을측정하였으나이방법은비만세포에서히스타민농도가매우낮으므로세포내많이함유되어있고히스타민과함께분비되는 hexosaminidase 활성을측정함으로써탈과립정도를알수있다 (16). 비만세포 (mast cells) 와호염기세포 (basophils) 는고친화성 (high-affinity) IgE 수용체인 FcεRI를가지고있고히스타민 (histamine) 과여러가지사이토카인 (cytokines) 과같은염증매개체 (inflammatory Sescetion of β-hexosaminidase. (% of control). Antho Antho + Antho 5 + Antho 1 + Antho 25 + Antho 5 + DNP-HAS DNP-HSA DNP-HAS DNP-HSA DNP-HAS DNP-HSA DNP-HAS DNP-HSA DNP-HAS DNP-HSA Fig. 3. Effect of anthocyanins on β-hexosaminidase release in IgE-antigen complex-stimulated RBL-2H3 cells. The data are the means±sd (n=4). p<.1 vs. positive control (DNP- HSA); p<.1 vs. positive control (IgE+DNP-HSA). mediators) 를방출하여알레르기질환발병에중요한역할을한다 (17). 따라서항알레르기기전연구에서비만세포와유사한기전을가진 rat basophilic leukemia RBL-2H3 세포를모델로많이사용하고있으며, Vo 등 (6) 과 Kato 등 (18) 은 RBL-2H2 세포내탈과립및사이토카인생성량을측정하여알레르기염증반응억제에의한항알레르기효과를가진천연물질을탐색하였다. RBL-2H2 세포에쑥으로부터분리된 eupatilin과 jaceosidin 처리는 IgE-DNA-HSA 복합체에의해유도된 β-hexosaminidase 분비를현저하게억제하였고 (7), RBL-2H3 세포에키토올리고당 (chitoologosaccharides) 을처리했을때 calcium ionophore A23187에의해증가된 β-hexosaminidase 과 histamin 분비를현저하게감소하였다 (6). 본연구결과안토시아닌도이들연구과유사한경향을나타내었다. 세포의탈과립정도를알수있는 histamin과 β-hexosaminidase 방출저해효과를가진천연소재발굴은항알레르기신약개발및건강기능식품개발을가능하게할수있을것이다 (6,16). 본연구결과검정콩껍질에서분리된안토시아닌은탈과립화를억제함으로써항알레기기효과를나타나는신소재임을알수있었다. 안토시아닌이사이토카인발현에미치는영향 IgE-항원 (DNA-HSA) 에의해활성화된 RBL-2H3 세포내안토시아닌처리가 IL-4, IL-13 그리고 TNF-α 발현에미치는영향은 Fig. 4와같다. IgE에의해감작된 RBL-2H3세포에 DNA-HSA를처리했을때 IL-4, IL-13 그리고 TNF-α mrna 발현이현저하게증가하였고, 안토시아닌처리는이들사이토사인발현을현저하게감소시켰다. 5 μg/ml 안토시아닌을처리했을때 IL-4, IL-13 그리고 TNF-α mrna 수준이 IgE-DNA-HSA 복합체만처리한군 (1배) 과비교하여각각.7,.7,.2배를나타내었다. Vo 등 (6) 과 Matsuda 등 (17) 은 DNP-HSA 또는 calcium
5 1666 정미자 하태정 최하나 이지선 박용일 Fold-induction of IL-4 mrna. Fold-induction of IL-3 mrna. Fold-induction of TNF-α mrna A Antho Antho + Antho 5 + Antho 1 + Antho 25 + Antho 5 + DNP-HAS DNP-HSA DNP-HSA DNP-HAS DNP-HSA DNP-HAS DNP-HSA DNP-HAS DNP-HSA DNP-HAS B Antho Antho + Antho 5 + Antho 1 + Antho 25 + Antho 5 + DNP-HAS DNP-HSA DNP-HSA DNP-HAS DNP-HSA DNP-HAS DNP-HSA DNP-HAS DNP-HSA DNP-HAS C Antho Antho + Antho 5 + Antho 1 + Antho 25 + Antho 5 + DNP-HSA DNP-HAS DNP-HSA DNP-HAS DNP-HAS DNP-HSA DNP-HSA DNP-HAS DNP-HSA DNP-HAS Fig. 4. Effect of anthocyanins on mrna expression of the IL-4, IL-13 and TNF-α. The data are the means±sd (n=3). p<.5; p<.1; p<.1 vs. positive control (IgE+DNP- HSA). The amount of IL-4, IL-13 and TNF-α mrna in each sample was normalized to the amount of GAPDH. The fold-induction of each mrna species was calculated as the ratio of the level of mrna in treated cells to that of the corresponding mean value in control cells. ionophore A23187에의해활성화된 RBL-2H3 세포에서 TNF-α, IL-4 그리고 IL-13 mrna가현저히증가하였다고하였는데본연구결과와같은경향을나타내었다. 쑥에서분리된 eupatilin과 jaceosidin 처리가탈과립및알레르기관련사이토카인 (TNF-α 그리고 IL-4) 의발현감소를나타내어항알레르기효과를증명함으로써, eupatilin과 jaceosidin이천식과같은알레르기질병에활용될가능성을제시하였다 (7). 플라보노이드의일종인 sulfuretin은천식모델마우스의 BALF에서 TNF-α와 IL-13을감소시켰고알레르기기도염증감소효과를나타내었다고보고하였으며 (19), 도라지물추출물은천식동물모델의 BALF내 IL-4, IL-13 그리고 TNF-α 생성을억제시켰고항염증효과가있었다 (). 따라서본연구결과검정콩껍질에서분리한안토시아닌처리에의한 IL-4, IL-13 그리고 TNF-α의발현억제는염증반응관련알레르기성천식을개선및예방할수있을것을시사하고있다. 본연구결과검정콩껍질에서분리된안토시아닌은 β- hexodaminidase 방출및사이토카인생성을현저하게억제하였으므로항알레르기효과를나타내는건강기능식품개발등다양한산업적용도로사용가능할것으로생각된다. 요약안토시아닌 (anthocyanins) 은플라보노이드에속하고항산화활성들을포함한그들의다양한건강유익성에대해알려져있다. 그들중검정콩껍질에서분리한주요안토시아닌은 glycopyranose를함유하고있는배당체이다. 천식은호염기성세포 (basophils) 와비만세포 (mast cells) 를포함한다양한면역세포와관련된알레르기관련질병이다. 호산구 (eosinophils), 호염기성세포, 비만세포는탈과립화에의한천식-특이적보조 2(T-helper 2) 사이토카인분비그리고계속해서일어나는증폭과같은염증을일으키는매개체의증가를통해알레르기천식 (allergic asthma) 에서중요한역할을한다. 흰쥐호염기성백혈병 (rat basophilic leukemia) RBL-2H3 세포는알레르기반응을측정하기위해가장일반적으로사용되는 in vitro 모델이다. 본연구에서는검정콩껍질안토시아닌이항원으로자극한 RBL-2H3 세포에서탈과립그리고 Th2 사이토카인생산에미치는효과를조사하였다. 세포탈과립은 β-hexosaminidase의방출을검출함으로써평가하였다. IgE-항원복합체로자극한 RBL-2H3 세포내 β-hexosaminidase 방출과 Th2 사이토카인생산이무처리군의그것과비교하여더높았다. 안토시아닌은 RBL- 2H3 세포의 IgE-항원복합체유도탈과립을현저하게억제시켰고 RBL-2H3 세포내 IgE-항원복합체-매개체 interleukin(il)-4, IL-13 그리고 TNF-α 생산을저해하였다. 이러한결과는검정콩껍질유래안토시아닌이알레르기반응
6 검정콩껍질유래안토시아닌의 RBL-2H3 세포에서탈과립화와사이토카인생성저해효과 1667 (allergic reaction) 을현저히저해하는효과가있음을보였고, 이들안토시아닌이향후알레르기천식을억제하거나개선하는데유용한물질로사용될가능성이있을것으로판단되었다. 감사의글 이논문은농촌진흥청의공동연구사업 (Project No. PJ718611) 과차세대바이오그린 21사업 ( 과제번호 : PJ718611), 11 가톨릭대학교교비연구비의지원으로이루어졌으며이에감사드립니다. 문 1. Fels AO, Cohn ZA The alveolar macrophages. J Appl Physiol : Larche M, Robinson DS, Kay AB. 3. The role of T lymphocytes in the pathogenesis of asthma. J Allergy Clin Immunol 111: Romagnami S. 1. T-cell responses in allergy and asthma. Curr Opin Allergy Clin Immunol 1: Oshita A, Hamelmann E, Haczku A, Takeda K, Conrad DH, Kikutani H, Gelfand W Modulation of antigen-induced B and T cell responses by antigen-specific IgE antibodies. J Immunol 159: Lee MY, Seo CS, Lee JA, Lee NH, Kim JH, Ha HK, Zheng MS, Son JK, Shin HK. 11. Anti-asthmatic effects of Angelica dahurica against ovalbumin-induced airway inflammation via upregulation of heme oxygenase-1. Food Chem Toxicol 49: Vo TS, Kong CS, Kim SK. 11. Inhibitory effects of chitooligosaccharides on degranulation and cytokine generation in rat basophilic leukemia RBL-2H3 cells. Carbohyd Polym 84: Lee SH, Bae EA, Park EK, Shin YW, Baek NI, Han EJ, Chung HG, Kim DH. 7. Inhibitory effect of eupatilin and jaceosidin isolated from Artemisia princepsin IgE-induced hypersensitivity. Int Immunopharmacol 7: Lila MA. 4. Anthocyanins and human health: an in vitro investigative approach. J Biomed Biotechnol 4: Amorini AM, Lazzarino G, Galvano F, Fazzina G, Tavazzi B, Galvano G. 3. Cyanidin-3-O-beta-glucopyranoside 헌 protects myocardium and erythrocytes from oxygen radical-mediated damages. Free Radic Res 37: Lee JH, Kang NS, Shin SO, Shin SH, Lim SG, Suh DY, Baek IY, Park KY, Ha TJ. 9. Characterization of anthocyanins in the black soybean (Glycine max L.) by HPLC- DAD-ESI/MS analysis. Food Chem 112: Chung MJ, Sung NJ, Park CS, Kweon DK, Mantovani A, Moon TW, Lee SJ, Park KH. 8. Antioxidant and hypocholesterolemic activities of water-soluble puerarin glycosides in HepG2 cells and in C57 BL/6J mice. Eur J Pharmacol 578: Huang F, Yamaki K, Tong X, Fu L, Zhang R, Cai Y, Yanagisawa R, Inoue KI, Takano H, Yoshino S. 8. Inhibition of the antigen-induced activation of RBL-2H3 cells by sinomenine. Int Immunopharmacol 8: Han EH, Hwang YP, Kim HG, Park JH, Choi JH, Im JH, Khanal T, Park BH, Yang JH, Choi JM, Chun SS, Seo JK, Chung YC, Jeong HG. 11. Ethyl acetate extract of Psidium guajava inhibits IgE-mediated allergic responses by blocking FcεRI signaling. Food Chem Toxicol 49: Cerezo AB, Cuevas E, Winterhalter P, Garcia-Parrilla MC, Troncoso AM. 1. Isolation, identification, and antioxidant activity of anthocyanin compounds in Camarosa strawberry. Food Chem 123: Astadi IR, Astuti M, Santoso U, Nugraheni PS. 9. In vitro antioxidant activity of anthocyanins of black soybean seed coat in human low density lipoprotein (LDL). Food Chem 112: Wendeler M, Sandhoff K. 9. Hexosaminidase assays. Glycoconjugate J 26: Matsuda H, Wang Q, Matsuhira K, Nakamura S, Yuan D, Yoshikawa M. 8. Inhibitory effects of thunberginols A and B isolated from Hydrangeae Dulcis Folium on mrna expression of cytokines and on activation of activator protein-1 in RBL-2H3 cells. Phytomedicine 15: Kato N, Motohashi S, Okada T, Ozawa T, Mashima K. 8. PICOT, protein kinase C θ-interacting protein, is a novel regulator of FcεRI-mediated mast cell activation. Cell Immunol 251: Song MY, Jeong GS, Lee HS, Kwon KS, Lee SM, Park JW, Kim YC, Park BH. 1. Sulfuretin attenuates allergic airway inflammation in mice. Biochem Biophys Res Commun : Choi JH, Hwang YP, Lee HS, Jeong HG. 9. Inhibitory effect of Platycodi Radix on ovalbumin-induced airway inflammation in a murine model of asthma. Food Chem Toxicol 47: (11 년 1 월 4 일접수 ; 11 년 1 월 12 일채택 )
Journal of Life Science 2011, Vol. 21. No μ μ
Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More informationμ
μ 초콩의제조중기능적특성비교 173 Table 1. Changes in total polyphenol contents of Chokong as affected by soaking time Extracting solvents Chokong 1) Soaking time (days) 1 4 7 10 14 Water 70% ethanol solution 23.46±4.62
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More informationMHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
More information농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다 년 2 월 11 일 - 1 -
농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다. 2013 년 2 월 11 일 - 1 - 연구기관명 : 부산대학교 연구책임자 : 정명호 연구원 : 손용해 연구원 : 장민경 - 2 - Ⅰ. 제목 팥의대사성질환개선및기능성규명 Ⅱ. 연구개발의목적및필요성 팥의대사성질환개선소재발굴과그기능성을과학적으로증명하기위해, 팥의당뇨,
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More informationÀÇÇа�ÁÂc00Ì»óÀÏ˘
Common Allergic Diseases in Children Sang - Il Lee, M.D. Department of pediatrics Sungkyunkwan University School of Medicine, Samsung Medical Center E - mail : silee@smc.samsung.co.kr Abstract Allergy
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and
More information- 2 -
- 1 - - 2 - - 3 - - 4 - μ μ μ μ μ μ μ α μ μ μ μ μ - 5 - μ μ μ μ - 6 - μ - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - μ μ μ α μ λ - 14 - μ μ μ μ μ - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22
More information2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세
본문제에대한지적소유권은동국대학교에있습니다. 본교의서면허락없이무단으로출판, 게재, 사용할수없습니다. 문제 2 2016 학년도약학대학면접문제 아래의질문에 3-4 분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신 인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세포의생존과증식
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More information11.fm
pissn 1229-1153 / eissn 2465-9223 J. Food Hyg. Saf. Vol. 30, No. 4, pp. 376~382 (2015) http://dx.doi.org/10.13103/jfhs.2015.30.4.376 Journal of Food Hygiene and Safety Available online at http://www.foodhygiene.or.kr
More information1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More informationStatistical Data of Dementia.
Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.
More information목차 1. 서론 줄기세포의간세포분화능평가시고려사항 간세포분화능평가시험법 분
세포치료제시험정보집 7 줄기세포치료제의 간세포분화능평가시험 2015. 4. 30. 식품의약품안전평가원 차세대줄기세포기반제제평가연구사업단 목차 1. 서론 --------------------------------------------- 1 2. 줄기세포의간세포분화능평가시고려사항 --------------- 2 3. 간세포분화능평가시험법 -----------------------------
More informationJkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
More information개최요강
55 2009. 5. ( ) ( ) < > 1. 1 2. 2. 2. 3 1) 3 2) 3 3) GC-MS 4. 5 1) 5 2) 5 3) ICP-OES 6 3. 7. 7 1) 7 2) 10. 13 1) 1g 13 2),,, 14 3), 15 4),, 15 4. 17 19 < > [ 1] 2 [ 2] ICP-OES 6 [ 3] 13 [ 4] 1g 13 [ 5]
More information- 1 -
11 1541000-001436-01 수출전략형신수요창출을위한홍마늘및바이오식품개발 (Development of red-garlic and its bio-food for create new market demand and develop of export items) - 1 - - 2 - - 3 - o o - 4 - o o - 5 - o α α - 6 - - 7
More information(00-1) Journal of Life.hwp
Journal of Life Science 2014 Vol. 24. No. 4. 386~392 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2014.24.4.386 산사 는장미과 의열 매로단맛과신맛이나고우리나라및중국 일본에자생하고 있는붉은색의열매로예로부터항비만
More informationjaeryomading review.pdf
4 5 6 7 8 9 10 11 12 13 1. S. Kim, H. Y. Jeong, S. K. Kim, S. Y. Choi and K. J. Lee, Nano Lett. 11, 5438 (2011). 2. E. Menard, K. J. Lee, D. Y. Khang, R. G. Nuzzo and J. A. Rogers, Appl. Phys. Lett. 84,
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More information???춍??숏
Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More informationProduct Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot
EZ-LDH Cell Cytotoxicity Assay Kit Cat. No. DG-LDH500 DG-LDH1000 FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. 1 ( 주 ) 대일랩서비스부설두젠생명공학연구소 Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는
More informationKISEP Otology Korean J Otolaryngol 2000;43: 마우스대식세포주에서항산화제및 Dexamethasone 이유발형산화질소합성효소발현과산화질소생성에미치는효과 강준명 여상원 이흥엽 장기홍 서병도 Effect of Antioxidants
KISEP Otology Korean J Otolaryngol 2000;43:136-42 마우스대식세포주에서항산화제및 Dexamethasone 이유발형산화질소합성효소발현과산화질소생성에미치는효과 강준명 여상원 이흥엽 장기홍 서병도 Effect of Antioxidants and Dexamethasone on inducible Nitric Oxide Synthase
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More information발간등록번호 전복소화분해시스템을활용한천연항알러지제품개발
발간등록번호 11-1541000-001498-01 전복소화분해시스템을활용한천연항알러지제품개발 . 2012 5 31 : : : : : : 17 1 Ⅰ. 제목 : 전복소화분해시스템을활용한천연항알러지제품개발 (Development of a natural anti-allergic product using abalone-gastrointestinal digestion
More informationAnalysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
More informationNo Slide Title
Antioxidant effect of Estrogen on Bovine aortic endothelial cells 가톨릭대학교의과대학서울성모병원산부인과김미란 Journal of Steroid Biochemistry and Molecular Biology 117 (2009) 74-80 Background Objectives Materials & Methods
More informationuntitled
산업표준심의회심의 2004 12 29 F 44032004 ( ) ( ) () () () () ( ) 1966 12 23 2004 12 29 041113 ( ) ( 025097239 40). 7 5,. ICS 91.100.30 KS Reinforced spun concrete pipes F 44032004 (.) A.... KS B 5533 KS D 4 KS
More information` Companies need to play various roles as the network of supply chain gradually expands. Companies are required to form a supply chain with outsourcing or partnerships since a company can not
More information,......
The Impact of Personal Traits, Family Characteristics, and Job Satisfaction on the Psychological Well-Being of Middle Aged Men from the Baby Boomer Generation Working in Large Corporations Department of
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More information노인정신의학회보14-1호
제14권 1호 통권 제23호 www.kagp.or.kr 발행인 : 정인과 / 편집인 : 이동우 / 발행처 : 정인과 (152-703) 서울특별시 구로구 구로동 80번지 고려대학교 구로병원 정신과 / TEL : 02-818-6608 / FAX : 02-852-1937 발행일 : 2008년 4월 30일 / 제 작 : (주)엠엘커뮤니케이션 140-846 서울특별시
More information이 발명을 지원한 국가연구개발사업 과제고유번호 KGM2420913 부처명 교육과학기술부 연구관리전문기관 연구사업명 전북분원운영사업 연구과제명 저탄소 녹생성장을 위한 바이오매스/에너지 개발 주관기관 한국생명공학연구원 연구기간 2009년 01월 01일 ~ 2009년 12월
(19) 대한민국특허청(KR) (12) 등록특허공보(B1) (45) 공고일자 2015년04월10일 (11) 등록번호 10-1509796 (24) 등록일자 2015년04월01일 (51) 국제특허분류(Int. Cl.) A61K 36/45 (2006.01) A23L 1/30 (2006.01) A61P 3/04 (2006.01) (21) 출원번호 10-2009-0108173
More information제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상
6차 산업 수익모델 시범사업 농산물가공품개발 연구용역 최 종 보 고 서 영남대학교 식품공학과 연구책임자 : 한 기 동 제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More information저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
More information- 1 -
- 1 - - 2 - - 3 - - 4 - - 5 - SUMMARY ( 영문요약문 ) - 6 - - 7 - - 8 - - 9 - cavenging - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 -
More information(....).hwp
sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More information도비라
광고학연구 : 제24권 5호(2013년) The Korean Journal of Advertising, Vol.24, No.5 (2013). pp.99 116 대학생 광고공모전이 광고업계 취업에 미치는 영향: 대학생과 실무자의 인식 비교를 중심으로 차 유 철 우석대학교 광고이벤트학과 교수, 언론학박사 이 희 복 상지대학교 언론광고학부 교수, 언론학박사* 신
More information목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적
用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure
More information10 (JLS_150240).hwp
Journal of Life Science 2016 Vol. 26. No. 3. 338~345 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2016.26.3.338 Antioxidant and Anti-inflammatory Effects of Extracts
More information유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012
11-1480523-001163-01 유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 목 차 ⅰ ⅲ ⅳ Abstract ⅵ Ⅰ Ⅱ Ⅲ i 목 차 Ⅳ ii 목 차 iii 목 차 iv 목 차 v Abstract vi Abstract σ ε vii Abstract viii Ⅰ. 서론 Ⅰ. 1 Ⅰ. 서론.
More information- 1 -
- 1 - - 2 - - 3 - - 4 - - 5 - - 6 - ι κ λ β β β β β - 7 - - 8 - - 9 - - 1 - - 11 - 마. - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 2 - - 21 - - 22 - - 23 - - 24 - ι κ λ β β - 25 - - 26 - -
More informationMicrosoft Word - 04-김택중.doc
J. Exp. Biomed. Sci. 2010, 16(2): 91~95 Anti-inflammatory Properties of Meso-dihydroguaiaretic Acid in Lipopolysaccharide-induced Macrophage Yong-Jae Kim *, Yeo-Jin Kang * and Tack-Joong Kim Division of
More informationuntitled
대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran
More informationIKC43_06.hwp
2), * 2004 BK21. ** 156,..,. 1) (1909) 57, (1915) 106, ( ) (1931) 213. 1983 2), 1996. 3). 4) 1),. (,,, 1983, 7 12 ). 2),. 3),, 33,, 1999, 185 224. 4), (,, 187 188 ). 157 5) ( ) 59 2 3., 1990. 6) 7),.,.
More information?
http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information<31325FB1E8B0E6BCBA2E687770>
88 / 한국전산유체공학회지 제15권, 제1호, pp.88-94, 2010. 3 관내 유동 해석을 위한 웹기반 자바 프로그램 개발 김 경 성, 1 박 종 천 *2 DEVELOPMENT OF WEB-BASED JAVA PROGRAM FOR NUMERICAL ANALYSIS OF PIPE FLOW K.S. Kim 1 and J.C. Park *2 In general,
More informationJkafm093.hwp
가정의학회지 2004;25:721-739 비만은 심혈관 질환, 고혈압 및 당뇨병에 각각 위험요인이고 다양한 내과적, 심리적 장애와 연관이 있는 질병이다. 체중감소는 비만한 사람들에 있어 이런 위험을 감소시키고 이들 병발 질환을 호전시킨다고 알려져 있고 일반적으로 많은 사람들에게 건강을 호전시킬 것이라는 믿음이 있어 왔다. 그러나 이런 믿음을 지지하는 연구들은
More informationMicrosoft Word - Genolution RNAi Manual.doc
1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000
More information<392E5FB8B8BCBAC6F3BCE2BCBAC6F3C1FAC8AF5FC4A1B7E1C1A65FB0B3B9DFC0C75FC7F6C8B25FB9D75FB1D8BAB9B9E6BEC85F F332E302E687770>
만성폐쇄성기도질환혁신신약개발전략 포항공과대학교생명과학과김윤근 1. 서론 최근 WHO에서는 2020년에인간의수명과삶의질을결정하는 4대질환군을지정하였는데, 이중에하나가기도폐색에의한호흡곤란을특징으로하는만성폐쇄성기도질환 (chronic obstructive airway disease) 이다. 만성폐쇄성기도질환은가역적인기도폐색을특징으로하는천식 (asthma) 과비가역적인기도폐색을특징으로하는만성폐쇄성폐질환
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More information(......).hwp
7 6 4 10 20 30 ph 5 4 3 0 10 20 30 40 50 60 Fermentation time(day) Fig.2-1. Changes of ph in DLMK according to various fermentation temperature 2 4 10 20 30 Acidity (%) 1 0 0 10 20 30 40 50 60 Fermentation
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More information41.6(19) fm
KOREAN J. FOOD SCI. TECHNOL. Vol. 41, No. 6, pp. 717~721 (2009) š w» z ÁyÁy»ÁÁ 1 * w tƒœw, 1 w m y l The Korean Society of Food Science and Technology Anti-allergic Effect of Zizania latifolia Turcz Extracts
More informationMicrosoft Word doc
KISEP Rhinology Korean J Otolaryngol 2006;49:307-12 사람정상코점막상피세포에서겔형성점소 (Gel-Forming Mucin) 분비에대한 Prostaglandin E 2 의효과 김진국 1 김창훈 2,3 김규보 2 장현종 1 김현직 2 윤주헌 2,3,4 Effect of Prostaglandin E 2 on Gel-forming
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI: 3 * Effects of 9th
Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp.357-378 DOI: http://dx.doi.org/10.21024/pnuedi.29.2.201906.357 3 * Effects of 9th Grade Students Participation in Career Curriculum Cluster
More information율촌 인쇄.xps
플라보노이드리나린배당체의염증제어능탐색 김우기경희대학교식품생명공학과 1. 서론 1.1. 연구배경 만성염증성질환의치료및완화를위하여전통적으로괴곽( 회화나무) 추출물을사용하여왔으나, 그효과물질및작용기작에대한규명은미흡한실정이다. 일부연구에서는플라보노이드류인 리나린(Linarin) 및그배당체가괴곽에다량존재하며다양한생리활성을나타냄이보고되었으나, 항산화능을비롯한일반적플라보노이드류의분석연구에집중되어왔다.
More information82-02.fm
w y wz 8«( 2y) 00~00, 2005 J. of the Korean Society for Environmental Analysis Calix[6]arene w k š w *Á x Á Á«ƒm w yw, *w w yw Cesium Ion Selective Solid Contact Electrodes Based on Calix[6]arene Won-sik
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
More information<30352DB1E2C8B9C6AFC1FD2028C8ABB1E2C7F6292036302D36362E687770>
3D 나노-마이크로 프린팅 기술의 현황 홍 기 현 한국기계연구원 부설 재료연구소 표면기술 연구본부 3D Nano-micro Printing Technology Kihyon Hong Korea Institute of Materials Science, Gyeongnam 642-831, Korea Abstract: 최근 3D 프린팅 기술을 이용하여 마이크로, 나노
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI: (LiD) - - * Way to
Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp.353-376 DOI: http://dx.doi.org/10.21024/pnuedi.29.1.201903.353 (LiD) -- * Way to Integrate Curriculum-Lesson-Evaluation using Learning-in-Depth
More information저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
More informationJksvs019(8-15).hwp
Grade I Grade II Grade III 12 대한혈관외과학회지 : 제 20 권 제 1 호 2004 Control Group A Group B Fig. 4. Microscopic findings of vein wall in control, group A and group B on the day of 7 after venous occlusion. The
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More information(5차 편집).hwp
(215), 54(1), 17-3 211 STEAM,.. STEAM, STEAM, 5~6 11.,., 5~6...,. (, 21)., 29. (,, 212). 211 STEAM * :, E-mail: njkwon@hanmail.net http://dx.doi.org/1.15812/ter.54.1.2153.17 (215), 54(1), 17-3,. (Arts)
More informationFocus2È£pdf
RDA World Focus RDA World Focus Focus Focus RDA World Focus Focus RDA World Focus Focus RDA World Focus Focus Focus RDA World Focus Focus RDA World Focus Economy / Trend RDA World Focus Economy
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 4, pp DOI: A Study on the Opti
Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp.127-148 DOI: http://dx.doi.org/11024/pnuedi.27.4.201712.127 A Study on the Optimization of Appropriate Hearing-impaired Curriculum Purpose:
More informationJkbcs032.hwp
Clinical Correlation of HER-2/neu Overexpression in Patients with Breast Cancer Sung Yong Kim, Tae Yoon Kim, Jae Jun Kim, Chang Ho Kim, Ok Pyung Song, Min Hyuk Lee, Eui Han Kim 1, and Moo Sik Cho Departments
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More informationuntitled
理 葉 -- 猪 粒 葉 類 CNHN-93-01 行 93 年 01 01 93 年 12 31 瑩 林 理 參 行 理 94 年 2 28 1 理 葉 -- 猪 粒 葉 類 CNHN-93-01 行 93 年 01 01 93 年 12 31 瑩 理 林 理 理 E-mail: shihying@mail.chna.edu.tw (Morinda citrifolia) Rubiaceae Noni
More informationY 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are
More informationcdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR
RT-PCR 법 II. 역전사효소반응 ( 주 ) 다인바이오연구소 현재분자생물학분야에서 RNA 수준의 gene expression ( 유전자발현 ) 과 cdna (complementary DNA) cloning에널리이용되고있는 RT-PCR (Reverse transcription ploymerase chain reaction) 은생명정보가 DNA에서 RNA로전달된다는분자생물학분야의
More information<303720C7CFC1A4BCF86F6B2E687770>
1) < 論 文 > 라이프스타일 세분화를 통한 실버타운 수요자 분석 133 주택연구 제15권 4호 2007. 12/15(4) : 133~160 Housing Studies Review Vol. 15, No. 4 : 133~160 접수일 : 2007. 7. 9, 심사일 : 2007. 7. 16, 심사완료일 : 2007. 8. 29 라이프스타일 세분화를 통한 실버타운
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
More information노화조직은행소식지 주소 : 부산광역시금정구부산대학로 63번길 2( 장전동 ) 부산대학교약학대학 / 노화조직은행 전화 :051) 팩스 :051) Homepa
소식지 주소 : 부산광역시금정구부산대학로 63번길 2( 장전동 ) 부산대학교약학대학 / 전화 :051)510-2814 팩스 :051)518-2821 E-mail:agingbank@pusan.ac.kr hyjung@pusan.ac.kr Homepage : http://knrrb.knrrc.or.kr/ http://aging.pharm.pusan.ac.kr/ Content
More information1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More information10 (10.1) (10.2),,
Chapter 16 Precipitation Equilibria Copyright 2001 by Harcourt, Inc. All rights reserved. Requests for permission to make copies of any part of the work should be mailed to the following address: Permissions
More information전체 목차 1. 주류 일반 2. 기능성 3. 숙취 4. 주세법 5. 주류 일반 상식 6. 우리술 즐기기
국순당 배중호 대표의 우리 술 강좌 : 백세주 성공신화, 그 비결 전체 목차 1. 주류 일반 2. 기능성 3. 숙취 4. 주세법 5. 주류 일반 상식 6. 우리술 즐기기 1. 주류 일반 술 소비량으로 본 세계지도 집값으로 본 세계지도 군사비 지출로 본 세계지도 1. 주류 일반 주류일반 전통주 정의 전통주 특징 전통주 역사 국순당과 전통주 계승 전통주 담그기
More information02신현화
Yonsei Business Review Vol. 47, No. 1 (Fall 2010), 151-179 David vs. Goliath: M&A of HaiTai Confectionery and Foods Co. by Crown Confectionery Co. Hyun-Han Shin** 2004 10 Korea Confectionary Holdings NV
More informationAbstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More information<36C8A3B3EDB9AE5B31305B315D2E323020BCF6C1A45D2E687770>
기업옥의 파드디자인에 관한 연구 A Study on Facade design of an office building 문혜정 / 홍익대학교 공간디자인전공 석과정 Moon Hye jeong / School of Spatial Design, Hongik University moons81@nate.com 김주연 / 홍익대학교 산업디자인학과 Kim Joo yun/ Dept.
More information[00]_목차.hwp
Korean J. Plant Res. 27(5):439-446(2014) http://dx.doi.org/10.7732/kjpr.2014.27.5.439 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article Murine Macrophage RAW 264.7 세포에서구실잣밤나무추출물의항염증효과
More information