Microsoft Word - 2-강인수.DOC
|
|
- 서준 태
- 5 years ago
- Views:
Transcription
1 대한생식의학회지 : 제 35 권제 2 호 2008 골형성부전증의착상전유전진단을위한분자유전학적방법의조건확립과적용 관동대학교의과대학제일병원생식생물학및불임연구실 1, 산부인과학교실 2 김민지 1 이형송 1 최혜원 1 임천규 1 조재원 1 김진영 2 송인옥 2 강인수 2 * Establishment and Application of Molecular Genetic Techniques for Preimplantation Genetic Diagnosis of Osteogenesis Imperfecta Min Jee Kim 1, Hyoung-Song Lee 1, Hye Won Choi 1, Chun Kyu Lim 1, Jae Won Cho 1, Jin Young Kim 2, In Ok Song 2, Inn Soo Kang 2 * 1 Laboratory of Reproductive Biology and Infertility, 2 Department of Obstetrics and Gynecology, Cheil General Hospital and Women's Healthcare Center, Kwandong University College of Medicine, Seoul, Korea Objectives: Preimplantation genetic diagnosis (PGD) has become an assisted reproductive technique for couples carrying genetic conditions that may affect their offspring. Osteogenesis imperfecta (OI) is an autosomal dominant disorder of connective tissue characterized by bone fragility and low bone mass. At least 95% of cases are caused by dominant mutations in the COL1A1 or COL1A2. In this study, we report on our experience clinical outcomes with 5 PGD cycles for OI in two couples. Methods: Before clinical PGD, we assessed the amplification rate and allele drop-out (ADO) rate of alkaline lysis and nested PCR protocol using heterozygous patient's single lymphocytes in the pre-clinical diagnostic tests for OI. We performed 5 cycles of PGD for OI by nested PCR for the causative mutation loci, COL1A1 c.2452g>a and c.3226g>a, in case 1 and case 2, respectively. The PCR products were analyzed by agarose gel electrophoresis, restriction fragment length polymorphism (RFLP) analysis with HaeIII restriction enzyme in the case 1 and direct DNA sequencing. Results: We confirmed the causative mutation loci, COL1A1 c.2452g>a in case 1 and c.3226g>a in case 2. In the pre-clinical tests, the amplification rate was 94.2% and ADO rate was 22.5% in case 1, while 98.1% and 1.9% in case 2, respectively. In case 1, a total of 34 embryos were analyzed and 31 embryos (91.2%) were successfully diagnosed in 3 PGD cycles. Eight out of 19 embryos diagnosed as unaffected embryos were transferred in all 3 cycles, and in the third cycle, pregnancy was achieved and a healthy baby was delivered without any complications in July, In case 2, all 19 embryos (100.0%) were successfully diagnosed and 4 out of 11 unaffected embryos were transferred in 2 cycles. Pregnancy was achieved in the second cycle and the healthy baby was delivered in March, The causative locus was confirmed as a normal by amniocentesis and postnatal diagnosis. Conclusions: To our knowledge, these two cases are the first successful PGD for OI in Korea. Our experience provides a further demonstration that PGD is a reliable and effective clinical techniques and a useful option for many couples with a high risk of transmitting a genetic disease. [Korean. J. Reprod. Med. 2008; 35(2): ] Key Words: Preimplantation genetic diagnosis (PGD), Osteogenesis imperfecta (OI), COL1A1, COL1A2, Allele drop-out (ADO) 최근체외수정을통해얻은배아를대상으로착 주관책임자 : 강인수, 우 ) 서울특별시중구묵정동 1-19, 관동대학교의과대학제일병원산부인과 Tel: (02) , Fax: (02) ikang67@yahoo.co.kr 상전에분자생물학적기술을이용한유전진단을통해정상적인배아만을선별적으로이식하여, 유전적이상이있는환아를출산할확률이높은부부들에게정상아의출산기회를제공해주는착상
2 골형성부전증의착상전유전진단을위한조건확립과적용 대한생식의학회지 전유전진단 (preimplantation genetic diagnosis, PGD) 이널리시행되고있다. 착상전유전진단을간단히설명하면배아가착상되기전인 6-8세포기배아에서 1~2개의할구를생검한후, 단일세포수준에서유전자이상을진단하기위한중합효소연쇄반응 (polymerase chain reaction, PCR) 법이나염색체의수적, 구조적이상을진단하기위한형광직접보합법 (fluorescence in situ hybridization, FISH) 을이용하여정상배아만을선별하고이식해정상아의임신을성립시키기위한유용한방법이다. 현재까지보고된바에의하면진단할수있는착상전유전진단의범위는염색체의수적, 구조적이상, 그리고대부분의단일유전자이상까지범위가확대되었으며, 또한 advanced maternal age, recurrent pregnancy loss 등을겪는체외수정시술환자들을대상으로 chromosomal aneuploid screening을시행하는등그범위가점차확대되어가고있다. 1~4 국내에서도 1990년대중반이후부터착상전유전진단이시행되고있으며, 염색체의수적이나구조적이상을대상으로형광직접보합법을이용하여시행한사례들과 5~8 듀센씨근이영양증 (Duchenne muscular dystrophy, DMD), 수포성표피박리증 (epidermolysis bullosa), 오르니틴트랜스카바밀라아제결핍증 (ornithine transcarbamylase deficiency), 그리고 lactic acidosis 등의단일유전자이상에의한유전질환을대상으로착상전유전진단을시행한결과가보고되었다. 9,10 골형성부전증 (osteogenesis imperfecta, OI, MIM# ) 은상염색체우성유전질환으로서일반적으로뼈가잘부러지고, blue sclerae와척추측만증등과같은뼈의기형등을나타내는것이특징이다. 11 골형성부전증의원인으로는뼈와피부를구성하는 type I procollagen의경우두분자의 pro α1 chain과한분자의 pro α2 chain으로이루어진 triple helix로구성되어있는데, 각각의 chain 합성에관여하는 COL1A1와 COL1A2 유전자의돌연변이로 triple helix 구조의결함이발생해질환이나타나는것으로알려져있다. 12 현재까지 COL1A1과 COL1A2 의원인유전자에서 200여종의돌연변이가발견되었고, 13 전세계적으로골형성부전증의발병율은 1:10,000~1:20,000으로보고되고있으며, 14 원인돌연변이 allele을가질경우, 95% 이상이골형성부전증으로발전하는것으로보고되어있다. 15 이러한골형성부전증은우성질환이므로후대로유전될수있는위험이매우높아서임신중기에인공유산을시키지않으려면착상전유전진단을수행해야하며, De Vos 등 (2000) 은골형성부전증가계에서착상전유전진단을수행하여두사례에서임신에성공한결과를보고한바있다. 16 본연구에서는골형성부전증가계에서단일세포를대상으로 nested PCR 후 restriction fragment length polymorphism (RFLP) 과 direct sequencing 방법을이용한진단방법의확립과이러한진단방법을골형성부전증을가진 2 가계에적용한 5 주기의착상전유전진단에대해보고하고자한다. 연구대상및방법 1. 환자첫번째가계의경우내원당시 32세의여성으로남편은정상이었지만, 부인의 COL1A1 유전자 exon 37의염기서열중 G가 A (c.2452g>a) 로치환되면서, 643번째아미노산 glycine (GGC) 의 codon이 serine (AGC) 으로치환 (G643S) 된것으로확인되었으며, 내원한환자의가족은표현형이모두정상으로판단되었으며, 환자본인만이돌연변이를가진것으로확인되었다. 두번째가계의경우내원당시 27세의여성이었으며 COL1A1 유전자 exon 44의염기서열중 G 가 A (c.3226g>a) 로치환되어 1076번째아미노산인 glycine (GGT) 이 serine (AGT) 으로치환 (G1076S) 된돌연변이를가지고있었다. 첫번째환자의경우와마찬가지로가족은모두표현형이정상이었으며, 환자본인만이돌연변이를가지고있는것으로확인되었다
3 제 35 권제 2 호, 2008 김민지 이형송 최혜원 임천규 조재원외 3 인 2. Genomic DNA의분리와단일림프구 (single lymphocytes) 준비각부부의혈액으로부터 AquaPure Genomic DNA Kit (Bio-Rad Laboratories, Hercules, CA, USA) 을이용하여 genomic DNA를추출한후사용전까지 -20 에보관하였으며, 이를이용하여 COL1A1 유전자해당돌연변이부위에대한 primer 쌍의효율적인 PCR 조건확립과 PCR 산물을이용한염기서열분석과정을통해돌연변이를확인하였다. 또한 genomic DNA에서확립된조건의효용성을단일세포수준에서확인하기위해각환자의혈액으로부터 Ficoll-Paque density gradient separation (Ficoll- Paque TM PLUS, Amersham Biosciences AB, Uppsala, Sweden) 방법으로단일림프구를분리하였다. 그후배양접시에 Ca 2+ /Mg 2+ -free phosphate buffered saline (PBS) 로소적을만들고그소적에분리된림프구의일부를넣어희석한후현미경하에서미세유리관을이용하여각각의단일림프구를 3 μl의 lysis buffer (200 mm KOH, 50 mm DTT) 가들어있는각각의 PCR tube에넣었다. 준비된단일림프구시료는사용전까지 -70 에보관하였으며, 이를이용하여단일세포수준에서의각 primers의 PCR 조건을재확인하고, 증폭성공률그리고 allele drop-out (ADO) rate를조사하는착상전유전진단에대한임상전검사를실시하였다. 3. 난자의채취및배아의배양 Gonadotrophin-releasing hormone (GnRH) agonist, human menopausal gonadotrophins (hmg) 와 human follicular stimulating hormone (hfsh) 을이용하여과배란을유도하였다. 초음파로난자의크기를관찰하여최소한 2개이상의난포가 18 mm 이상되었을때 human chorionic gonadotrophins (hcg) 10,000 IU를주사하였고, hcg 주사후 34시간에질식초음파를이용하여난자를채취하였다. 채취된난자는 G-Fert 배양액 (Vitrolife Sweden AB, Kungsbacka, Sweden) 에넣어, 37, 5% CO 2, 95% 공기중배양 기에서 3~4시간배양하였다. 배양후성숙된난자를대상으로세포질내정자주입술을시행하였으며, 16~18시간후에수정을확인하였다. 수정이확인된수정란은 48시간동안배양한후할구생검을실시하였다. 4. 할구생검 (blastomere biopsy) 배양 3일째 6-10세포기의배아를대상으로할구생검을시행하였다. 생검과정을용이하게하기위하여먼저배아를 Ca 2+ /Mg 2+ 이들어있지않은배양액 (Biopsy medium, Medicult, Jyllinge, Denmark) 에넣은후생검을시행하였다. Biopsy pipette 내에적당량의 acid Tyrode 용액 (ph 2.4) 을채우고 holding pipette으로배아를고정한후, acid Tyrode 용액으로투명대의일부를제거하였다. 투명대제거후뚜렷한 1개의핵을갖는할구 1~2개를생검하였고, 할구생검시에상태가양호한 6-세포기이상의배아에서는 2개의할구를생검하였다. 할구를생검한후배아는 3~4회수세한후배양액으로옮겨, 배아이식전까지배양하였다. 또한배양액또는배양과정중의오염여부를확인하기위하여생검당시배아를배양하였던배양액만을수획하여동일한조건에서실험함으로써오염여부를확인하였다. 5. Single cell PCR analysis 준비된단일림프구는 alkaline lysis buffer를이용하여용해시키고, neutralization buffer (900 mm Tris- HCl, ph 8.3, 300 mm KCl, 200 mm HCl) 를넣어중화시켰다. PCR 특이성을높이기위해 semi-nested PCR 방법을사용하였으며, primers의염기서열은 Table 1에나타내었다. 일차 PCR의경우, 10 mm Tris-HCl (ph 8.3), 50 mm KCl, 2.5 mm MgCl 2, 0.2 mm dntps (Roche Diagnostics GmbH, Mannheim, Germany), 10 pmol outer primers, 1 unit Taq. DNA polymerase (GeneCraft Co, Munster, Germany) 를혼합한후전체반응액이 30 μl가되게하였다. 일차 PCR은 DNA thermal cycler (ABI 2700, Applied Biosystems, Foster
4 골형성부전증의착상전유전진단을위한조건확립과적용 대한생식의학회지 Table 1. Primers used for nested PCR of COLA1 and the PCR conditions ColA1 Exon 37 COL1A1-Ex37-F (outer) COL1A1-Ex37-R (outer) COL1A1-Ex37-F (inner) COL1A1-Ex37-R (inner) ColA1 Exon 44 Sequences of primers (5' 3') TCCCCCAGGTAGTGGAAACTCCTGC TCCTTCTGGCAGCCCCCACCCAGCC TAGTGGAAACTCCTGCCTC CCAACATTACCCTGTAGGAG Annealing temperature Size bp bp COL1A1 Ex44-F (outer) TGGGAGTTGGGAGAGATGG bp COL1A1 Ex44-F (inner) GGAAGCAGCTGAGGAGAGAG bp COL1A1 Ex44-R (outer/inner) GGGCACTGTCTGCATCTGTA City, CA, USA) 를사용하여 96 에서 10분, 94 에서 30초 ( 처음 10 cycles에서는 96 에서 40초 ), 각 primer의 annealing temperature에서 30초, 72 에서 40초의 cycle을 25회수행한후최종적으로 72 에서 10분간반응시켰다. 일차 PCR의증폭산물 0.5 μl를사용하여 nested PCR을진행하였으며, 전체반응액은 20 μl가되게하였다. 이차 PCR 반응조건은일차 PCR 조건과동일하게수행하였으며, 반응산물은 2% agarose gel 전기영동법을이용하여증폭여부를확인하였고, 착상전유전진단의오진원인중하나인오염여부를확인하기위하여 PCR 반응시 2개이상의 negative control 시료를포함하여모든과정을진행하였다. 6. Restriction fragment length polymorphism (RFLP) analysis 첫번째사례의경우 COL1A1 유전자 c.2452g> A의돌연변이여부를진단하기위하여 RFLP 분석법을동시에시행하였다. COL1A1 유전자 exon 37 에특이적인 primer를이용하여 nested PCR을수행한결과 261-bp에해당하는산물을확인할수있었다. 이환자가가지고있는 c.2452g>a 돌연변이의경우 HaeIII 제한효소의절단부위인 5'-GG^CC-3' 의염기서열이치환되어 HaeIII 제한효소로절단되 지않기때문에환자의 PCR 산물을절단할경우정상인과는다른 band 양상을보인다. 따라서정상 allele과돌연변이 allele을간단하게구별하기위해, 8 μl의 PCR 산물, 1 μl의 10X NEBuffer 2, 0.9 μl의 3 차증류수, 그리고 0.1 μl의 HaeIII 제한효소 (New England Biolabs Inc., MA, USA) 를섞은후 37 에서 2시간처리한후 3% agarose gel에전기영동하여그산물을 UV 하에서관찰하였다. 정상 allele의경우 86-, 65-, 63-, 27-, 20-bp의절단산물이관찰되며, 돌연변이 allele의경우, 128-, 86-, 27-, 20-bp의절편들이관찰된다. 따라서두 allele을가지고있는환자의경우 128-, 86-, 65-, 63-, 27-, 20-bp의절단산물이관찰된다. 그러나 27-bp와 20-bp의경우크기가작아 3% agarose gel에서는관찰이불가능하며또한절단절편중하나인 65-bp의경우또다른절편인 63-bp의절편과겹쳐서보여 gel 상에서는구분이되지않는다. 7. 염기서열분석 (Direct sequencing) Nested PCR 수행후얻어진반응산물중일부는 RFLP 분석을위해사용하고더정확한진단을위해 direct sequencing을동시에진행하였다. Sequencing reaction 진행전에 AccuPrep PCR Purification Kit (Bioneer corp., Daejeon, KOREA) 을이용
5 제 35 권제 2 호, 2008 김민지 이형송 최혜원 임천규 조재원외 3 인 Table 2. Preclinical single-cell PCR analysis with single lymphocytes in osteogenesis imperfecta Case 1 Case 2 Amplification rate 94.2% (49/52) 98.1% (52/53) Contamination rate 0.0% 0.0% Allele drop-out rate 22.5% (9/40) 1.9% (1/52) Figure 1. The diagnosis of preclinical test with single lymphocytes isolated from heterozygote patient in case 1. Results were obtained from the test using the nested PCR followed by the restriction fragment length polymorphism (RFLP) with HaeIII. Lane 1; normal allele onlyband pattern (mutant allele: ADO), lane 2; heterozygoteband pattern, and lane 3; mutated allele only-band pattern (normal allele; ADO). After HaeIII restriction enzyme digestion, the PCR products of the heterozygote lymphocyte (lane 2) were digested into 128-, 86- and 65 (and 63)-bp fragments, while the products of the normal allele (lane 1) and mutated allele (lane 3) were digested into 86- and 65 (and 63)-bp fragments and 128- and 86- bp fragments (not 65-bp), respectively (the digested 27- and 20-bp fragments were not seen in the agarose gel). 하여 PCR 산물을정제하였으며, sequencing reaction 은 4 μl의 5X sequencing buffer, 8 μl의 Terminator Ready Reaction Mix (BigDye Terminator Reaction Kit; Applied Biosystems, Foster city, USA), 1.6 pmol의해당 sequencing primer, 50 ng의 PCR 산물과증류수를혼합하여최종 20 μl로만들었으며, 96 에서 10초, 50 에서 5초, 60 에서 4분으로 25 cycle을수행하였다. Sequencing 반응물은 50 μl의 100% ethanol과 2 μl의 3M sodium acetate (ph 5.2) 를넣어혼합후얼음에 15분간방치시킨다음 12,000 rpm 에서 15분간원심분리하고, 상층액제거후다시 70% ethanol로세척해건조시켰다. 침전물은 15 μl 의 Hi-Di formamide (Applied Biosystems, Foster city, USA) 를넣어용해시킨다음 95 에서 3분간변성시킨후 automatic genetic analyzer (ABI Prism Avant, Applied Biosytems, Foster city, USA) 를이용한 capillary electrophoresis와 Seqscape software (Applied Biosytems, Foster city, USA) 를사용하여염기서열을분석하였다. 결과 1. 임상전검사 (preclinical tests) 첫번째사례의경우 genomic DNA를이용한염기서열분석결과부인의 COL1A1 유전자 exon 37 에 c.2452g>a 돌연변이가있음을재확인하였으며남편의경우에는정상으로확인되었다. 착상전유전진단에들어가기위한예비실험으로서단일세포수준에서의진단방법의효용성, 증폭성공률그리고 ADO rate을조사하기위하여부인의단일림프구를대상으로 nested PCR, RFLP 그리고염기서열분석방법을이용한임상전검사를수행하였다. 총 52개의림프구를대상으로실시하였으며그중 49개에서증폭에성공하여 94.2% 의증폭성공률을보였으며 22.5% (9/40) 의다소높은 ADO rate를나타내었다 (Figure 1 and Table 2). 두번째사례역시염기서열분석결과부인의 COL1A1 유전자 exon 44에 c.3226g>a 돌연변이가있음을재확인하였으며, 남편은정상으로확인되었다. 부인의단일림프구를대상으로임상전검사를수행한결과 98.1% (52/53) 의증폭성공률과 1.9% (1/52) 의 ADO rate을나타내었다 (Table 2). 2. 골형성부전증에대한착상전유전진단 1) 사례 1 본사례의경우첫과배란유도후개인사정으로인해해당주기에착상전유전진단을시행하지못하고모든배아를동결보존하였다. 첫번째와두번째착상전유전진단에서는동결보존된배아중각각 12개와 15개의배아를융해하여착상전
6 골형성부전증의착상전유전진단을위한조건확립과적용 대한생식의학회지 Table 3. Clinical outcomes of the PGD for two cases of osteogenesis imperfecta Case 1 Case 2 1 st cycle 2 nd cycle 3 rd cycle 1 st cycle 2 nd cycle No. of biopsied embryos No. of analyzed embryos 12 (100.0%) 15 (100.0%) 7 (100.0%) 9 (100.0%) 10 (100.0 %) No. of non-amplified embryos No. of diagnosed embryos 10 (83.3%) 14 (93.3%) 7 (100.0%) 9 (100.0%) 10 (100.0%) No. of unaffected embryos No. of affected embryos No. of transferred embryos Clinical pregnancy No No Yes No Yes Results of amniocentesis - - Normal - Normal Delivery wks 36.4 wks 유전진단을시행하였고각각 10개 (83.3%) 와 14개 (93.3%) 의배아에서진단에성공하였으며, 이들배아중 4개와 9개의배아가정상으로진단되었다. 또한각각 1개씩의할구에서 ADO가관찰되어 6.3% (1/16) 과 4.8% (1/21) 의 ADO rate를나타내었다. 각각 3개씩의정상배아만을이식하였으나임신에성공하지못하였다 (Table 3). 세번째착상전유전진단에서는총 7개의배아를대상으로생검을시행하였고, 그중 5개의배아에서는 2개씩의할구를생검하였으며, 나머지 2개로부터는 1개씩의할구를생검하여착상전유전진단을시행하였다 (Table 3). Nested PCR, RFLP와 direct sequencing을이용한진단결과 7개모두에서진단에성공하여 100.0% 의진단성공률을보였으며 ADO는나타나지않았다. 총 6개의정상배아가확인되었으며그중 2개의정상배아만을이식하여임신에성공하였다. 임신 17주에실시된양수검사에서태아가정상임을확인하여착상전유전진단의수행결과가정확함을재확인하였다 (Figure 2). 그후임신 37주에제왕절개를통해분만에성공하였다. 2) 사례 2 첫번째착상전유전진단시동결보존되어있던 9개의배아를융해하여생검을실시하였으며, 9개모두에서진단에성공하여 100.0% 의진단성공률을나타내었고, 2개의할구에서 ADO가관찰되어 11.8% (2/17) 의 ADO rate를나타내었다. 총 5개의배아가정상으로진단되어이중 2개의배아를이식하였으나임신에성공하지못하였다 (Table 3). 두번째착상전유전진단시총 10개의배아를획득하여생검을진행하였는데이중 6-세포기이상인 8개의배아에서는 2개씩의할구를생검하였고나머지 2개의배아로부터는 1개의할구만을생검하여 nested PCR과 direct sequencing을이용한진단을실시하였다. 생검을실시한 10개배아모두에서진단에성공하여 100.0% 의진단성공률과 11.1% (2/18) 의 ADO rate를보였으며, 이중 6개의정상배아를확인할수있었으며, 그중 2개의정상배아만을이식하여임신에성공하였다. 임신 17주차에수행한양수검사에서태아가정상염기서열을가지고있는것을확인하여착상전유전진단의결과를재확인할수있었고이후임신 36.4주에제왕절개를통하여분만에성공하였으며, 제대혈을이용하여수행한신생아검사결과에서도정상임을최종적으로확인할수있었다 (Table 3 and Figure 3)
7 제 35 권제 2 호, 2008 김민지 이형송 최혜원 임천규 조재원외 3 인 A Male partner Female partner Amniotic cells PCR product 261 bp 128 bp RFLP-Hae III 86 bp 65 bp B Male partner Female partner Amniotic cells Normal Affected Normal Figure 2. The results of amniocentesis for osteogenesis imperfecta in case 1. Results of amniocentesis using the restriction fragment length polymorphism (RFLP) with HaeIII or direct sequencing analysis. (A) Detection of the mutation in exon 37 of the COL1A1 gene in the female partner. After HaeIII restriction enzyme digestion, the PCR products of the female partner (lane 3 and 4) were digested into 128-, 86- and 65 (and 63)-bp fragments, while the products of the amniotic cells (lane 5 and 6) and normal male partner (lane 1 and 2) were completely digested into 86- and 65 (and 63)-bp fragments (the digested 27- and 20-bp fragments were not seen in the agarose gel). (B) Direct sequencing of the PCR product spanning exon 37 demonstrates the presence of a normal homozygous C/C sequence in the male partner and the amniotic cells (The blue arrows indicate normal C/C sequences). Male partner Female partner Amniotic cells Male partner Female partner Amniotic cells Normal Affected Normal Normal Affected Normal Figure 3. The results of amniocentesis for osteogenesis imperfecta in case 2. Direct sequencing of the PCR product spanning exon 44 of the COL1A1 shows the presence of a heterozygous G-to-A transition in affected female partner (red arrow). The normal male partner and amniotic cells were homozygous G/G (blue arrows)
8 골형성부전증의착상전유전진단을위한조건확립과적용 대한생식의학회지 고찰골형성부전증은뼈와피부를구성하는 type I procollagen chain의구조적결함으로발병하며, 이러한 procollagen chain은두분자의 pro α1 chain과한분자의 pro α2 chain으로이루어진 triple helix로구성되어있으며, COL1A1과 COL1A2 단백질의아미노산서열중 G-X-Y unit의반복에의해 procollagen chain 이서로꼬여지는독특한 helix 구조를가지게된다. 이 G-X-Y unit의 helix 구조를이루는데가장중요한아미노산은 glycine 이며, glycine 이아닌다른아미노산으로치환이될경우, helix 의구조에결함이발생하여정상적인기능을하는 procollagen chain이형성되지않는다. 또한다른하나의 chain이정상이라할지라도비정상 chain이끼어있는 triple helix는전체적으로비정상적인 helix 구조를가지게되며, 결국, α1과 α2 chain 중한 chain의두 alleles 중한 allele의변이에의해서도최종적으로생성되는 type I collagen triple helix의형성에문제가생겨질환이나타나는것으로알려져있다. 12 지금까지보고된많은돌연변이들이이러한 glycine에해당하는위치에있는돌연변이들이며본연구에서보고한두사례역시모두 glycine이 serine으로치환되는돌연변이를가지고있었다. 현재까지도골형성부전증환자의경우정상아의출산을위하여다양한산전진단법들이수행되어왔다. 보고된골형성부전증의대부분이경미한증상을가지고있었으며, 이렇게경미한증상을가진환자의진단에있어서초음파로진단하는것은중증환자의경우와는다르게오진의위험이크기때문에, Raghunath 등은융모막세포를생검하여 collagen 합성정도를 autoradiography을통하여비교분석하는진단방법을산전진단에적용하기도하였다. 17 그러나 autoradiography을이용한진단법역시일부골형성부전증환자에있어서는진단결과가명확하지않아부적합하기때문에, 보다정확한진단을위하여근래에여러가지다양한분자 생물학적인진단방법들이도입되었다. Lynch 등과 Benuslene 등은 COL1A1, COL1A2 유전자의 polymorphic markers를이용한 linkage analysis를진행하여 haplotype을분석하였고, 이를이용하여원인돌연변이 allele를구분하는방법을산전진단에적용하였던사례를보고하였으며, 18,19 Gomez 등은 COL1A2 유전자의 640번째아미노산인 glycine이 cysteine으로치환된새로운점돌연변이를발견한후이부위에대한 DNA hybridization 방법을 c.2327g>t을가진골형성부전증환자의산전진단에성공적으로적용하였다. 20 Nuytinck 등은 type 1 collagen 합성을저하시키는 non-functional COL1A1 allele을진단하기위하여두개의 polymorphic marker를이용하여 mutant allele과 normal allele을구분하였고, 이를산전진단에적용하였다. 21 이와같이많은연구자들에의한다양한유전적분석과 linkage analysis를통한진단법의발전으로산전진단의적용이확대되었다. 하지만최근에는산전진단에서만가능하였던여러가지진단방법들이단일세포수준에서도시행되어유전적인분석과정확한진단이가능하게되었으며, 여러연구자들의노력으로과거와는달리여러부위를동시에볼수있는 multiplex PCR, 일반 PCR보다민감도가높은 fluorescent PCR 22 그리고단일세포로부터의 whole genome amplification method의발전으로인한 comparative genomic hybridization (CGH) 나 array CGH의적용 23 등많은분자생물학적분석방법등이착상전유전진단에적용되어짐에따라높은증폭성공률과낮은 ADO rate 의조건확립으로적용가능한질환의범위가확대되었고, 비정상적인임신으로인한유산의정신적, 육체적부담감으로부터벗어날수있게되었다. De Vos 등은유전의위험성이높은골형성부전증을가지고있는두가계를대상으로착상전유전진단의적용과임신성공사례를최초로보고한바가있다. 16 이들은진단방법으로써 fluorescent PCR 과 RFLP 그리고 fragment analysis 방법을사용하였으며, 약 11.0% 의 ADO rate와약 85% 의증폭성공
9 제 35 권제 2 호, 2008 김민지 이형송 최혜원 임천규 조재원외 3 인 률을나타내었다고보고하였다. 본연구에서도골형성부전증을가지고있는두가계를대상으로총 5 주기의착상전유전진단을시행함에있어 nested PCR과 RFLP 그리고 direct sequencing 방법을이용하여진단하였으며, 착상전유전진단을수행하기이전에원인돌연변이의확인, 특이적 primers의고안및선정그리고단일림프구에서의증폭성공률과 ADO rate의조사와같은 PCR 조건확립과진단방법의최적화를위해임상전검사를수행하였다. 임상전검사에서증폭성공률은 94~98% 로높게나타났으나, ADO rate의경우첫번째사례에서 22.5% 로높아생검시 6-세포기이상의배아에서두개의할구를생검하여진단하기로결정하였으며, PCR 반응시 denaturation step에서의온도를높이고, 반응시간을조절하여조건을최적화하였다. 또한처음에는 RFLP 분석방법으로임상전검사를수행하였으나, 부분적절단 (partial digestion) 이나 preferential amplification가나타날경우 ADO로오진할가능성이있는등정확한진단을할수없고, ADO rate 역시높아이후에는 direct sequencing 방법으로진단방법을개선하였다. 이러한 direct sequencing 방법을진단에적용한결과 4.0% 의낮은 ADO rate를나타내었다. 두번째사례에서는임상전검사결과 ADO rate가 1.9% 로매우낮게관찰되었으나, 착상전유전진단결과에서는 ADO rate 가임상전검사와는다르게 4.8~11.8% 로다소높게관찰되었다. 그러나할구두개로부터얻은결과를종합하여진단하기때문에오진의위험을줄일수있었다. 이후임신 17주차에양수검사를통하여착상전유전진단의결과가정확하였음을재확인하였고, 첫번째사례의경우 2005년에분만하여현재까지건강하게생활하고있으며, 두번째사례또한 2008년에분만에성공하였고신생아검사결과정상으로나타났으며현재아무런증상없이건강하게생활하고있다. 전세계적으로시행되는착상전유전진단의데이터를관리하는 ESHRE PGD consortium에서발표한 2008년 1월 ESHRE PGD consortium data collection VII에의하면 2004년까지총 11,791 주기의착상전유전진단이시행되었으며임상적임신율은난자채취당 18% (per oocyte retrival) 와배아이식당 25% (per embryo transfer) 를나타내고있고, 총 1,988명의아이들이태어났다고보고하였다. ESHRE PGD consortium data collection I~VII까지정리한결과단일유전자이상에의한착상전유전진단적용질환중골형성부전증의경우전세계적으로총 17 주기만이시행된것으로확인되었다. 24~31 이와같이골형성부전증의착상전유전진단의적용과성공이전세계적으로도흔하지않은경우임을알수있다. 특히, 본원에서시행한골형성부전증에대한착상전유전진단의경우총 2 가계, 5 주기의착상전유전진단을모두성공적으로수행하였으며, 두가계모두에서건강한아이를출산하였다. 이와같은임상결과는전세계적으로흔하지않은사례이며, 아직까지국내에서보고된바가없는성공적인골형성부전증에대한착상전유전진단적용사례이다. 본원에서는 2003년부터 2007년까지단일유전자이상에대한착상전유전진단을총 36 주기시행하였고, 이중 12 주기에서임신에성공하여배아이식당 34.3% 의임상적임신율 (per embryo transfer) 을보이고있고, 12명의건강한아기가태어났으며, 1 주기의경우는아직임신중으로현재 30주이상유지되고있으며양수검사결과모두정상으로확인되었다. 현재까지시행한착상전유전진단의질환들에는듀센씨근이영양증 (Duchenne muscular dystrophy), 수포성표피박리증 (epidermolysis bullosa), 골형성부전증 (osteogenesis imperfecta), 취약 X 염색체증후군 (fragile X syndrome), 오르니틴트랜스카바밀라아제결핍증 (ornithine transcarbamylase deficiency), pyruvate dehydrogenase (PDH) deficiency, 척수성근위축증 (spinal muscular atrophy), Huntington's disease (HD), 척수소뇌성운동실조증 (spinocerebellar ataxia 3), long-chain 3-hydroacyl CoA dehydrogenase (LCHAD) deficiency, 페닐케톤뇨증 (phenylketonuria) 그리고 Chacot-Marie-Tooth (CMT)
10 골형성부전증의착상전유전진단을위한조건확립과적용 대한생식의학회지 disease 등이있으며, 최근 multiple displacement amplification (MDA) 방법을이용한 whole genome amplification을수행하여 array 또는 array CGH 등의다양한진단법을착상전유전진단에적용한사례들이보고되고있으며, 23 앞으로도착상전유전진단의적용범위는점차확대되어질것으로사료된다. 결론적으로앞으로도더욱높은증폭성공률과낮은 ADO rate 위하여더정확한진단방법의개발및확립을통해더많은단일유전자이상의유전질환을가진환자들에게착상전유전진단을적용할수있게될것이며이는이러한부부들에게정상아의임신과출산의기회를더욱많이제공하게될것이다. 참고문헌 1. Munne S. Preimplantation Genetic Diagnosis and Human Implantation-A Review. Placenta 2003; 24: S Staessen C, Platteau P, Van Assche E, Michiels A, Tournaye H, Camus M, et al. Comparison of blastocyst transfer with or without preimplantation genetic diagnosis for aneuploidy screening in couples with advanced maternal age: a prospective. Human Reprod 2004; 19: Gianaroli L, Magli MC, Cavallini G, Crippa A, Nadalini M, Bernardini L, et al. Frequency of aneuploidy in sperm from patients with extremely severe male factor infertility. Human Reprod 2005; 20: Platteau P, Staessen C, Michiels A, Van Steirteghem A, Liebaers I, Devroey P. Preimplantation genetic diagnosis for aneuploidy screening in women older than 37 years. Fertil Steril 2005; 84: 임천규, 한미현, 전진현, 송견지, 김정욱, 박소연등. 균형전좌또는 Robertsonian 전좌보인자의체외수정및배아이식술에서형광직접보합법을이용한착상전유전자진단의임상적적용. 대한산부인과학회지 2000; 43: 김진영, 임천규, 송인옥, 유근재, 양광문, 한국선등. 유전질환및염색체이상의예방을위한착상전유전진단의결과. 대한불임학회지 2002; 29: 임천규, 민동미, 이형송, 변혜경, 박소연, 류현미등. 형광직접보합법을이용한착상전유전진단기법의최적화와경험축적에의한임신율의향상. 대한불임학회지 2004; 31: Lim CK, Jun JH, Min DM, Lee HS, Kim JY, Koong MK, et al. Efficacy and clinical outcome of preimplantation genetic diagnosis using FISH for couples of reciprocal and Robertsonian translocations: the Korean experience. Prenat Diagn 2004; 24: 최수경, 이은호, 이호준, 전진현, 강인수, 백은찬등. 근이양증가계에서의 PEP-PCR을이용한착상전유전자진단. 대한불임학회지 1996; 23: 이형송, 최혜원, 임천규, 민동미, 변혜경, 김진영등. OTC 효소결핍증, 수포성표피박리증및 lactic acidosis 가계에서 duplex nested PCR 방법을이용한착상전유전진단 : OTC 효소결핍증가계에서의정상아임신및출산. 대한산부인과학회지 2004; 47: Byers PH. Brittle bones-fragile molecules: disorders of collagen gene structure and expression. Trends Genet 1990; 6(9): Sykes B. Linkage analysis in dominantly inherited osteogenesis imperfecta. Am J Med Genet 1993; 45(2): Kuivaniemi H, Tromp G, Prockop DJ. Mutations in fibrillar collagens (types I, II, III, and XI), fibril-associated collagen (type IX), and network-forming collagen (type X) cause a spectrum of diseases of bone, cartilage, and blood vessels. Hum Mutat 1997; 9(4): Ries-Levavi L, Ish-Shalom T, Frydman M, Lev D, Cohen S, Barkai G, et al. Genetic and biochemical analyses of Israeli osteogenesis imperfecta patients. Hum Mutat 2004; 23(4): Byers PH. Osteogenesis imperfecta. In Royce PM, Steinmann B (eds): Connective Tissue and Its Heritable Disorders: Molecular, Genetic and Medical Aspects. New York: Wiley Liss; 1993; De Vos A, Sermon K, Van de Velde H, Joris H, Vandervorst M, Lissens W, et al. Two pregnancies after preimplantation genetic diagnosis for osteogenesis imperfecta type I and type IV. Hum Genet 2000; 106(6): Raghunath M, Steinmann B, Delozier-Blanchet C, Extermann P, Superti-Furga A. Prenatal diagnosis of collagen disorders by direct biochemical analysis of chorionic villus biopsies. Pediatr Res 1994; 36: Lynch JR, Ogilvie D, Priestley L, Baigrie C, Smith R, Farndon
11 제 35 권제 2 호, 2008 김민지 이형송 최혜원 임천규 조재원외 3 인 P, et al. Prenatal diagnosis of osteogenesis imperfecta by identification of the concordant collagen 1 allele. J Med Genet 1991; 28: Benuslene E, Kucinskas V. Strategy for prenatal diagnosis of osteogenesis imperfecta by linkage analysis to the type I collagen loci COL1A1 and COL1A2. Med Sci Monit 2000; 6: Gomez-Lira M, Sangalli A, Pignatti PF, Digilio MC, Giannotti A, Carnevale E, et al. Determination of a new collagen type I alpha 2 gene point mutation which causes a Gly640 Cys substitution in osteogenesis imperfecta and prenatal diagnosis by DNA hybridisation. J Med Genet 1994; 31: Nuytinck L, Sayli BS, Wettinck K, De Paepe A. Prenatal diagnosis of osteogenesis Imperfecta type I by COL1A1 nullallele-testing. Prenat Diagn 1999; 19: Findlay I, Quirke P, Hall J, Rutherford A. Fluorescent PCR: a new technique for PGD of sex and single-gene defects. J Assist Reprod Genet 1996; 13(2): Hellani A, Coskun S, Benkhalifa M, Tbakhi A, Sakati N, Al-Odaib A, et al. Multiple displacement amplification on single cell and possible PGD applications. Mol Hum Reprod 2004; 10: Geraedts J, Handyside A, Harper J, Liebaers I, Sermon K, Staessen C, et al. ESHRE Preimplantation Genetic Diagnosis (PGD) Consortium: preliminary assessment of data from January 1997 to September ESHRE PGD Consortium Steering Committee. Hum Reprod 1999; 14: Geraedts J, Handyside A, Harper J, Liebaers I, Sermon K, Staessen C, et al. European Society of Human Reproduction and Embryology Preimplantation Genetic Diagnosis Consortium Steering Committee ESHRE preimplantation genetic diagnosis (PGD) consortium: data collection II (May 2000). Hum Reprod 2000; 15: ESHRE PGD Consortium Steering Committee. ESHRE Preimplantation Genetic Diagnosis Consortium: data collection III (May 2001). Hum Reprod 2002; 17: Sermon K, Moutou C, Harper J, Geraedts J, Scriven P, Wilton L, et al. ESHRE PGD Consortium data collection IV: May- December 2001.Hum Reprod 2005; 20: Harper JC, Boelaert K, Geraedts J, Harton G, Kearns WG, Moutou C, et al. ESHRE PGD Consortium data collection V: cycles from January to December 2002 with pregnancy follow-up to October Hum Reprod 2006; 21: Sermon KD, Michiels A, Harton G, Moutou C, Repping S, Scriven PN, et al. ESHRE PGD Consortium data collection VI: cycles from January to December 2003 with pregnancy follow-up to October Hum Reprod 2007; 22: Harper JC, de Die-Smulders C, Goossens V, Harton G, Moutou C, Repping S, et al. ESHRE PGD consortium data collection VII: cycles from January to December 2004 with pregnancy follow-up to October Hum Reprod 2008; 23:
12 골형성부전증의착상전유전진단을위한조건확립과적용 대한생식의학회지 = 국문초록 = 목적 : 착상전유전진단은환아를출산할가능성이높은부부들에게정상아의출산기회를제공해주는보조생식술의하나로서널리시행되고있다. 골형성부전증은상염색체우성유전질환으로서뼈와피부를구성하는결합조직의이상으로뼈가잘부러지는특징을가지고있으며, 질환의 95% 이상은 COL1A1 또는 COL1A2 유전자의이상으로발병한다고알려져있다. 본논문에서는골형성부전증환자 2 가계를대상으로 5 주기의착상전유전진단을시행하여임신에성공한사례에대해보고하고자한다. 연구방법 : 착상전유전진단수행전에환자의단일림프구에서증폭성공률과 allele drop-out (ADO) rate을확인하기위하여임상전검사를수행하였다. 각각원인돌연변이로확인된 COL1A1 유전자 c.2452g>a와 c.3226g>a를가지고있는골형성부전증 2 가계를대상으로 5 주기의착상전유전진단을시행하였다. 생검한할구로부터원인돌연변이를진단하기위하여 nested PCR 후 HaeIII 제한효소를이용한 restriction fragment length polymorphism (RFLP) 분석방법과 direct sequencing 방법을이용하여진단을실시하였다. 결과 : Genomic DNA를이용하여 COL1A1 유전자검사를해본결과각가계의원인돌연변이는 c.2452g>a와 c.3226g>a임을재확인하였으며, 단일세포를이용한임상전검사결과첫번째사례의경우 94.2% 의증폭성공률과 22.5% 의 ADO rate을나타내었고, 두번째사례의경우 98.1% 의증폭성공률과 1.9% 의 ADO rate를나타내었다. 착상전유전진단결과첫번째사례의경우, 3 주기의착상전유전진단에서총 34개의배아중 31개의배아에서진단에성공하여 91.2% (31/34) 의진단성공률을나타내었고, 총 19개의정상배아중 8개의배아 (2.7개/ 배아이식 ) 를이식하였다. 세번째주기에서임신에성공하였고제왕절개로건강한아이를분만하였다. 두번째사례의경우 2 주기의착상전유전진단을시행하였으며, 총 19개의배아모두진단에성공하여 100.0% (19/19) 의진단성공률을나타내었고, 총 11개의정상배아중 4개 (2개/ 배아이식 ) 의배아를이식하였다. 두번째착상전유전진단에서임신에성공하였고, 건강한아이를분만하였다. 결론 : 착상전유전진단을통한골형성부전증환자 2 가계에서의성공적인임신과출산은국내에서처음으로보고되는임상결과로, 본원의착상전유전진단방법은효과적이고확실한방법으로써앞으로도더많은단일유전자이상의유전질환을가진환자들에게적용하게될것이며, 이는이와유사한유전질환을가지고있거나유전질환의이환가능성이있는부부들에게정상아의임신과출산의기회를더욱많이제공할수있을것이다. 중심단어 : 착상전유전진단, 골형성부전증, COL1A1, COL1A2, Allele drop-out (ADO)
Microsoft Word - 3-전진현.DOC
大韓不妊學會誌 : 第 32 卷第 1 號 2005 Kor. J. Fertil. Steril., Vol. 32, No. 1, 2005, 3 근이영양증에대한착상전유전진단에서 Duplex-nested PCR 과 Fluorescent PCR 방법의효용성 성균관대학교의과대학삼성제일병원생식생물학및불임연구실 1, 유전학연구실 2, 산부인과학교실 3 이형송 1 최혜원 1 임천규
More informationMicrosoft Word - 6-전진현.DOC
대한생식의학회지 : 제 34 권제 3 호 2007 삼핵산반복서열질환인헌팅톤병, 척수소뇌성운동실조증, X- 염색체취약증후군의착상전유전진단방법에대한연구 관동대학교의과대학제일병원생식생물학및불임연구실 1, 산부인과학교실 2 김민지 1 이형송 1 임천규 1 조재원 1 김진영 2 궁미경 2 송인옥 2 강인수 2 전진현 1 * Optimized Methods of Preimplantation
More information歯 PDF
* * The Effects of Oocyte Oocytes Intracytoplasmic ICSI) Kee TaekHoo Hai * SikChun Department of Obstetrics and Gynecology, School of Medicine, Kyungpook Taegu, *Department of Animal Science, Taegu Kyungbuk,
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More informationMicrosoft Word - 2-강인수.DOC
종 설 대한생식의학회지 : 제 35 권제 1 호 2008 착상전유전진단 (Preimplantation Genetic Diagnosis) 의임상적적용 관동대학교의과대학제일병원산부인과 김진영 강인수 * Clinical Application of Preimplantation Genetic Diagnosis (PGD) Jin Yeong Kim, Inn Soo Kang
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information뉴스레터6호F?2??訝
February 2009 No.06 Roche Diagnostics Korea Co., Ltd. Focus Tech EDITORIAL February 2009 No.06 Contents Editorial 03 Focus 04 Product 10 Talk 12 Tech 14 Activity 19 Style 22 February 2009 No.06 02 03 FOCUS
More information김범수
Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More information1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More information황지웅
Comparison of Laparoscopy and Exploration in the Distal Pancreatectomy BACKGROUND: To determine the benefits of laparoscopic surgery compared with exploration, the clinical outcomes of open and laparoscopic
More informationK O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis
More information미래의학 - 맞춤형의학 유전자가위
미래의학 유전자가위 / 맞춤형의료 Dr. Shoukhrat Mitalipov AUGUST 2, 2017 Center for Embryonic Cell and Gene Therapy, Oregon Health & Science University, Portland, Oregon, USA Knight Cardiovascular Institute, Oregon Health
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More information005송영일
Received : 2015. 12. 09 Reviewed : 2015. 12. 16 Accepted : 2015. 12. 16 Sternal Fracture occurred after Thai Massage : A Case Report Young-Il Song, K.M.D. 1, Dong-Eun Kim, K.M.D. 1 1 Department of Rehabilitation
More informationAbstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
More information기관고유연구사업결과보고
기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106
More information00약제부봄호c03逞풚
경희대학교 동서신의학병원 약품 정보지 2 0 0 7. S P R I N G. V O L. 0 1 신약 소개 02 Journal Review 03 Special Subject 04 복약 지도 06 의약품 안전성 정보 07 약제부 알림 07 약제부 업무 소개 08 E A S T - W E S T N E O M E D I C A L C E N T E R 본 약품
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More informationY 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information04조남훈
Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache
More informationKbcs002.hwp
Does Real-time Compound Imaging Improve Evaluation of reast Cancer Compared to Conventional Sonography? o Kyoung Seo, M.D., Yu Whan Oh, M.D., Kyu Ran Cho, M.D., Young Hen Lee, M.D., Hyung Joon Noh, M.D.,
More information431_439특집_문신용
Focused Issue of This Month In Vitro Fertilization Program ShinYong Moon, MD Department of Obstetrics and Gynecology, Seoul National University College of Medicine Email : shmoon@snu.ac.kr J Korean Med
More informationMicrosoft Word - 5-김진영.DOC
大韓不妊學會誌 : 第 33 卷第 3 號 2006 Kor. J. Fertil. Steril., Vol. 33, No. 3, 2006, 9 염색체이수성과관련된비정상적임신이예상되는환자에서착상전유전진단의결과 성균관대학교의과대학삼성제일병원산부인과 1, 불임연구실 2, 유전학연구실 3 김진영 1 임천규 2 차선화 1 박수현 1 양광문 1 송인옥 1 전진현 2 박소연 3
More information16(1)-3(국문)(p.40-45).fm
w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University
More information12이문규
Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental
More informationStatistical Data of Dementia.
Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.
More informationMicrosoft Word - 9-전진현.DOC
대한생식의학회지 : 제 34 권제 4 호 2007 정상정자소견을나타내는불임부부에서일반적인체외수정과세포질내정자주입술을병행하는분할수정법의효용성 관동대학교의과대학제일병원생식생물학및불임연구실 1, 산부인과학교실 2 홍승범 1 박동욱 1 신미라 1 최수진 1 이선희 1 송인옥 2 전진현 1 * Efficacy of the Split Insemination Method
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More information노영남
Purpose: Delayed massive hemorrhages from pseudoaneurysm rupture of the peripancreatic large arteries, after pancreaticoduodenectomy, are fatal. We reviewed the clinical course and outcome of bleeding
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More information( )Jkstro011.hwp
비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy
More information책임연구기관
2009. 2. 책임연구기관 - i - - ii - - iii - - iv - 6.3.1 Sample Collection and Analysis 161 6.3.1.1 Sample Collection 161 6.3.1.2 Sample Analysis 161 6.3.2 Results 162 6.3.2.1 Dalian 162 6.3.2.2 Xiamen 163 6.3.3
More information29(2)-04(임시근).fm
Printed in the Republic of Korea ANALYTICAL SCIENCE & TECHNOLOGY Vol. 29, No. 2, 79-84, 2016 http://dx.doi.org/10.5806/ast.2016.29.2.79 Note ( 단신 ) Performance of MiniPCR TM mini8, a portable thermal cycler
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More information<B0E6C8F1B4EBB3BBB0FA20C0D3BBF3B0ADC1C E687770>
심전도연수강좌 : 처음시작하는사람들을위한심전도 연세대학교원주의과대학순환기내과학교실 안민수 Cardiac Electrophysiology I : Automaticity : 60-100 회 /min, His bundle : 40-60 회 /min Bundle branch : 20-40 회 /min Purkinje fiber : 20 회 /min Cardiac Electrophysiology
More information서론
- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - -
More information뉴스지14호-칼라
2 3 4 5 6 TaKaRa Taq TM / TaKaRa Ex Taq TM / TaKaRa LA Taq TM / Pyrobest TM DNA Polymerase/ TaKaRa Z -Taq TM TaKaRa Taq TM TaKaRa Ex Taq TM TaKaRa LA Taq TM TaKaRa Z-Taq TM Pyrobest TM DNA Polymerase 7
More information원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현
원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현 원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현 원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 지도김석원교수 이논문을석사학위논문으로제출함
More information- i - - ii - - i - - ii - - i - - ii - - iii - - iv - - v - - vi - - vii - - viii - - ix - - x - - xi - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 -
More informationCONTENTS.HWP
i ii iii iv v vi vii viii ix x xi - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 -
More informationINDUS-8.HWP
i iii iv v vi vii viii ix x xi 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More informationAutomated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets
PCR FlashGel System 2013. 04. 24 PCR 2013. 04. 24 순서 1. PCR 이란 2. PCR 실험의기본조건 3. PCR 효소선택가이드 4. Hot Start PCR의원리 5. PCR 실험시 Troubleshooting 6. PCR 장비 _TP350 소개 PCR(Polymerase Chain Reaction) PCR 이란? -
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More informationMicrosoft Word - 5-지병철.DOC
大韓不妊學會誌 : 第 32 卷第 4 號 2005 Kor. J. Fertil. Steril., Vol. 32, No. 4, 2005, 12 체외수정시술시획득한미성숙난자의환자연령에따른체외성숙률및수정률비교 분당서울대학교병원산부인과 1, 서울대학교의과대학산부인과학교실 2, 서울대학교의학연구원인구의학연구소 3 한상훈 1 이정렬 2 김현준 1 문정희 1 지병철 1 구승엽
More information10-1(조사보고서).PDF
Vol. No. Octob er 9 9 9 : 997 Curr ent St atus of A s sisted Repr oductiv e T echnology in K orea, 997-5 - .. 3. : 997... 3.. - 5 - - ( ) : 997-985,.,.,. 993 5, ( ), 99. 99 999 9 93 (Fig. ). 997.,.,,,,.
More information09구자용(489~500)
The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal
More informationuntitled
대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran
More informationPJTROHMPCJPS.hwp
제 출 문 농림수산식품부장관 귀하 본 보고서를 트위스트 휠 방식 폐비닐 수거기 개발 과제의 최종보고서로 제출 합니다. 2008년 4월 24일 주관연구기관명: 경 북 대 학 교 총괄연구책임자: 김 태 욱 연 구 원: 조 창 래 연 구 원: 배 석 경 연 구 원: 김 승 현 연 구 원: 신 동 호 연 구 원: 유 기 형 위탁연구기관명: 삼 생 공 업 위탁연구책임자:
More information???? 1
The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1
More information전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II)
전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) 전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) - i - - ii - - iii - - iv - - v - - vi - - vii - - viii - - ix - -
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More information°Ç°�°úÁúº´6-2È£
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine
More informationCloning
Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
More informationYI Ggodme : The Lives and Diseases of Females during the Latter Half of the Joseon Dynasty as Reconstructed with Cases in Yeoksi Manpil (Stray Notes w
497 의사학 제24권 제2호(통권 제50호) 2015년 8월 Korean J Med Hist 24 ː497-532 Aug 2015 c대한의사학회 http://dx.doi.org/10.13081/kjmh.2015.24.497 pissn 1225-505X, eissn 2093-5609 역시만필( 歷 試 漫 筆 ) 의 사례로 재구성한 조선후기 여성의 삶과 질병
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information<BCADBFEFBDC3BFA9BCBAB0A1C1B7C0E7B4DC5FBCADBFEFBDC320B0F8B5BFC0B0BEC6C1F6BFF8BBE7BEF7C0C720C1F6BCD3B0A1B4C9BCBA20B9E6BEC8BFACB1B828BCF6C1A431323330292E687770>
2015 정책연구-15 서울시 공동육아지원사업의 지속가능성 방안연구 책임연구원 : 조막래(서울시여성가족재단 가족정책실 연구위원) 위촉연구원 : 김한별(서울시여성가족재단 가족정책실) SEOUL FOUNDATION OF WOMEN & FAMILY 발 간 사 한 아이를 키우려면 온 마을이 필요하다 라는 인디언 격언이 있습니다. 십수년전에는 골목마다 아이들의 북적이는
More informationKinematic analysis of success strategy of YANG Hak Seon technique Joo-Ho Song 1, Jong-Hoon Park 2, & Jin-Sun Kim 3 * 1 Korea Institute of Sport Scienc
Kinematic analysis of success strategy of technique JooHo Song 1, JongHoon Park 2, & JinSun Kim 3 * 1 Korea Institute of Sport Science, 2 Catholic Kwandong University, 3 Yonsei University [Purpose] [Methods]
More information, ( ) 1) *.. I. (batch). (production planning). (downstream stage) (stockout).... (endangered). (utilization). *
, 40 12 (2006 6) 1) *.. I. (batch). (production planning). (downstream stage) (stockout).... (endangered). (utilization). * 40, 40 12 (EPQ; economic production quantity). (setup cost) (setup time) Bradley
More informationuntitled
대한수혈학회지:제21권 제2호, 2010 유전자 검사로 확인된 A 1 B weak 형 환자 1예 조치현ㆍ유병준ㆍ윤승규ㆍ최계령ㆍ최재열ㆍ김장수ㆍ임채승ㆍ김영기ㆍ이갑노 고려대학교 의과대학 진단검사의학교실 Using Genotyping to Identify an A 1 B weak Blood Group Chi-Hyun Cho, Byong-Joon Yoo, Seung-Gyu
More informationBuy one get one with discount promotional strategy
Buy one get one with discount Promotional Strategy Kyong-Kuk Kim, Chi-Ghun Lee and Sunggyun Park ISysE Department, FEG 002079 Contents Introduction Literature Review Model Solution Further research 2 ISysE
More information< C0CCB1E2BFED2DC0CCB8EDBDC D E687770>
원저 J Korean Neurol Assoc / Volume 24 / February, 200 젊은나이에산발성파킨슨병이생긴한국인환자의 Parkin 유전자변이 연세대학교의과대학신경과학교실, 영동세브란스병원신경과 Kee Ook Lee, M.D., Chul Hyoung Lyoo, M.D., Myung Sik Lee, M.D., Ph.D. Department of
More information975_983 특집-한규철, 정원호
Focused Issue of This Month Gyu Cheol an, MD Department of Otolaryngology ead & Neck Surgery, Gachon University of College Medicine E - mail : han@gilhospital.com Won-o Jung, MD Department of Otolaryngology
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
More information<30372EC0CCC0AFC1F82E687770>
산전 초음파상 진단된 단독 대조확장증의 출생 후 예후 울산대학교 의과대학 서울아산병원 산부인과학교실 이유진 원혜성 박상민 조현진 정 의 김선권 심재윤 이필량 김 암 Yu-Jin Lee, M.D., Hye-Sung Won, M.D., Sang-Min Park, M.D., Hyun-Jin Cho, M.D., Eui Jung, M.D., Sun-Kwon Kim,
More information현대패션의 로맨틱 이미지에 관한 연구
한지닥섬유제품의인체생리반응및쾌적성평가 임순 Evaluation of Thermal Physiological Responses and Comfort in Dox Fabric Soon Im Professor, Dept. of Fashion Industry, Incheon National University This study performed the evaluation
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More informationºÎÁ¤¸ÆV10N³»Áö
case of brugada syndrome presented as chest pain STRCT rugada syndrome was described in 1992 as a new clinical entity characterized by electrocardiographic STsegment elevation in the right precordial leads
More information07.... 01V28.
National Election Commission 9 September S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23/30 24 25 26 27 28 29 11 November S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
More information590호(01-11)
T H E K O R E A N D O C T O R S W E E K L Y www.docdocdoc.co.kr I N S I D E 38 3 5 6 7 10 13 28 29 30 31 38 41 42 2 Advertisement Government & Medicine 3 Government & Medicine 4 Government & Medicine Government
More information2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, )
Abstract Kim Dal-Rae, Kim Sun-Hyung* Dept. of Sasang Constitutional Medicine, College of Oriental Medicine, Kyung-Hee Univ. *Dept. of Sasang Constitutional Medicine, East-West Neo Medical Center, Kyung-Hee
More informationJkcs022(89-113).hwp
대한배뇨장애 및 요실금 학회지 J. Korean Continence Society 2004;8:89-113 Bristol Female Lower Urinary Tract Symptom 설문지의 한국어 번역 및 번역본의 언어 타당도 Seung-June Oh*, Hyung Geun Park*, Sung Hyun Paick, Won Hee Park and Myung-Soo
More information±èÇ¥³â
533 Fig. 1. Dead zone. Nine echoes are positioned 2-10 mm below the scan surface with 1 mm distance. All nine echoes are clearly visualized. 534 Fig. 2. Vertical and horizontal measurement. 10 cm distance
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More information°Ç°�°úÁúº´5-44È£ÃÖÁ¾
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis
More informationECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of
More informationÆ÷Àå½Ã¼³94š
Cho, Mun Jin (E-mail: mjcho@ex.co.kr) ABSTRACT PURPOSES : The performance of tack coat, commonly used for layer interface bonding, is affected by application rate and curing time. In this study, bonding
More informationAnalysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
More information<3230303420B0B3C0CEC1A4BAB8BAD0C0EFC1B6C1A4BBE7B7CAC1FD2E687770>
인터넷 전화/팩스/이메일 방문 접수통보 분쟁조정 신청 및 접수 Case Screening 불만의 해소, 타기관 이첩 등 증거수집, 전문가 자문 등 사실조사 조정전 합의권고 YES 합의 NO 조정결정 NO 민사소송 또는 포기 YES 종료 200 180 190 180 160 163 140 120 100 80 60 40 20 116 100 57 93
More information<494352503131335FC1F8B9E6B1B3C0B02E687770>
ICRP 간행물 113 진단 및 중재 절차를 위한 방사선방호 교육훈련 Education and Training in Radiological Protection for Diagnostic and Interventional Procedures 대한방사선방어학회 이 번역본 발간은 2011년도 원자력안전위원회 방사선안전기술 개 발사업 과제 지원(한국동위원소협회로 부터
More information저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
More information..........5-45..
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals
More information<C7D1B1B9B1B3C0B0B0B3B9DFBFF85FC7D1B1B9B1B3C0B05F3430B1C733C8A35FC5EBC7D5BABB28C3D6C1BE292DC7A5C1F6C6F7C7D42E687770>
기혼 여성이 사이버대학에서 상담을 전공하면서 겪는 경험 방기연 (고려사이버대학교 상담심리학과 부교수) * 요 약 본 연구는 기혼 여성의 사이버대학 상담전공 학과 입학에서 졸업까지의 경험을 이해하는 것을 목적으로 한 다. 이를 위해 연구참여자 10명을 대상으로 심층면접을 하고, 합의적 질적 분석 방법으로 분석하였다. 입학 전 에 연구참여자들은 고등교육의 기회를
More information<30382EC0C7C7D0B0ADC1C22E687770>
대한내과학회지: 제 76 권 제 2 호 2009 의학강좌-개원의를 위한 모범처방(Current Clinical Practice) 간기능검사의 이해와 적용 인제대학교 의과대학 일산백병원 내과학교실 김 경 아 Understanding and application of liver function tests Kyung-Ah Kim, M.D. Department of
More informationKor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on
More information