Infect Chemother 2011;43(5): 서론 재료 및 방법 황색포도알균(Staphylococcus aureus)은 인체에 흔하게
|
|
- 일섭 원
- 7 years ago
- Views:
Transcription
1 Original article Infect Chemother 2011;43(5): pissn eissn Infection & Chemotherapy 메티실린 내성 황색포도알균(Methicillin Resistant Staphylo coccus aureus, MRSA)의 분자역학 연구에서 IRS-PCR (Infrequent- Restriction-Site PCR)의 응용 신나영 1 유진홍 2 박철민 3 이동건 2 최수미 2 권재철 2 김시현 2 박선희 2 최정현 2 가톨릭대학교 의과대학 일반대학원 생명의과학과 1, 내과학교실 2, 가톨릭대학교 의과학연구원 3 Application of Infrequent-Restriction-Site Polymerase Reaction (IRS-PCR) to the Molecular Epidemiologic Analysis of Methicillin Resistant Staphylococcus aureus (MRSA) Background: We investigated the usefulness of infrequent-restriction-site polymerase chain reaction (IRS-PCR) compared with pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) on the molecular epidemiologic analysis of methicillin-resistant Staphylococcus aureus (MRSA). Materials and Methods: We used fifty clinical isolates of MRSA collected from 10 university hospitals located in Seoul. We performed three procedures on these isolates: PFGE using SmaI, IRS-PCR using XbaI-Hha I or EagI-Hha I, and MLST using seven house-keeping genes. We determined the clusters of molecular types by dendrogram using the unweighted pair group method with arithmetic mean (UPGMA) and Dice coefficients Results: MLST analysis showed that isolates exhibited ST1, ST5, ST72, ST89, and ST239. In PFGE, the isolates clustered into 5 major groups with 80% similarity, which subsequently became classified into 18 subgroups with 95% similarity. In IRS-PCR using EagI-HhaI restriction enzymes, there was little resolution among the patterns of isolates. However, Xba I-Hha I IRS-PCR showed 5 groups with a 90% similarity. These groups were then classified into 9 subgroups with a 95% similarity. There were no significant differences among the isolates from different hospitals. Conclusions: The XbaI-HhaI IRS-PCR method could be a useful tool in the molecular epidemiology of MRSA. Its resolution power was good enough to analyze isolates, because the patterns of IRS-PCR were closely correlated with those of MLST and showed diverse groups. Key words: Methicillin resistant Staphylococcus aureus, Pulsed Field Gel Electrophoresis, Infrequent restriction site PCR, Multilocus sequence typing Na-Young Shin 1, Jin-Hong Yoo 2, Chulmin Park 3, Dong- Gun Lee 2, Su-Mi Choi 2, Jae-Cheol Kwon 2, Si-Hyun Kim 2, Sun-Hee Park 2, and Jung-Hyun Choi 2 1 Department of Biomedical Science, The Catholic University of Korea, Graduate School, 2 Department of Internal Medicine, College of Medicine, and 3 Catholic Research Institutes of Medical Science, The Catholic University of Korea, Seoul, Korea Copyright 2011 by The Korean Society of Infectious Diseases Korean Society for Chemotherapy Submitted: July 6, 2011 Revised: August 23, 2011 Accepted: September 20, 2011 Correspondence to Jin-Hong Yoo, M.D. Division of Infectious Disease, Department of Internal Medicine, Bucheon St. Mary s Hospital, 2 Sosa-dong, Wonmi-gu, Bucheon , Korea Tel: , Fax: jhyoo@catholic.ac.kr
2 Infect Chemother 2011;43(5): 서론 재료 및 방법 황색포도알균(Staphylococcus aureus)은 인체에 흔하게 감염증 을 일으키는 병원균으로써, 피부연조직 감염증과 같은 가벼운 질환에 서부터 패혈증과 같은 전신성 중증질환을 일으키기도 한다. 특히 전 세 계적으로 문제가 되고 있는 메티실린 내성 황색포도알균(methicillin resistant S. aureus, MRSA)은 병원 감염의 주요 원인균이며, 최근 들 어서는 병원뿐만 아니라 지역사회 관련 메티실린 내성 황색포도알균 (community-associated MRSA, CA-MRSA)이 새로 운 문제로 대두되 고 있다[1-6]. 국내에 발표된 연구에서도, 국내 3차 병원에서 분리되는 S. aureus 중 MRSA는 70% 이상이며[7, 8], 1, 2차 병원에서도 40% 이상으로 보고되 고 있다[9]. MRSA에 의한 원내감염을 방지하기 위해서 MRSA의 감염 원, 감염경로의 정확한 파악이 필요하기 때문에 형별(typing)이 사용된 다[10]. 현재 MRSA의 분자역학적 형별법중 표준방법으로 사용되는 기법은 pulsed field gel electrophoresis (PFGE)이다[11]. 이는 genomic DNA 를 제한효소로 처리한 후 PFGE 장비를 이용하여, 일반적인 전기영동 방 법(electrophoresis system)으로 분리될 수 없는 커다란 크기의 DNA 절편을 분리하여 그 양상을 비교 분석하는 기법이다. 이를 이용하여 MRSA 균주의 집단방생 에 대한 분석과 역학적 형별, 그리고 유전적 관 계를 밝힐 수 있다는 장점들을 지닌다. 그러나 고가의 장비가 필요하고, 연구자가 능숙해질 때까지 많은 시간이 필요하며, 결과를 보기까지 시 일이 오래 걸리고 연구실 간의 재현성을 확보하는데 어려움이 있다. 또한 multiple house-keeping genes[12]을 이용한 multilocus sequence typing (MLST)는 유전적 다양성을 분석하는 PCR 방법으로 적은 양의 검체로 누구나 쉽게 실험할 수 있으나 염기서열분석에 비용 이 많이 들고 시일이 걸린다. 이에 보다 저렴하고 신속하게 시행하여 PFGE나 MLST에 필적하는 결과를 얻을 수 있는 여러 대안들이 개발되었다. 이들 중, infrequent restriction site PCR (IRS-PCR)이 제시되었는데[13], 이는 infrequent 와 frequent restriction site를 인식하는 두 종류의 제한 효소를 사용하 여 각 효소에 의해 잘려진 절단면에 결합하는 adaptor를 primer와 함 께 사용하여 필요한 부위만 선택적으로 증폭하여 확인하는 방법이다. IRS-PCR은 고가의 장비가 필요 없으며 DNA를 증폭하여 사용하기 때 문에 적은 양으로도 실험이 가능하여 PFGE와 MLST보다 단시간에 수 행할 수 있으며, 재현성 확보에도 유리한 방법으로 평가 받고 있다. 하지 만 IRS-PCR은 현재까지 그람 음성균에만 사용되어 왔고 많은 종에 응 용되지 않아 추가적인 검증이 필요하다. 이에 본 연구진은 이 기법이 분 자역학적 분석을 위한 대안 수단이 될 수 있는지 여부를 확인해보기 위 하여 대표적인 그람양성균인 MRSA를 대상으로 한 분자역학연구에서 IRS-PCR의 적용 가능성을 평가해 보고자 본 연구를 시행하였다. 1. 실험균주 및 세균학적 검사 서울, 경기도에 위치하는 9곳의 대학병원에서 2008년 5월부터 2009 년 3월까지 MRSA에 감염된 중환자실 환자의 비강배양(nasal swab)과 균혈증(bacteremia) 검체에서 분리된 MRSA 수집균주와 가톨릭대학 교 의과학연구소 감염내과학 연구실에 보관된 MRSA 균주를 대상으로 사용하였다. 각 병원에서는 각각의 균주를GP 카드와 AST-P601 카드를 이용한 Vitek II automated system (biomérieux, Hazelwood, MO, USA) 을 사용하거나 PBC28 카드를 이용한 MicroScan Pos Combo Panel Type 6 automated system (Baxter Diagnostics, West Sacramento, CA, USA)를 사용하여 항균제 감수성 검사를 하여 MRSA를 감별하였 다. 이렇게 수집된 균주는 다시 실험실에서 최종확인으로 혈액 한천 배 지(BAP; Komed, Korea)에 접종하여 37 에서 18시간 순수 배양하여 그람염색법을 시행하여 현미경으로 균체의 형태를 확인 한 후 단일 집 락을 선별한 후 mannitol salt agar (MI; Difco Lab., Livonia, USA)에 접 종하여 37 에서 48시간 동안 배양하여 관찰하는 통해 screening[14, 15] 검사를 실시하여 보관되었다. 분자생물학적 연구를 위한 세균배양은 brain heart infusion (BHI; becton dickonson {BD}, Franklin Lakes, NJ, USA)와 luria bertani (LB; BD, Franklin Lakes, NJ, USA) broth에서 이루어졌다. 2. 분자 역학 방법 1) PFGE PFGE를 위한 DNA 분리는 Schwartz[16] 방법을 일부 수정하여 실시 하였다. MRSA 균주를 3 ml의 LB broth에 접종하여 37 에서 13,000 rpm 으로 16시간 동안 배양하였다. 분광광도계(SPECTRONIC 20D+, Thermo Electron Scientific Instruments Corporation, Madison, WI, USA) 610 nm에서 OD 0.3 ( CFU/mL)이 되도록 조정하고 희 석하여 최종농도는 각 tube 당 ~ CFU/mL로 하였다. 침사에 lysis I buffer (30 mm Tris-hydrochloride; ph8.0, 1M NaCl, 100 mm EDTA-NaOH, 0.5% Brij-58, 0.2% Sodium deoxychlolate, 0.5% Sodium laurylsarcosine) 50 μl를 첨가한 다음, 37, 30분 정도 배양한 후 2% CleanCut agarose (CHEF Genomic DNA Plug Kit, Bio- Rad Laboratories, Hercules, CA, USA) 50 μl와 100units Lysostapin (Sigma Chemical Corp., St. Louis, MO) 2 μl를 혼합하여 4 에서 굳 혀 1% plug를 만들었다[11]. Plug를 lysis II buffer (50 mm Tris-HCl ph 7.4, 100units Lysostapin, Lysozyme 1 mg/ml) 300 μl에 37 에 서 1시간 반응 후 Lysis I buffer 250 μl에 37 에서 1시간 더 추가 반응 시켰다. 다시 proteinase K buffer (0.5M EDTA-NaOH, 25 units/ml proteinase K) 300 μl에 넣어 50 에서 하룻밤 반응하였다. 다음 날 증 류수와 washing buffer로 3회 이상 반복 세척 후 TE 완충액에 넣어 4 에 보관하였다.
3 398 NY Shin, et al. IRS-PCR on MRSA 제한효소 처리는 20U의 SmaI을 사용하여 25 에서 4시간 반응 시켰다[17]. CHEP DR III (Bio-Rad Laboratories Inc.)에서 block I (Switching time 5-15초, 200V, 6V/cm, 10시간 14 ) 와 block II (Switching time 15-60초, 200V, 6V/cm, 13시간 14 )의 조건으로 전 기영동 하였다. S. aureus 표준균주인 NCTC 8325를 normalization 하는데 사용하 였다. PFGE 군집(cluster) 분석은 fingerprinting II informatix software (Bio-Rad Laboratories, Hercules, CA, USA)으로 데이터 베이스 화 하였다. unweighted pair group method with arithmetic mean (UPGMA)와 dice coefficients 방법을 통해 dendrogram을 얻었다 (band position tolerance-1.25 or 1, optimization-0.5%). pulseulsed-field type (PFT) clusters는 Tenover 등이 제시한 기준에 따라 판독 하였다(similarity coefficient of 80%)[18]. 2) MLST 균주의 allelic profile은 Mark Enright[12] 방법을 일부 수정하여 수 행하였다. PCR 반응액은 MRSA의 임상 분리주의 Genomic DNA 50 ng과, 0.25 U Taq polymerase (Boehringer Mannheim, Indianapolis, Ind.), 1 PCR buffer (20 mm TrisHydro-chloride; ph8.0, 100 mm KCl, 0.1 mm EDTA, 1 mm dithiothreitol), 200 μm dntp mixture (2.5 mm each), 각각의 0.2 μm primer, DW (final volume 50 μl)을 혼합하여 준 비한 후 My cycler (Bio-Rad Laboratories)를 사용하여 중합효소 연쇄 반응을 시행하였다. PCR 조건은 초기 변성(denaturation)단계는 95 에서 3분, 변성 94 에서 30초, primer 결합(annealing)단계는 55 에서 30초, DNA 합성(extension)단계는 72 에서 1분으로 30회 시행 후 마지막 DNA 합성단계는 72 에서 5분으로 하였다. MRSA DNA로 7가지의 유전자를 PCR 한 후 그 산물을 염기서열 분 석하였다. 각 균주들의 검사결과에 따른 sequence type (STs)은 S. aureus MLST server ( 통하여 분리되 어 결정되었다. 3) IRS-PCR (1) Adaptor and primers Adaptor 제작은 Handley SA [20] 가 제시한 방법과 수정한 방법을 동시에 수행하여 비교하였다. HhaI (AH1 & AH2 또는 AH1 & AH2-new), XbaI (AX1와 AX2 또는 AX1와 AX2-new), EagI (AE1 & AE2 또는 AE1 & AE2-new) adaptor는 각 oligonucleotide 조합을 균등한 양(20 pmol/μl each)으로 혼합하여 2시간 동안 95 에서 4 로 냉각시켜 만든 후 -20 에 보존 하였다. 이번 연구에서는 adaptor의 안정성을 높이고 PCR과정의 선택성을 높이기 위하여 oligonucleotides는 GC% 가 50-60% 이상으로 하여 melting temperature (Tm) 값이 상향 조정된 oligonucleotides를 새 로 설계하였고 Fast PCR (Running PCR)을 이용하여 PCR efficiency (quality)를 높였다. In silico server ( 통하여 기존 염 기서열분석이 완료된 S. aureus genomic DNA에서 XbaI, EagI, HhaI 의 restriction fragment length polymorphism (RFLP) 패턴을 미리 예측하였다. 사용된 S. aureus 균주의 목록은 S. aureus RF122, Mu50, COL, ED98, JH1, JH9, MRSA252, MSSA476, MW2, Mu3, N315, NCTC 8325, USA300_FPR3757, USA300_TCH1516이었다. 약 20개에서 30개 밴드 패턴이 예측된 primers (XbaI primers; PX-CG & PX-GC, EagI primers; PE-C & PE-T)그룹을 선택하여, IRS-PCR의 선택성과 전기영 동의 분석능을 최적화하도록 하였다. 각각의 adaptor와 primers는 Table 1과 같다. (2) Digestion & ligation 1983년 Dyer DW[21] 방법을 응용하여 QIAamp DNA Mini kit (QIAGEN, Hilden, Germany)를 이용해서 genomic DNA를 분리하고 정량 하였다. 임상 분리균의 chromosomal DNAs는 1 μg, 1 NEB buffer 4 (ph 7.9; 50 mm potassium acetate, 20mM Tris-acetate, 10 mm magnesium acetate, 1 mm dithiothreitol), DW (final volume, 40 μl), 1 BSA에 10 U HhaI와 10 U XbaI 또는 10 U HhaI와 10 U EagI를 넣 어 37 C에서 3시간 동안 반응시킨 후 65 에서 20분간 불활성화 시켰 다[13]. 잘린 DNA 10 μl, T4 DNA ligase (400 U), ATP (12.6 pmol), 1 ligase buffer (ph 7.5; 1 mm ATP, 50 mm Tris-acetate, 10 mm magnesium acetate, 10 mm dithiothreitol), HhaI adaptor (AH 또는 AH-new 20 pmol), XbaI adaptor (AX 또는 AX-new 20 pmol) 또는 Table 1. Adaptors and Primers Used in Infrequent Restriction Site Polymerase Chain Reactions Oligonucleotide Sequence References HhaI adaptor AH1 5'-AGA ACT GAC CTC GAC TCG CAC G-3' a Handley SA et al.,2002 AH2 3'- TG AGC GT-5' Handley SA et al.,2002 AH2-new 3'-TGA CTG GAG CTG AGC GT-5' In this study XbaI adaptor AX1 5'-PO4-CTA GTA CTG GCA GAC TCT-3' Handley SA et al.,2002 AX2 3'- AT GAC CG-5' b Handley SA et al.,2002 AX2-new 3'- AT GAC CGT CTG -5' c In this study XbaI primers, PX-CG 5'-AGA GTC TGC CAG TAC TAG ACG-3' In this study XbaI primers, PX-GC 5'-AGA GTC TGC CAG TAC TAG AGC-3' In this study EagI adaptor AE1 5'-PO4-GGC CTA CTG GCA GAC TCT-3' Handley SA et al.,2002 AE2 3'- AT GAC CG-5' b Handley SA et al.,2002 AX2-new 3'- AT GAC CGT CTG -5' c In this study EagI primers, PE-C 5'-AGA GTC TGC CAG TAG GCC GC-3' In this study EagI primers, PE-T 5'-AGA GTC TGC CAG TAG GCC GT-3' In this study a AH1 serves as part of the adaptors and primers as the HhaI primer. b,c EagI and XbaI use the same sequence for this portion of the adaptor.
4 Infect Chemother 2011;43(5): EagI adaptor (AE 또는 AE-new 20 pmol), DW (final volume, 20 μl) 혼합하여 16 C에 1시간 동안 반응시켜 ligation 후 65 에서 20분간 불 활성화 시켰다(Fig. 1)[22]. 4) PCR IRS-PCR은 Mazurek GH[13]와 Yoo JH[24]의 방법을 수정하여 수 행하였다. 혼합물 template DNA 50 ng (1/50th of the ligation-redigestion product), 0.25 U Taq polymerase, 1 PCR buffer, 200 μm dntp mixture (2.5 mm each), 20pmol AH1 primer, PX-CG primer 또는 PE-C 20 pmol, DW (final volume, 50 μl) 혼합한 후 My cycler를 사용 하여 중합효소 연쇄 반응을 증폭 시켰다[23]. PCR조건은 XbaI-HhaI는 95 에서 15분간 초기 변성시킨 후 변성단 계는 94 에서 1분, primer 결합단계는 61 에서 1분, DNA 합성단계는 72 에서 2분으로 25회 시행 후 마지막 DNA 합성단계는 72 에서 10 분으로 하였고, EagI-HhaI는 95 에서 15분간 초기 변성시킨 후 변성 단계는 94 에서 1분, primer 결합단계는 67 에서 1분, DNA 합성단계 는 72 에서 2분으로 25회 시행 후 마지막 DNA 합성단계는 72 에서 10분으로 하였다[13]. 5) Pattern 분석 IRS-PCR product는 PAGE (Polyacrylamide gel Electrophoresis) analysis로 1 TBE buffer (ph 8.0, 89 mm Tris base, 89 mm Boric acid, 2 mm EDTA), 6.5% Polyacrylamide gel로 180 volt에서 1시간 10 분 동안 얼음 수조에 넣고 전기영동 하였다. DNA marker로 25bp ladder (Bioneer)를 사용하였다. EtBr로 20분 염색하고 증류수로 10분간 세척 후 Gel Doc에서 UV illumination으로 이미지를 얻었다[23, 24]. IRS-PCR 군집 분석은 Fingerprinting II Informatix software으로 데이터 베이스화 하여 dice coefficients 방법을 통해 dendrogram을 얻었다(band position tolerance-1.5, optimization-0.5%). 결과 1. Adaptor 설계 Fast PCR을 이용해 확인한 결과 기존의 논문들에서 사용한 adaptor 중 Tm값이 AH2의 경우 23.3, AX2 (AE2)의 경우 18.8 로 측정되었 다. Tm값이 낮고 PCR 산물이 제대로 증폭되지 않았으며 실험의 재현성 이 확보되지 않았다(Fig. 2A). 그래서 adaptor의 안정성을 높이기 위하여 Tm 값이 각각 56.6 Digestion HhaI XbaI 5...G C G C...T 3...C G C G...A G A T C HhaI Ligation XbaI HhaI HhaI C T A G A...G C G C...G C G T...C G C G...C XbaI HhaI HhaI HhaI C...3 G C G AGA GTC TGC CAG TA (AX2) CTAGA...GCG (AH2) C GTGCGAGTCGAGGTCAGTTCT TCT CAG ACG GTC AT GATC (AX1) T...C (AH1) G C G CACGCTCAGCTCCAGTCAAGA..-5 Denaturation XbaI HhaI 5 -..AGA GTC TGC CAG TA (AX2) CTAGA...GCG (AH2) C GTGCGAGTCGAGGTCAGTTCT TCT CAG ACG GTC AT GATC (AX1) T...C (AH1) G C G CACGCTCAGCTCCAGTCAAGA..-5 Initial primer annealing 5 -..AGA GTC TGC CAG TA CTAG ACG (PX-GC primer) 3 -..TCT CAG ACG GTC AT GATC (AX1) T...C (AH1) G C G CACGCTCAGCTCCAGTCAAGA..-5 Initial extension AH AGA GTC TGC CAG TA CTAG ACG (PX-GC primer) 3 -..TCT CAG ACG GTC AT GATC (AX1) T...C (AH1) G C G CACGCTCAGCTCCAGTCAAGA..-5 Figure 1. Schematic presentation of IRS-PCR.
5 400 NY Shin, et al. IRS-PCR on MRSA A B C Figure 2. IRS-PCR electrophoretic patterns of MRSA produced by amplification of restricted-ligated XbaI-HhaI fragments. (A) Lane 1 and 10 contained 25-bp ladders; lane 2 through 9 contained clinically isolated strains using adaptor (AH1&AH2, AX1 & AX2, AE1 & AE2) and primer PX-C. (B) Lane 1, 8, and 15 contained 25-bp ladders; lane 2 through 7 and 9 through 14 contained clinically-isolated strains using new adaptor (AH1 & AH2-new, AX1 & AX2-new, AE1 & AE2-new) and primer PX-C. (C) Lane 1 and 10 contained 25-bp ladders; lane 2 through 9 contained clinically-isolated strains using new adaptor (AH1 & AH2-new, AX1 & AX2-new, AE1 & AE2-new) and primer PX-CG. adaptor를 이용한 IRS-PCR 결과는 PX-C primer (PX-N)를 사용할 경우 PCR 증폭산물이 너무 많아 구별이 어려웠지만(Fig. 2B), PX-CG primer (PX-NN)의 경우 PCR산물이 적당하게 증폭되어 IRS-PCR 조건 에 최적화되었다(Fig. 2C). EagI-HhaI adaptor를 이용한 IRS-PCR를 수행하여 측정한 결과는 밴드 수가 매우 적고 구별점도 없어, 변별력을 찾기 어려웠다. Figure 3. Representative products of PFGE. Lane 1, 7, 13, and 20 contained DNA marker (NCTC8325 S. aureus); lane 2 through 6, 8 through 12, and 14 through 19 contained clinically-isolated strains. 와 38.8 로 상향되도록 새로 설계한 AH2-new, AX2-new & AE2- new라는 adaptor를 고안하였다. 이렇게 Tm값을 높여 새로 설계한 adaptors로 IRS-PCR를 실시한 결과, PCR 증폭 산물이 안정적으로 증 폭되었다(Fig. 2C). 2. In silico 방법을 통한 S. aureus에서의 IRS-PCR 방법론적 확립 In silico server를 통하여 S. aureus genomes에서 RFLP 패턴을 미 리 예측한 결과, XbaI 이용 시 개, HhaI 이용 시 3000개 이상, EagI 이용 시 25-29개의 Site를 예측할 수 있었다. 또한 XbaI를 이용한 IRS-PCR에서 PX-CG primer를 선택 증폭할 경우 17-23개, PX-GC primer의 경우 26-29개의 밴드 패턴으로 예측되었다. 즉, XbaI-HhaI 3. PFGE, MLST, IRS-PCR 분자역학방법 비교 PFGE와 IRS-PCR을 통해 얻은 대표적인 전기영동 결과는 각각 Fig. 3 와 Fig. 4에 예시하였다. IRS-PCR 결과, 비슷한 패턴의 밴드가 형성되었지만 MLST 형별(Sequence type)을 기준으로 보면 각각의 다른 패턴을 형성하여 변별력을 찾아볼 수 있었다. 총 50주의 MRSA DNA를 SmaI 제한효소로 처리하여 PFGE를 수 행한 결과를 군집분석하여 얻은 dendrogram을 보면, pulsotype은 80% similarty 수준에서 볼 때 총 5가지(A-E)의 군집으로 분류되었다 (Fig. 5). MRSA DNA를 7가지의 house-keeping gene의 염기서열 분석을 통 하여 MLST 형별(Sequence type)을 검사한 결과 총 50주 중 9주가 ST5 였으며, 3주가 ST1, 4주가 ST89, 16주가 ST239, 18주가 ST72였다(Table 2). PFGE similarty 90% 수준에서 볼 때는 ST5 균주내에서 A-1, A-2, A-3으로 3가지 군집, ST1 균주내에서 B-1, B-2로 2가지 군집, ST89 균 주내에서 C로 1가지 군집, ST239 균주내에서 D로 1가지 군집, ST72 균 주내에서 E-1, E-2, E-3로 3가지 군집으로 나타났고 PFGE similarty 95% 수준에서 볼 때에는 ST5 균주내에서 A-1, A-2, A-3, A-4로 4가 지 군집, ST1 균주내에서 B-1, B-2, B-3로 3가지 군집, ST89 균주내에
6 Infect Chemother 2011;43(5): A B C D Figure 4. IRS-PCR electrophoretic patterns of MRSA produced by amplification of restricted-ligated XbaI-HhaI DNA using primer PX-CG in MRSA. The lane 1 in each gel contained 25-bp ladders; (A) ST239 isolates. (B) lane 2 to 5 contained ST89 isolates; lanes 6 to 9 contained ST72 isolates. (C) ST1 isolates. (D) ST5 isolates. Figure 5. Dendrogram of MRSA in PFGE.
7 402 NY Shin, et al. IRS-PCR on MRSA Figure 6. Dendrogram of MRSA in IRS-PCR. Table 2. Comparison of Genotypes between MLST, IRS-PCR and PFGE Strain ( ) a MLST IRS-PCR PFGE Strain MLST IRS-PCR PFGE Cm621 (Kk) ST5 a A-3 Cm626 (Sb) ST239 d D Cm609 (Kh) ST5 a A-3 Cm517 (Sb) ST239 d D Cm515 (Sb) ST5 a A-3 Cm813 (Kk) ST239 d D Cm642 (Kh) ST5 a A-3 Cm680 (Sb) ST239 d D Cm514 (Sb) ST5 a A-3 Cm695 (Sb) ST239 d D Cm705 (Cs) ST5 a A-3 Cm702 (Cs) ST239 d D Cm730 (Sb) ST5 a A-1 Cm720 (Cs) ST239 d D Cm721 (Cs) ST5 a A-3 Cm509 (Cs) ST72 e E-1 Cm745 (Is) ST5 a A-2 Cm513 (Sb) ST72 e E-1 Cm620 (Kk) ST1 b B-2 Cm633 (Cs) ST72 e E-1 Ws19 (Ws) ST1 b B-1 Cm634 (Cs) ST72 e E-1 Ja9 (Ja) ST1 b B-1 Cm531 (Cs) ST72 e E-1 Ws10 (Ws) ST89 c C Cm636 (Cs) ST72 e E-1 Ws29 (Ws) ST89 c C Cm643 (Sb) ST72 e E-1 Sc24 (Sc) ST89 c C Cm646 (Kk) ST72 e E-1 Ws2 (Ws) ST89 c C Cm820 (Ks) ST72 e E-1 Cm598 (Sb) ST239 d D Cm765 (Cs) ST72 e E-1 Cm511 (Cs) ST239 d D Cm814 (Kk) ST72 e E-3 Cm512 (Sb) ST239 d D Cm824 (Kk) ST72 e E-2 Cm572 (Sb) ST239 d D Cm772 (Cs) ST72 e E-3 Cm600 (Sb) ST239 d D Cm773 (Kk) ST72 e E-1 Cm656 (Sb) ST239 d D Cm648 (Sb) ST72 e E-1 Cm657 (Sb) ST239 d D Cm662 (Cs) ST72 e E-1 Cm678 (Sb) ST239 d D Cm664 (Kh) ST72 e E-1 Cm677 (Sb) ST239 d D Cm708 (Cs) ST72 e E-1 a Abbreviation of hospital name. 서 C-1, C-2로 2가지 군집, ST239 균주내에서 D-1, D-2로 2가지 군집, ST72 균주내에서 E-1, E-2, E-3, E-4, E-5, E-6, E-7로 7가지 군집으로 나타났다(Fig. 5). 반면, XbaI-HhaI 제한효소로 처리한 IRS-PCR를 수행한 결과를 군 집분석하여 얻은 dendrogram을 보면, 90% similarty 수준에서 총 5가 지(a-e)군집으로 분류 되었다(Fig. 6). IRS-PCR similarty 95% 수준에서 볼 때에는 ST5 균주내에서 a로 1 가지 군집, ST1 균주내에서 b로 1가지 군집, ST89 균주내에서 c로 1가 지 군집, ST239 균주내에서 d-1, d-2, d-3, d-4로 4가지 군집, ST72 균 주내에서 e-1, e-2로 2가지 군집구분이 가능 하였다. 그리고 ST1 인 b 군집(Ws19, Cm620, Ja9)은 각각 유사도 100%이었다. 같은 MLST ST5와 ST72를 기준으로 보았을 때 IRS-PCR은 모두 같 은 밴드 패턴을 보였으나 PFGE의 경우엔 3가지의 밴드 패턴을 볼 수 있 었고, ST1를 기준으로 보았을 때에도 IRS-PCR은 모두 같은 밴드 패턴 을 보였으나 PFGE의 경우엔 2가지의 밴드 패턴을 볼 수 있었다. 반면에 ST89, ST239는 PFGE, IRS-PCR 모든 방법에서 같은 밴드 패턴을 볼 수 있었다(Table 2). 즉, IRS-PCR과 PFGE의 2가지 형별에서는 같았으나 3가지 형별에서 는 다르다는 걸 확인할 수 있었고, MLST와 IRS-PCR의 형별 구분은 일 치하였다. 또한 IRS-PCR 뿐만 아니라 MLST, PFGE 모두 병원별 다르지 않았다.
8 Infect Chemother 2011;43(5): 고찰 S. aureus은 인간에 기거하는 주요 정상세균총(normal bacterial flora)의 하나이며 코, 인두, 손, 목, 피부, 회음부, 겨드랑이 등 온몸에 서 발견되지만 주요 서식처는 전비공(anterior nares)의 편평 상피세 포(squamous epithelium)이다[25]. 건강한 숙주에서는 정상세균총 의 일부로 존재하지만 특정요인 등에 의해 감염을 일으키는 기회감염 균(opportunistic infection)이다. S. aureus의 비강 집락형성(nasal colonization)은 감염증의 주요 위험요소이고 높은 분포로 보고되기도 하였다[26]. 특히 전 세계적으로 문제가 되고 있는 MRSA는 농양이나 창 상감염 등의 피부감염, 패혈증, 폐렴, 독성쇼크증후군, 식중독 등의 여러 가지 감염을 일으킬 수 있는 중요한 병원성 세균이다. 원내감염의 중요 한 원인 균이지만 근래에는 지역사회감염도 증가되고 있다[27]. 질병관 리예방본부(Centers for Disease Control, CDC)는 수술창상 또는 입 원 후 72시간 이상 경과한 환자의 모든 부위에서 MRSA가 검출되는 경 우를 병원 감염(Hospital infection)이라 정의하였고, 그 전에 MRSA가 검출되는 경우를 지역사회 감염(community-associated infection)이 라 정의 하였다[28]. CA-MRSA에 의한 감염도 HA-MRSA와 같이 증가 되고 있다. 그러므로 본 연구에서 MRSA를 대상으로 역학을 규명하여 대표 균주 여부를 파악하는 것을 주된 목표로 하여 보다 나은 분자생물 학적 기법을 확립하고자 하였다. 현재까지 변별력 및 재현도 면에서 다른 형별 분류 방법보다 우월하 고 단 기적 변화만을 분석하기 위한 목적으로 PFGE를 사용하지만 고가 의 장비가 따로 필요하고 능숙해질 때까지 많은 시간과 노력이 필요한 방법이고 결과를 얻기까지 오랜 시간이 걸리는 단점이 있다. 또한 7개의 house-keeping genes의 염기서열을 분석하여 유형 (ST)을 결정하 는 MLST는 유전자의 장기적 역학 변동을 반영하고 검사 실간 변이가 없어 전세계적 역학을 추정[29] 할 수 있으나 염기서열분석 을 위해 수탁한 후 결과를 MLST server를 통해 분석하여 얻으므로 시 일이 걸리고 비용도 많이 들었다. 반면 IRS-PCR 방법은 adaptor를 primer와 함께 사용하여 필요한 부 위만 선택적으로 짧은 시간 내에 증폭하여 확인하는 방법으로 적은 양 으로도 실험이 가능하며 고가의 장비가 필요 없으며 DNA만 준비되어 있으면 하루 만에 결과를 얻을 수 있어 PFGE 보다 적은 시간과 적은 노 동력이 필요하였다. 이런 이유로, 현재까지 개발된 분석 방법들과 비교해서 보다 능률적 인 대안일 것이라는 기대 하에 본 연구를 수행 하였다. 그러나 과거의 방 법을 바탕으로 실험해 보면서 몇 가지 문제점을 발견할 수 있었다. 일단 ligation 단계에서는 회사마다 ligation 반응온도가 달라 모두 사용해 보 았다. 실온에서 반응하는 ligation kit를 사용하였을 때 반응을 하지 않 아 최종적으로 밴드 형성이 되어지지 않았다. 이에 16 에서 반응 할 수 있는 ligation kit를 사용하였더니 반응을 하여 밴드형성이 되었다. 그러 나 최종적으로 두 가지 패턴의 밴드만을 형성하여 변별력이 좋다고 볼 수 없었다. Kit 상의 문제만이 아니었던 것으로 추정되었다. 그래서 다시 adaptor와 primer의 문제점을 찾아 보완하였다. 처음 사용했던 adaptor는 Tm값이 낮아서 좋은 결과를 얻지 못하였 다. 안정성을 높이기 위하여 Tm값을 높여 새로 설계한 adaptors로 IRS- PCR를 실시한 결과, PCR 증폭 산물이 안정적으로 증폭되었다. 그러나 PX-N primer를 사용할 경우 PCR 증폭산물이 너무 많아 구 별이 어려웠다. 그래서 PCR 산물이 적당하게 증폭할 수 있게 PX-NN primer를 사용하여 IRS-PCR 조건 최적화시킬 수 있었고 변별력도 향상시킬 수 있었다. 이 외의 각 단계별로의 시간 조절을 해 본 결과 위 의 방법의 조건에서 최적의 결과를 얻을 수 있었다. 그리고 Mazurek GH[13]에서는 ligation 단계 후에 digestion을 잠시 동안 한번 더 반응 시킨 후 IRS-PCR를 하였는데 이 단계를 거친 결과와 거치지 않은 결과 는 별 차이가 없어 실험 간소화를 위해 이 단계는 생략하였다. 또한 S. aureus genomes에서 SmaI을 이용 시 RFLP 패턴은 25-37개 의 Site를 예측할 수 있어 가장 좋은 제한 효소라 생각할 수 있으나 절편 에 blunt ends를 생성하는 제한효소이기 때문에 ligation시 비특이적 결합이나 이에 따라 PCR 증폭시 재현성이 매우 떨어질 수 있는 단점이 있어[20] 이번 연구설계에서는 SmaI을 이용한 IRS-PCR 방법은 배제하 였다. 최종적으로 전기영동한 결과를 데이터 베이스화하여 형성된 dendrogram을 관찰해 보았을 때 밴드 패턴은 같은데도 ladder의 영향 으로 서로 다른 군으로 나뉘게 되는 문제점을 발견하였다. 그 원인은 전기영동 시 polyacrylamide gel이 주위 영향을 쉽게 받는 것이라 생각하여 완충액(Buffer)을 한 번에 만들어 전기영동 시마다 덜 어 쓰고 완충액이 담긴 통을 얼음 수조에 담아 전기영동을 실시하여 같 은 조건으로 맞추어 문제점을 해결 할 수 있었다. 이 연구에서 50주의 MRSA 임상 균주를 분석 한 결과 MLST 시행 시 5가지(ST1, ST5, ST72, ST89, ST239) 형으로 구별되었고, PFGE pulsotype은 80% similarty 수준에서는 총 5가지(A-E) 군집으로 분류 되었고 90% similarty 수준에서는 총 10가지 군집으로, 95% similarty 수준에서는 총 18가지 군집으로 분리되었다. 그리고 응용된 IRS-PCR 을 시행한 결과 EagI-HhaI 사용시에는 뚜렷한 변별력을 찾을 수 없었 지만, XbaI-HhaI 사용시에는 밴드수가 많고 뚜렷한 구별점을 찾을 수 있어 90% similarty 수준에서는 총 5가지(a-e) 군집으로 분류되었고 95% similarty 수준에서는 총 9가지 군집으로 분리되었다. MLST 형을 기준으로 하여 IRS-PCR과 PFGE의 결과를 비교해 보았 을 때 IRS-PCR의 밴딩 패턴은 PFGE와 거의 일치했다. 검사 소요 시간을 비교해 보면 평균적으로 PFGE는 4일이 소요되고 MLST는 3일이 소요되는 반면 IPS-PCR은 이틀 이내로 수행할 수 있었 다. IRS-PCR 방법을 사용시에는 EagI-HhaI 조합보다는 XbaI-HhaI를 사용하여 형별 변별력을 높일 수 있었다. 용도면에서는 단기간의 동시다 발 감염(outbreak)을 분석하기 위해서는 IRS-PCR 방법 보다는 PFGE 방법으로 시행하는 것이 좋을 것으로 본다. 반면에, IRS-PCR 방법이 MLST 보다 시간과, 노력, 비용을 크게 절감할 수 있는 적절한 대안이 될 수 있다고 생각한다. MRSA 분자역학연구에서 IRS-PCR 방법의 확립은 기존 PFGE와 MLST의 시간적, 경제적 비용을 절감 시킬 수 있을 것으로 기대된다. 또 한 IRS-PCR이 MRSA 분자역학연구 및 진단에서 그람양성균에도 유용
9 404 NY Shin, et al. IRS-PCR on MRSA 함을 확인한 바 향후 MRSA 이외의 다른 그람 양성균들에도 대상 범위 를 넓힘으로 분자 역학연구의 발전에 기여 할 수 있을 것이라 기대된다. 감사의 글 본 연구는 2009년 질병관리본부 용역개발과제의 연구개발비지원( A )에 의해 수행됨. 또한 2008년 3월 18일에 가톨릭대학교 의과대학 생명의학연구윤리 (IRB)에서 승인(HCMC08OT007) 받음. References 1. Williams REO, Jevons MP, Shoote RA, Thom BT, Noble WC, Lidwell OM, White RG, Taylor GW. Isolation for the control of staphylococcal infection in surgical wards. Br Med J 1962; 2: Saravolatz LD, Markowitz N, Arking L, Pohlod D, Fisher E. Methicillin resistant Staphylococcus aureus. Epidemiologic observation during a community-acquired outbreak. Ann Intern Med 1982;96: Klein E, Smith DL, Laxminarayan R. Hospitalizations and deaths caused by methicillin-resistant Staphylococcus aureus, United States, Emerg Infect Dis 2007;13: Hussain FM, Boyle-Vavra S, Daum RS. Community-acquired methicillin-resistant Staphylococcus aureus colonization in healthy children attending an outpatient pediatric clinic. Pediatr Infect Dis J 2001;20: Suggs AH, Maranan MC, Boyle-Vavra S, Daum RS. Methicillin-resistant and borderline methicillin-resistant asymptomatic Staphylococcus aureus colonization in children without identifiable risk factors. Pediatr Infect Dis J 1999;18: Miller LG, Perdreau-Remington F, Rieg G, Mehdi S, Perlroth J, Bayer AS, Tang AW, Phung TO, Spellberg B. Necrotizing fasciitis caused by community-associated methicillin-resistant Staphylococcus aureus in Los Angeles. N Engl J Med 2005;352: Chong Y, Lee K. Present situation of antimicrobial resistance in Korea. J Infect Chemother 2000;6: Kim JM, Park ES, Jeong JS, Kim KM, Kim JM, Oh HS, Yoon SW, Chang HS, Chang KH, Lee SI, Lee MS, Song JH, Kang MW, Park SC, Choe KW, Pai CH. Multicenter surveil lance study for nosocomial infections in major hospitals in Korea. Nosocomial Infection Surveillance Committee of the Korean Society for Nosocomial Infection Control. Am J Infect Control 2000; 28: Kim HB, Sa CM, Yoo J, Kim BS, Yun OJ, Yoon HR, Lee YS. Antibiotic resistance patterns of Staphylococcus aureus isolated from the patients admitted to non-teriary hospitals. Korean J Infect Dis 2000;32: Kim SM, Lee DC, Park SD, Kim BS, Kim JK, Choi MR, Park SY, Hwang SM, Shin NY, Shim ES, Kwon PS, Kwon DY, Hur SH, Kim HJ, Lim HB, Chong Y. Genotype, coagulase type and antimicrobial susceptibility of methicillin-resistant Sta phylococcus aureus isolated from dermatology patients and healthy individuals in Korea. J Bacteriol Virol 2009;39: McDougal LK, Steward CD, Killgore GE, Chaitram JM, Mc- Allister SK, Tenover FC. Pulsed-field gel electrophoresis typing of oxacillin-resistant Staphylococcus aureus isolates from the United States: establishing a national database. J Clin Microbiol 2003;41: Enright MC, Day NP, Davies CE, Peacock SJ, Spratt BG. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J Clin Microbiol 2000;38: Mazurek GH, Reddy V, Maston BJ, Haas WH, Crawford JT. DNA fingerprinting by infrequent-restriction-site amplification. J Clin Microbiol 1996;34: Lally RT, Ederer MN, Woolfrey BF. Evaluation of mannitol salt agar with oxacillin as a screening medium for methicillinresistant Staphylococcus aureus. J Clin Microbiol 1985;22: Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing nineteenth informational supplement. CLSI document M100-S19. Wayne PA: Clinical and Laboratory Standards Institute; Schwartz DC, Cantor CR. Separation of yeast chromosomesized DNAs by pulsed field gradient gel electrophoresis. Cell 1984;37: Murchan S, Kaufmann ME, Deplano A, de Ryck R, Struelens M, Zinn CE, Fussing V, Salmenlinna S, Vuopio-Varkila J, El Solh N, Cuny C, Witte W, Tassios PT, Legakis N, van Leeuwen W, van Belkum A, Vindel A, Laconcha I, Garaizar J, Haeggman S, Olsson-Liljequist B, Ransjo U, Coombes G, Cookson B. Harmonization of pulsed-field gel electrophoresis protocols for epidemiological typing of strains of methicillin-resistant Staphylococcus aureus: a single approach developed by consensus in 10 European laboratories and its application for tracing the spread of related strains. J Clin Microbiol 2003;41: Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, Swaminathan B. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 1995;33: Cha HY, Moon DC, Choi CH, Oh JY, Jeong YS, Lee YC, Seol SY, Cho DT, Chang HH, Kim SW, Lee JC. Prevalence of the ST239
10 Infect Chemother 2011;43(5): clone of methicillin-resistant Staphylococcus aureus and differences in antimicrobial susceptibilities of ST239 and ST5 clones identified in a Korean hospital. J Clin Microbiol 2005; 43: Handley SA, Regnery RL. Differentiation of pathogenic Bartonella species by infrequent restriction-site PCR. J Clin Microbiol 2000;38: Dyer DW, Iandolo JJ. Rapid isolation of DNA from Staphylococcus aureus. Appl Environ Microbiol 1983;46: Riffard S, Lo Presti F, Vandenesch F, Forey F, Reyrolle M, Etienne J. Comparative analysis of infrequent-restriction-site PCR and pulsed-field gel electrophoresis for epidemiological typing of Legionella pneumophila serogroup 1 strains. J Clin Microbiol 1998;36: Kim SI, Yoo JH, Cho YK, Lee DG, Wie SH, Choi JH, Kim YR, Shin WS, Kang MW. Comparison of Pulsed-field Gel Electrophoresis, Amplified Fragment Length Polymorphism, and Infrequent Restriction Site-Polymerase Chain Reaction for Molecular Typing of Escherichia coli and Staphylococcus aureus Strains. Korean J Infect Dis 1999;31: Yoo JH, Choi JH, Shin WS, Huh DH, Cho YK, Kim KM, Kim MY, Kang MW. Application of infrequent-restriction-site PCR to clinical isolates of Acinetobacter baumannii and Serratia marcescens. J Clin Microbiol 1999;37: Peacock SJ, de Silva I, Lowy FD. What determines nasal carriage of Staphylococcus aureus? Trends Microbiol 2001;9: Fridkin SK, Hageman JC, Morrison M, Sanza LT, Como-Sabetti K, Jernigan JA, Harriman K, Harrison LH, Lynfield R, Farley MM; Active Bacterial Core Surveillance Program of the Emerging Infections Program Network. Methicillin-resistant Staphylococcus aureus disease in three communities. N Engl J Med 2005;352: Hisata K, Kuwahara-Arai K, Yamanoto M, Ito T, Nakatomi Y, Cui L, Baba T, Terasawa M, Sotozono C, Kinoshita S, Yamashiro Y, Hiramatsu K. Dissemination of methicillin-resistant staphylococci among healthy Japanese children. J Clin Microbiol 2005;43: Garner JS, Jarvis WR, Emori TG, Horan TC, Hughes JM. CDC definitions for nosocomial infections, Am J Infect Control 1988;16: Lee WG. Resistance mechanism and epidermiology of vancomycin resistant enterococci. Korean J Clin Microbiol 2008; 11:71-7.
6 JH Byun, et al. IRS-PCR on E. coli 성을나타낸다. CTX-M ESBL 유전자는 mobile genetic element 와연관되어지역사회에서 ESBL 이쉽게전파할수있다 [5, 6]. 병원균의역학적분석을하기위
Original Article http://dx.doi.org/10.3947/ic.2012.44.1.5 Infect Chemother 2012;44(1):5-10 pissn 2093-2340 eissn 2092-6448 Infection & Chemotherapy Infrequent-Restriction-Site 중합효소연쇄반응 (ISR-PCR) 을사용한지역사회발생
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information°ø±â¾Ð±â±â
20, 30, 40 20, 30, 40 1 2 3 4 5 6 7 8 9 10 3.1 6.3 9.4 12.6 15.7 18.8 22.0 25.1 28.3 31.4 2.4 4.7 7.1 9.4 11.8 14.1 16.5 18.8 21.2 23.6 7.1 14.1 21.2 28.3 35.3 42.4 49.5 56.5 63.6 70.7 5.9 11.9 17.8 23.7
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr
Original Article pissn 1738-2637 J Korean Soc Radiol 2012;67(2):129-134 The Survey of Magnetic Resonance Imaging Quality according to in Korea 1 자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 1 Hyun-Hae
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More informationTechnical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Len
Technical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Length Sequencing (Primer walking) 길이가긴 insert 를포함한 plasmid
More informationuntitled
대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran
More informationECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of
More information±èÇ¥³â
533 Fig. 1. Dead zone. Nine echoes are positioned 2-10 mm below the scan surface with 1 mm distance. All nine echoes are clearly visualized. 534 Fig. 2. Vertical and horizontal measurement. 10 cm distance
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More informationA C O N T E N T S A-132
C O N T E N T S -2 SC2 Series -3 SC2 Series -4 SC2 Series SC2 B 40 B 100 S I SC2 B 40 B 100 RO R S I SC2-2 B 40 B 100 HOY R S I -5 SC2 R0 40 SW R0 SC2 R 40 SC2 Series SW RB SW R SC2-2 H0 40 SW H0 SC2-2
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More information1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26
2015 한국전지학회 춘계학술대회 2일차 한국전지학회 춘계 학술대회(신소재 및 시장동향 관련 주제 발표) 시간 제목 비고 세션 1 차세대 이차전지용 in-situ 분석기술 좌장 : 윤성훈 09:00~09:30 Real-time & Quantitative Analysis of Li-air Battery Materials by In-situ DEMS 김동욱(한국화학연구원)
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More informationK O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis
More information16(1)-3(국문)(p.40-45).fm
w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More information3 x =2y x =-16y 1 4 {0 ;4!;} y=-;4!; y x =y 1 5 5'2 2 (0 0) 4 (3-2) 3 3 x=0 y=0 x=2 y=1 :: 1 4 O x 1 1 -:: y=-:: 4 4 {0 -;2!;} y=;2!; l A y 1
= =-6 {0;!;}=-;!; = 5 5' (00) (-) =0=0 == :: -:: =-:: {0-;!;}=;!; 0 l :: -:: =:: F 5 0cm =- = =- (0)=- =6 =0 =- (0)=- - =- {-;#;0}=;#; =- - =- (0)=- = =8 -:: :: =:: - =- 98 R l Q P B S r rb l Q P B lb
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More informationƯÇãû
'' - 1 - - 2 - - 3 - - 4 - - 5 - ' - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - Super-Bio Co., Ltd. KWON, Suk-Tae Thermostable DNA Polymerase-encoding Gene from Thermus sp. X-1 an d Amino Acid Sequence
More informationAnalysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
More informationAbstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More informationDV690-N_KOR_110216.indd
P/NO : MFL63266772 3 1 4 1 5 7 1 2 3 4 5 6 7 6 1 7 7 r t y u i - - - -, 7 1, 8 1 1 3 6 8 10 11 13? 12 14 15 16 17 18 a 1 b B c d e f c/v g C/V h M i Z j z k l 2 4 5 7 9 m w/s/a/d n b o p x q [ ] } r?
More information..........5-45..
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals
More information433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
More informationca_02.hwp
SPSPSPSP SPSPSPS SPSPSP SPSPS SPSP SPS 공기청정기 항균필터 SPS - KACA009-139 한국공기청정협회 2002년 12월 31일 제정 2016년 -월 -일 개정예정 http://www.kaca.or.kr 1.1 적용범위 이 표준은 에어필터로 공기중의 입자제거 및 미생물 제균 성능을 지닌 필터에 대하여
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More information<B8F1C2F72E687770>
제1장 제17장 성홍열 및 사슬알균 감염증 사슬알균 (Streptococci)은 증식 중의 특징적으로 쌍 또는 사슬모양의 그람양성 알균 으로 catalase 음성, 통성혐기성균이며, 보통 한천배지에서는 발육이 어렵고 혈액이나 혈청 등을 첨가한 배지에서 잘 발육한다. 포도당이나 다른 탄수화물을 분해하나 포도당 을 분해하여 가스를 생성하지 않는다. 이들은 최소
More information1
- MEDIC (MEDical Intelligent wheelchair ) MedicalIntelligent, Wheelchair MEDIC. MEDIC LG Global Challenger 2003 - 1. 3 2. 4 2.1 4 (1) 4 (2) 5 2.2 6 (1) 6 (2) 6 (3) 7 3. 8 3.1 8 3.2 10 3.3 11 4. 12 4.1
More information<30352DB1E2C8B9C6AFC1FD2028C8ABB1E2C7F6292036302D36362E687770>
3D 나노-마이크로 프린팅 기술의 현황 홍 기 현 한국기계연구원 부설 재료연구소 표면기술 연구본부 3D Nano-micro Printing Technology Kihyon Hong Korea Institute of Materials Science, Gyeongnam 642-831, Korea Abstract: 최근 3D 프린팅 기술을 이용하여 마이크로, 나노
More informationCONTENTS 표지 설명 자기만의 독특한 남성적 카리스 마를 내면화시킨 배우 최민수. 그가 SBS 주말극장 태양의 남 쪽 을 통해 2년여 만에 브라운 관에 복귀했다. 선 굵은 서사의 중심 인물이 되어 돌아온 그가 벌써부터 화제의 중심인물로 떠 올랐다. 사진 서창식 H
2003 September 09 주말극장 태양의 남쪽 아침연속극 이브의 화원 커버스토리 태양의 남쪽 의 최민수 SBS TV 추석특집 프로그램 프로그램 탐험 해결! 돈이 보인다 CONTENTS 표지 설명 자기만의 독특한 남성적 카리스 마를 내면화시킨 배우 최민수. 그가 SBS 주말극장 태양의 남 쪽 을 통해 2년여 만에 브라운 관에 복귀했다. 선 굵은 서사의
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More information( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
More information05052유식안101.hwp
제 출 문 식품의약품안전청장 귀 하 이 보고서를 유전자재조합식품 모니터링(부산광역시보건환경연구원/정구영) 과제의 연구 결과보고서로 제출합니다. 2005. 11. 30 주관연구기관명 : 부산광역시보건환경연구원 주관연구책임자 : 정구영 목 차 Ⅰ. 연구개발결과 요약문----------------------------------- 1 (한글)------------------------------------------
More informationuntitled
연구보고서 2005-06 정품 DC 현황 조사방법론 정립에 관한 연구 A Study on the Methodology for DC Piracy Rate Survey Computer program Deliberation & Mediation Committee 정품 DC 현황 조사방법론 정립에 관한 연구 A Study on the Methodology for DC
More information27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
More informationh ttp :/ / lo c a lh o s t:8 0 8 0 / js p b o o k h ttp :/ / lo c a lh o s t:8 0 8 0 / m y a p p h ttp :/ / w w w.th in k o n w e b.c o m / js p b o o k re q u e s t.g e tc o n te x tp a th () a p p lic
More information10-2 삼각형의닮음조건 p270 AD BE C ABC DE ABC 중 2 비상 10, 11 단원도형의닮음 (& 활용 ) - 2 -
10 단원 : 도형의닮음 10-1 닮음도형 p265 ABC DEF ABC DEF EF B ABCD EFGH ABCD EFGH EF A AB GH ADFC CF KL 중 2 비상 10, 11 단원도형의닮음 (& 활용 ) - 1 - 10-2 삼각형의닮음조건 p270 AD BE C ABC DE ABC 중 2 비상 10, 11 단원도형의닮음 (& 활용 ) - 2 -
More informationDBPIA-NURIMEDIA
27(2), 2007, 96-121 S ij k i POP j a i SEXR j i AGER j i BEDDAT j ij i j S ij S ij POP j SEXR j AGER j BEDDAT j k i a i i i L ij = S ij - S ij ---------- S ij S ij = k i POP j a i SEXR j i AGER j i BEDDAT
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More informationPJTROHMPCJPS.hwp
제 출 문 농림수산식품부장관 귀하 본 보고서를 트위스트 휠 방식 폐비닐 수거기 개발 과제의 최종보고서로 제출 합니다. 2008년 4월 24일 주관연구기관명: 경 북 대 학 교 총괄연구책임자: 김 태 욱 연 구 원: 조 창 래 연 구 원: 배 석 경 연 구 원: 김 승 현 연 구 원: 신 동 호 연 구 원: 유 기 형 위탁연구기관명: 삼 생 공 업 위탁연구책임자:
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More informationuntitled
대한마취과학회지 2008; 55: 190~6 Korean J Anesthesiol Vol. 55, No. 2, August, 2008 임상연구 대한민국의 마취통증의학 임상실습 현황 연세대학교 의과대학 마취통증의학교실 및 마취통증의학연구소 장동진ㆍ안소운ㆍ안지원ㆍ김종훈 The current status of anesthesiology clerkship in Korea
More information°Ç°�°úÁúº´5-44È£ÃÖÁ¾
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis
More information44-4대지.07이영희532~
A Spatial Location Analysis of the First Shops of Foodservice Franchise in Seoul Metropolitan City Younghee Lee* 1 1 (R) 0 16 1 15 64 1 Abstract The foodservice franchise is preferred by the founders who
More information<3239353720C6EDC1FDBABB2E687770>
목 차 자치법규 [훈 령] 제960호 서울특별시 교대근무자 초과근무수당 지급에 관한 규정 4 [입법예고] 제2010-178호 서울특별시 건축기본조례(안) 입법예고 5 고 시 제2010-19호 은평 재정비촉진계획변경 결정 및 지형도면 작성고시 7 제2010-20호 서울특별시립 청소년수련시설 2010년도 예산 및 사용료 고시 42 제2010-21호 도시관리계획(용도지구:개발진흥지구)
More information<31382D322D3420BDC5B1D4C8AF5FB3EDB9AE28C3D6C1BEBABB292E687770>
醫 史 學 제18권 제2호(통권 제35호) 2009년 12월 Korean J Med Hist 18ː57 72 18ː173-188 Dec. Dec. 2009 2009 C 大 韓 醫 史 學 會 ISSN ISSN 1225 505X 1225-505X 지방병 연구와 식민지배 : 1927년 영흥 및 해남지역 에메틴 중독사건을 중심으로 신 규 환* 1. 머리말 2. 일제의
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More information<31335FB1C7B0E6C7CABFDC2E687770>
에너지기후변화교육 4(2):203~211(2014) 203 초등학교 교과서 에너지 단원의 탐구활동과 시각자료 기능 분석 사례 연구 신명경 권경필 * 경인교육대학교 Abstract : This study aimed to analyze energy related inquiry activity and visual materials in elementary textbook.
More information<494352503131335FC1F8B9E6B1B3C0B02E687770>
ICRP 간행물 113 진단 및 중재 절차를 위한 방사선방호 교육훈련 Education and Training in Radiological Protection for Diagnostic and Interventional Procedures 대한방사선방어학회 이 번역본 발간은 2011년도 원자력안전위원회 방사선안전기술 개 발사업 과제 지원(한국동위원소협회로 부터
More information4.ƯÁýb61èÈñÁøÇ62~772Çà°£
J KMA Special Issue Current Situation of Tuberculosis and Its Control in Korea Hee Jin Kim, MD Department of Technical Cooperation, Korean Institute of Tuberculosis, Korean National Tuberculosis Assciation
More informationA 001~A 036
4 3 2 0 8 91 0 1 2 3 4 5 6 08 09 00 01 02 03 04 18 19 10 29 20 22 23 39 30 31 32 33 48 49 40 41 59 50 69 1 2 3 4 1 2 3 4 1 4 7 10 13 1 2 3 4 5 6 rev. C C r C a f h f h L h h nrpm f h f n L C 3 P L
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More information10(3)-12.fm
w y wz 10«3y 273~280 (2010.12.) Journal of Korean Society of Urban Environment p yá xá½k w y œw (2010 9 15, 2010 12 2 k) Analysis of Characteristics of Delivered Nonpoint Source Pollution at Forested Watershed
More informationCloning
Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군
More information<31325FB1E8B0E6BCBA2E687770>
88 / 한국전산유체공학회지 제15권, 제1호, pp.88-94, 2010. 3 관내 유동 해석을 위한 웹기반 자바 프로그램 개발 김 경 성, 1 박 종 천 *2 DEVELOPMENT OF WEB-BASED JAVA PROGRAM FOR NUMERICAL ANALYSIS OF PIPE FLOW K.S. Kim 1 and J.C. Park *2 In general,
More information1) 음운 체계상의 특징 음운이란 언어를 구조적으로 분석할 때, 가장 작은 언어 단위이다. 즉 의미분화 를 가져오는 최소의 단위인데, 일반적으로 자음, 모음, 반모음 등의 분절음과 음장 (소리의 길이), 성조(소리의 높낮이) 등의 비분절음들이 있다. 금산방언에서는 중앙
금산 은 상위의 중부방언에 속한다. 충청남도의 핵방언권 중 (A)지역, 즉 충청 남도의 남부이며 전라북도와 주로 접경을 이루는 방언권이다. 그중 충청남도의 최 남단에서 전라북도와 경계를 이루고 있는 지역이 금산 이라는 점은 주목할 만하 다. 금산 지역이 전라북도와 지리적으로 인접해 있어 문화 등 제반 교류의 가능성 을 엿볼 수 있고, 이는 곧 금산과 전북방언과의
More informationYI Ggodme : The Lives and Diseases of Females during the Latter Half of the Joseon Dynasty as Reconstructed with Cases in Yeoksi Manpil (Stray Notes w
497 의사학 제24권 제2호(통권 제50호) 2015년 8월 Korean J Med Hist 24 ː497-532 Aug 2015 c대한의사학회 http://dx.doi.org/10.13081/kjmh.2015.24.497 pissn 1225-505X, eissn 2093-5609 역시만필( 歷 試 漫 筆 ) 의 사례로 재구성한 조선후기 여성의 삶과 질병
More information<B9E9B3E2C5CDBFEFB4F5B5EBBEEE20B0A1C1A4B8AE20B1E6C0BB20B0C8B4C2B4D92E687770>
2011 어르신 생활문화전승프로그램 柯 亭 里 義 兵 마을 백년터울 더듬어 가정리 길을 걷는다 주관 춘천문화원 후원 한국문화원 연합회 문화체육관광부 -차 례- 제1장 구술 자료의 가치 1. 역사적 측면 2. 문화적 측면 3. 미래 삶의 터전 제2장 지명으로 전하는 생활문화전승 제3장 구술로 전하는 생활문화전승 1. 의암제를 준비하는 사람 류연창 2. 고흥 류
More information10(3)-10.fm
w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction
More information<30382EC0C7C7D0B0ADC1C22E687770>
대한내과학회지: 제 76 권 제 2 호 2009 의학강좌-개원의를 위한 모범처방(Current Clinical Practice) 간기능검사의 이해와 적용 인제대학교 의과대학 일산백병원 내과학교실 김 경 아 Understanding and application of liver function tests Kyung-Ah Kim, M.D. Department of
More informationY 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More information황지웅
Comparison of Laparoscopy and Exploration in the Distal Pancreatectomy BACKGROUND: To determine the benefits of laparoscopic surgery compared with exploration, the clinical outcomes of open and laparoscopic
More information석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
More information82-01.fm
w y wz 8«( 2y) 57~61, 2005 J. of the Korean Society for Environmental Analysis p w w Á Á w w» y l Analysis of Influence Factors and Corrosion Characteristics of Water-pipe in Potable Water System Jae Seong
More information대한한의학원전학회지26권4호-교정본(1125).hwp
http://www.wonjeon.org http://dx.doi.org/10.14369/skmc.2013.26.4.267 熱入血室證에 대한 小考 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 韓醫學古典硏究所 白裕相1, 2 *117) A Study on the Pattern of 'Heat Entering The Blood Chamber' 1, Baik 1
More information<35BFCFBCBA2E687770>
주요개념 : 컴퓨터음란물 접촉자, 성지식, 성태도 남자중학생의 컴퓨터음란물 접촉자와 비접촉자간의 성지식과 태도의 차이 김 영 혜* 이 화 자** 정 향 미*** 1. 연구의 필요성 한국은 I. 서 론 1960 년대 이후부터 시작된 돌진적 산업화 ( 한 상진, 1996) 로 인하여 경제적 부흥을 이루어 집집마다 TV 수상기를 가질 수 있게 되었고 최근에는 PC보급율
More information1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
More information16(2)-7(p ).fm
w wz 16«2y Kor. J. Clin. Pharm., Vol. 16, No. 2. 2006 ü t xy y w tœ ½ BÁ x BC B y w w w C y w w w Current Status and Expectations of Orphan Drugs in Korea -In point of supplying medicines for the rare
More information45-51 ¹Ú¼ø¸¸
A Study on the Automation of Classification of Volume Reconstruction for CT Images S.M. Park 1, I.S. Hong 2, D.S. Kim 1, D.Y. Kim 1 1 Dept. of Biomedical Engineering, Yonsei University, 2 Dept. of Radiology,
More informationTable 1. Allelic profiles of 194 C. jejuni analyzed in this study Gene locus Fragment length (bp) No. of alleles No. of polymorphic sites (%) Ave. p d
연구논문, Research article 국내설사환자분리캄필로박터제주니의유전형분석 질병관리본부감염병분석센터세균분석과정수미, 강병학, 홍사현, 김재옥 * * 교신저자 : kimjo70@korea.kr, 043-719-8110 Genetic analysis of Campylobacter jejuni isolates from diarrheal patients in
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More information12이문규
Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental
More information304.fm
Journal of the Korean Housing Association Vol. 20, No. 3, 2009 yw s w - û - A Study on the Planning of Improved-Hanok - Focused on Jeon-Nam Province - y* ** z*** **** Kang, Man-Ho Lee, Woo-Won Jeong, Hun
More information9(3)-4(p ).fm
w wz J. Kor. Soc. Cloth. Ind. 9«3y, 2007 Vol. 9, No. 3, pp.319-326(2007) w xk x p w q w Analysis of Foot Characteristics According to the Classification of Foot Types of Junior High School Girls Ji-Young
More information03-2ƯÁý -14š
Management on hazardous chemicals for production of safe produce Namjun Cho, Sumyeong Hong, Wonil Kim, Byungjun Park Chemical Safety Division, National Academy of Agricultural Science, RDA * Correspondence
More information<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
More information005송영일
Received : 2015. 12. 09 Reviewed : 2015. 12. 16 Accepted : 2015. 12. 16 Sternal Fracture occurred after Thai Massage : A Case Report Young-Il Song, K.M.D. 1, Dong-Eun Kim, K.M.D. 1 1 Department of Rehabilitation
More information(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re
EMF Health Effect 2003 10 20 21-29 2-10 - - ( ) area spot measurement - - 1 (Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern
More information01-왕순주-완.PDF
: 7 1 2003 Introduction of Geriatric Emergency Medicine Soon- Joo Wang, M.D. Departm ent of Em ergency Medicine, Hallym University Sacred Heart Hospital,.,.,, 13.1% 65, 2030. 20% 1).,,. 35% 65 2).. 65
More information