한수지 49(2), 176-183, 2016 Original Article Korean J Fish Aquat Sci 49(2),176-183,2016 2015 년제주도양식넙치 (Paralichthys olivaceus) 를대상으로한 VHS 및 RSIVD 모니터링 박현경 전려진 1 김승민 박명애 2 조미영 2 황성돈 2 박신후 2 정현도 3 정준범 * 제주대학교해양의생명과학부, 1 제주대학교수산백신연구센터, 2 국립수산과학원수산생물방역과, 3 부경대학교수산생명의학과 Monitoring of VHS and RSIVD in Cultured Paralichthys olivaceus of Jeju in 2015 Hyun Kyung Park, Lyu Jin Jun 1, Seung Min Kim, Myoung Ae Park 2, Mi Young Cho 2, Seong Don Hwang 2, Shin Hoo Park 2, Hyun Do Jeong 3 and Joon Bum Jeong* Faculty of Marine Biomedical Science, Jeju National University, Jeju 63243, Korea 1 Fish Vaccine Resarch Center, Jeju National University, Jeju 63333, Korea 2 Aquatic Life Disease Control Division, National Fisheries Research & Development Institute, Busan 46083, Korea 3 Department of Aquatic Life Medicine, Pukyong National University, Busan 48513, Korea In this study, disease surveillance was performed to monitor the prevalence of viral haemorrhagic septicaemia virus (VHSV) and red seabream iridovirus (RSIV) in olive flounder, Paralichthys olivaceus in 2015. The fish samples were collected in March (60 farms), May (55 farms) and July (52 farms) from different farms in Jeju. Reverse transcription polymerase chain reaction (RT-PCR) (VHSV) or PCR (RSIV) results showed that VHSV detected in 2 farms, but RSIV has not been detected in any farms. The sequences of the nucleocapsid protein (N) and glycoprotein (G) gene of the 2 VHSV isolates were successfully sequenced. Phylogenetic analysis was included VHSV isolates reported here together with a representative VHSV isolates available in GenBank. Phylogenetic analysis indicated that most of Korea VHSV isolates were closely related to the Japan and China genotype Ⅳa which is clearly distinct from the North American genotype Ⅳb. Key words: Paralichthys olivaceus, VHSV, RSIV, Nucleocapsid protein, Glycoprotein 서론 (Paralichthys olivaceus) 50%,. red seabream iridovirus (RSIV), lymphocystis disease virus (LCDV) DNA viral haemorrhagic septicaemia virus (VHSV), viral nervous necrosis virus (VNNV), hirame rhabdovirus (HRV), marine birnavirus (MABV) RNA, VHSV RSIV (Cho et al., 2010). VHSV (Oncorhynchus mykiss), (Mortensen et al., 1999). 2000 (Takano et al., 2000; Isshiki et http://dx.doi.org/10.5657/kfas.2016.0176 Korean J Fish Aquat Sci 49(2) 176-183, April 2016 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial Licens (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Received 4 October 2015; Revised 27 January 2016; Accepted 19 March 2016 *Corresponding author: Tel: +82. 64. 754. 3426 Fax: +82. 64. 756. 3493 E-mail address: jeongjb@jejunu.ac.kr Copyright 2016 The Korean Society of Fisheries and Aquatic Science 176 pissn:0374-8111, eissn:2287-8815
VHS 및 RSIVD 모니터링 177 al., 2001) (World Organization for Animal Health, OIE). VHSV Rhabdoviridae Novirhabdovirus RNA 6 gene nucleocapsid protein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), non-structural protein (NV) RNA polymerase (L) (Schutze et al., 1999). Snow et al. (1999) Lumsden et al. (2007) VHSV N G 4 genotype, Genogroup (European freshwater and sea fish), Genogroup (British Isles), Genogroup (North Atalantic and North America), Genogroup (Pacific coast, Atlantic, Great Lakes, Japan and Korea) 4 (Einer- Jensen et al., 2004; Dale et al., 2009; Kim et al., 2011). RSIV 1990 (Pagrus major),,, (Inouye et al., 1992; Matsuoka et al., 1996). RSIV 1990 (Oplegnathus fasciatus), (Do et al., 2005). RSIV Megalocytivirus, 4 subgroups, subgroup RSIV, subgroup RBIV, subgroup (Siniperca scherzeri) ISKNV, subgroup (P. olivaceus) turbot(scophthalmus maximus) TRBIV (He et al., 2001; Do et al., 2004; Shi et al., 2004). VHS RSIVD. 실험어 재료및방법 ( / ) 2015 3 (60 ), 5 (55 ), 7 (52 ) (Paralichthys olivaceus), VHSV RSIV. Primer RSIV ( 84 ) RSIVD primer set PCR (Table 1). VHSV Primers N-gene 444 bp forward primer (5 -GAGAGA- ACTGGCCCTGACTG-3 ) reverse primer (5 -ATGATCC- GTCTGGCTGACTC-3 ) Cho et al. (2007), G-gene 1,340 bp forward primer (5 -ACAGAT- CACTCAACGACCTC-3 ) reverse primer (5 -ATAGTGA CGGCCAAAGA CTC-3 ) full length open reading frames (ORFs) PCR (Table 1). DNA 추출 RSIV, DNeasy Blood & Tissue Kit (Qiagen Hilden, Germany) total DNA. 10 mg ATL buffer 180 L proteinase K 20 L 56., AL buffer 200 L ethanol 200 L spin column 6,000 g 1. Column tube AW1 buffer 500 L AW2 buffer 500 L, AE buffer 50 L DNA. DNA -20. Table 1. PCR conditions and primer sequences for the detection of virus from the olive flounder Paralichthys olivaceus of Korea Target¹ Oligonucleotide sequence (5'-3') PCR condition Product size (bp) F GAGAGAACTGGCCCTGACTG N gene VHSV-N 94 (30")-55 (45")-72 (45") 444 R ATGATCCGTCTGGCTGACTC F ACAGATCACTCAACGACCTC G gene VHSV-G 94 (30")-52 (30")-72 (1') 1,340 R ATAGTGACGGCCAAAGACTC F CTCAAACACTCTGGCTCATC RSIV 94 (30")-58 (60")-72 (60") 570 R GCACCAACACATCTCCTATC ¹VHSV, viral haemorrhagic septicaemia virus; RSIV, red seabream iridovirus.
178 박현경ㆍ전려진ㆍ김승민ㆍ박명애ㆍ조미영ㆍ황성돈ㆍ박신후ㆍ정현도ㆍ정준범 RNA 추출및 cdna 합성 VHS, Viral RNA Mini kit (Qiagen Hilden, Germany) RNA. 10 mg nuclease freewater 140 L homogenizer. AVL buffer 560 L 15 10, ethanol 560 L spin column 6,000 g 1. Column tube AW1 buffer 500 L AW2 buffer 500 L, AE buffer 30 L Table 2. VHSV isolates used in this study for comparison of N gene Virus isolate Year Origin Host fish Genotype GenBank accession No. 15-E03(SW) 2015 Korea Olive flounder Ⅳa unpublished 15-E03(SD) 2015 Korea Olive flounder Ⅳa unpublished US-mak-wa88 1988 USA Coho salmon Ⅳa X59241 JF00Ehil-JPN 2000 Japan Olive flounder Ⅳa AB490792 KRRV9822-JPN 1998 Japan Olive flounder Ⅳa AB179621 CA-NS04-01 2007 Canada Brown trout Ⅳb HQ168409 CA-NB04-01b 2007 Canada Brown trout Ⅳb HQ168408 MI03GL 2006 USA Muskellunge Ⅳb DQ427105 15-JUL-2009 2009 USA Muskellunge Ⅳb GQ385941 CA-NB00-01 2007 Canada Brown trout Ⅳb EF079895 ON41 2011 USA Diporeia spp. Ⅳb HQ415762 SE-SVA-14 2009 Sweden Rainbow trout Ⅰb GQ325428 SE-SVA-1033 2009 Sweden Rainbow trout Ⅰb FJ460591 UKMLA98/6HE1 2009 Britain Rainbow trout Ⅰb GQ325431 DK-1p8 2009 Denmark Rainbow trout Ⅰb GQ325430 DK-5e59 2009 Denmark Rainbow trout Ⅰb GQ325429 96-43 2000 Britain Atlantic herring Ⅰb AF143862 Cod-Ulcus 1979 Denmark Atlantic cod Ⅰb Z93414 DK-4p37 1997 North sea Rainbow trout Ⅰb FJ460590 FR-07-71 1990 France Rainbow trout Ⅰa D00687 07-71 1997 France Rainbow trout Ⅰa AJ233396 Fil3 1983 Germany Rainbow trout Ⅰa Y18263 DE-Fil3-wt 1983 Germany Rainbow trout Ⅰa X73873 DK-3592B 1997 Denmark Rainbow trout Ⅰa AF012093 KV010308-4 2010 Norway Rainbow trout Ⅲ FJ362514 BV060408-52 2010 Norway Rainbow trout Ⅲ FJ362510 FA281107 2010 Norway Rainbow trout Ⅲ EU481506 FS280208-V 2010 Norway Rainbow trout Ⅲ GU121102 FS280208-S 2010 Norway Rainbow trout Ⅲ GU121100 V230308-5 2010 Norway Rainbow trout Ⅲ FJ362515 860/94 1994 Scotland Turbot Ⅱ AJ130915 F13.02.97 1997 Ireland Turbot Ⅱ AJ130916 4p101 1997 Skagerrak Whiting Ⅱ AJ130918 H17/2/95 1995 North sea Haddock Ⅱ AJ130924 H16/7/95 1995 North sea Cod Ⅱ AJ130923 2p51 1996 Skagerrak Norway pout Ⅱ AJ130917
VHS 및 RSIVD 모니터링 179 RNA. RNA -20. RT-PCR 3 L viral RNA, 4 L 5 reaction buffer, 1 L reverse transcriptase, 1 L dntp, 1 L oligo (dt) primer 2.4 L MgCl 2 volume 20 L nuclease freewater, 25 5, 42 1, 70 15. PCR 및 sequencing PCR microtube 1 M primer, 2.5 mm dntp, 10 G-Taq Buffer, 2.5 U G-Taq DNA polymerase (Gene Pro Themal Cycler Cosmo, Korea) template DNA distilled water PCR volume 20 L, PCR Table 1. PCR 1 TAE buffer (40 Mm Tris-acetate, 1 mm EDTA), 0.5 g/ L ethidium bromide 1% agarose gel, UV. PCR Gel purification kit (Bioneer, Korea), ToPo TA cloning kit (Invitrogen, USA) cloning, (Solgent, Korea). 계통학적분석 BioEdit program Clustal W (Thompson et al., 1994) GenBank N gene 34 (Table 2) G gene 19 (Table 3) alignment. Alignment MEGA program version 4.0 (Tamura et al., 2007) neighbor joining criteria. 결과및고찰 1980,,. VHS Table 3. VHSV isolates used in this study for comparison of G gene Virus isolate Year Origin Host fish Genotype GenBank accession No. 15-E03(SW) 2015 Korea Olive flounder Ⅳa unpublished 15-E03(SD) 2015 Korea Olive flounder Ⅳa unpublished CHN-PORV 2005 China Olive flounder Ⅳa KC685626 JF00Ehil-JPN 2000 Japan Olive flounder Ⅳa AB490792 JP990Obama25 1999 Japan Olive flounder Ⅳa DQ401191 Makah 1988 USA Coho salmon Ⅳa U28747 U13653 2005 Canada Drum Ⅳb HQ453209 CA-NB00-01 2000 Canada Mummichog Ⅳb EF079896 CA-NS04-01 2004 Canada Brown trout Ⅳb EF079899 DK-200070-4 2000 Denmark Rainbow trout Ⅰa AY546612 DK-204022 2004 Denmark Rainbow trout Ⅰa JF681347 DK-204038 2004 Denmark Rainbow trout Ⅰa JF681342 DK-204062 2004 Denmark Rainbow trout Ⅰa JF681314 JP96KRRV9601 1996 Japan Rainbow trout Ⅰb DQ401190 DK-6p403 1999 Denmark Herring Ⅰb AY546584 DK-1p52 1996 Baltic sea Sprat Ⅱ AY546576 DK-1p53 1996 Baltic sea Herring Ⅱ AY546577 DK-1p55 1996 Baltic sea Sprat Ⅱ AY546578 DK-4p168 1997 Skagerrak Herring Ⅲ AY546582 IR-F13.02.97 1997 Ireland Turbot Ⅲ AY546620 FR-L59X 1987 France Eel Ⅲ AY546618
180 박현경ㆍ전려진ㆍ김승민ㆍ박명애ㆍ조미영ㆍ황성돈ㆍ박신후ㆍ정현도ㆍ정준범 RSIVD,. 2 2, 3.3%., VHSV 3 2 (3.3%) (Fig. 1, Table 4), 30 6.7%. 15 cm, VHSV Kim et al. (2009). VHSV 3 15, 10-15 (Kim et al., 2003). Fig. 1. Detection of the VHSV gene by RT-PCR using the N (lane 1-5) or G (lane 6-10) primer set. Lane 1 and 6, 15-E03(SW); Lane 2 and 7, 15-E03(SD); Lane 3 and 8, farm 1; Lane 4 and 9, farm 2; Lane 5 and 10, farm 3; M, 1 kb DNA ladder. Fig. 2. Phylogenetic tree showing the genetic relationships among 36 VHSVs based on the nucleotide sequences of the N gene. Phylogenetic analysis indicated that most of Korea VHSVs belong to the genotype Ⅳa. Bootstrap values were transferred to the original maximum likelihood tree derived from the actual data. The scale bar indicates the number of substitutions per nucleotide site. *indicates VHSV isolates in this study.
VHS 및 RSIVD 모니터링 181. RSIV (Cho et al., 2009), RSIV. RSIV, RSIV (Table 4), RSIV,, (data not shown). Park et al. (2015) Table 4. Distribution of virus infection in cultured olive flounder Paralichthys olivaceus in 2015 Virus Detection rate (%) (No. of positive / No. of farms) March May July VHSV 3.3(2/60) 0(0/55) 0(0/52) RSIV 0(0/60) 0(0/55) 0(0/52), RSIV 3,. Kim (2015) two-step RT-PCR VHSV a, VHSV N gene (444 bp) G gene (1,340 bp) primer set RT-PCR. 2 15-E03 (SW) 15-E03 (SD), N gene G gene N gene G gene primer set (Fig. 1). 2 VHSV GenBank 34 N gene 19 G gene. N gene, 2 Fig. 3. Phylogenetic tree showing the genetic relationships among 21 VHSVs based on the nucleotide sequences of the G gene. Phylogenetic analysis indicated that most of Korea VHSVs belong to the genotype Ⅳa. Bootstrap values were transferred to the original maximum likelihood tree derived from the actual data. The scale bar indicates the number of substitutions per nucleotide site. *indicates VHSV isolates in this study.
182 박현경ㆍ전려진ㆍ김승민ㆍ박명애ㆍ조미영ㆍ황성돈ㆍ박신후ㆍ정현도ㆍ정준범 genotype (Fig. 2). VHSV genotype a b subgroups, 2 VHSV genotype a (Snow et al., 1999; Einer-Jensen et al., 2004; Lumsden et al., 2007)., 2 (accession number: AB179621, AB490792) (Nishizawa et al., 2002), 2 98.9-99% (data not shown), genotype b (Fig. 2). G gene, 2 N gene (Fig. 3)., (accession number: KC685626) (accession number: AB490792, DQ401191) (Fig. 3),, 99.4-99.6% 99.5-99.6% (data not shown). VHS RSIVD, VHS.. 사사 2015 (R2015071),. References Cho MY, Kim MS, Kwon MG, Jee BY, Choi HS, Choi DL, Park GH, Lee CH, Kim JD, Lee JS, Oh YK, Lee DC, Park SH and Park MA. 2007. Epidemiological study of bacterial diseases of cultured olive flounder, Paralichthys olivaceus from 2005 to 2006 in Korea. J Fish Pathol 20, 61-70. Cho MY, Jee BY, Park GH, Lee CH, Lee DC, Kim JW, Park MS and Park MA. 2009. Monitoring of fish pathogens in wild marine fish of Korean coastal offshore water in 2008. J Fish Pathol 22, 75-83. Cho MY, Park GH, Jee BY and Kim JW. 2010. Statistical data on fish virus of cultured olive flounder, Paralichthys olivaceus from 2005 to 2007. J Fish Pathol 23, 155-162. Dale OB, Ørpetveit I, Lyngstad TM, Kahns S, Skall HF, Olesen NJ and Dannevig BH. 2009. Outbreak of viral haemorrhagic septicaemia (VHSV) in seawater-farmed rainbow trout in Norway caused by VHS virus Genotype III. Dis Aquat Org 85, 93-103. http://dx.doi.org/10.3354/dao02065. Do JW, Moon CH, Kim HJ, Ko MS, Kim SB, Son JH, Kim JS, An EJ, Kim MK, Lee SK, Han MS, Cha SJ, Park MS, Park MA, Kim YC, Kim JW and Park JW. 2004. Complete genomic DNA sequence of rock bream iridovirus. Virol 325, 351-363. http://dx.doi.org./10.1016/ j.virol. 2004. 05.008. Do JW, Cha SJ, Kim JS, An EJ, Lee NS, Choi JH, Lee CH, Park MS, Kim JW, Kim YC and Park JW. 2005. Phylogenetic analysis of the major capsid protein gene of iridovirus isolates from cultured flounders Paralichthys olivaceus in Korea. Dis Aquat Org 64, 193-200. Einer-Jensen K, Ahrens P, Forsberg R and Lorenzen N. 2004. Evolution of the fish rhabdovirus viral haemorrhagic septicaemia virus. J Gen Virol 85, 1167-1179. http;//dx.doi. org/10.1099/vir.0.798200. He JG, Deng M, Weng SP, Li Z, Zhou SY, Long QX, Wang XZ and Chan SM. 2001. Complete genome analysis of the mandarin fish infectious spleen and kidney necrosis iridovirus. Virology 291, 126-139. http://dx.doi.org/10.1006/ viro.2001.1208. Inouye K, Yamano K, Maeno Y, Nakajima K, Matsuoka M, Wada Y and Sorimachi M. 1992. Inidovirus infection of cultured red seabream, Pagrus major. Fish Pathol 27, 19-27. Isshiki T, Nishizawa T, Kobayashi T, Nagano T and Miyazaki T. 2001. An outbreak VHSV (viral haemorrhagic septicaemia virus) infection in farmed Japanese flounder Paralichthys olivaceus in Japan. Dis Aquat Org 47, 87-99. Kim HJ. 2015. Validation of the sensitivities of one-step and two-step reverse-transcription PCR methods for detection of viral haemorrhagic cepticaemia virus (VHSV) Ⅳa isolates from cultured olive flounder in Korea. Aquaculture 448, 359-364. http://dx.doi.org/10.1016 /j.aquaculture.2015.06.034. Kim SM, Lee JI, Hong MJ, Park HS and Park SI. 2003. Genetic relationship of the VHSV (viral haemorrhagic septicemia virus) isolated from cultured olive flounder, Paralichthys olivaceus in Korea. J Fish Pathol 16, 1-12. Kim WS, Kim SR, Kim DW, Kim JO, Park MA, Kitamura SI, Kim HY, Kim DH, Han HJ, Jung SJ and Oh MJ. 2009. An outbreak of VHSV (viral haemorrhagic septicaemia virus) infection in farmed olive flounder, Paralichthys olivaceus in Korea. Aquaculture 296, 165-168. http://dx.doi. org/10.1016 /j.aquaculture.2009.07.019. Kim WS, Jung SJ, Kim JO, Kim DW, Kim JH and Oh MJ. 2011. Genetic positioning of Korean viral haemorrhagic septicaemia virus (VHSV) from cultured and wild marine fishes. J Fish Pathol 24, 19. http://dx.doi.org/10.7847/ jfp.2011.24.1.001. Lumsden JS, Morrison B, Yason C, Russell S, Yong K, Yaz-
danpanah A, Huber P, Al-Hussinee L, Stone D and Way K. 2007. Mortality event in freshwater drum Aplodinotus grunniens from Lake Ontario, Canada, associated with viral haemorrhagic septicaemia virus, Type IV. Dis Aquat Org 76, 99-111. Matsukoa S, Inonye K and Nakjima K. 1996. Cultured fish species infected by red seabream iridoviral disease from 1991 to 1995. J Fish Pathol 31,233-234. Mortensen HF, Heuer OE, Lorenzen N, Otte L and Olesen NJ. 1999. Isolation of viral haemorrhagic septicaemia virus (VHSV) from wild marine fish species in the Baltic Sea, Kattegat, Skagerrak and the North Sea. Virus Res 63, 95-106. Nishizawa T, Iida H, Takano R, Isshiki T, Nakajima K and Muroga K. 2002. Genetic relatedness among Japanese, American and European isolates of viral haemorrhagic septicaemia virus (VHSV) based on partial G and P genes. Dis Aquat Org 48, 143-148. Park HK, Kim SM, Lee DW, Jun LJ and Jeong JB. 2015. Monitoring of VHS and RSIVD in cultured Paralichthys olivaceus of Jeju in 2014. JFMSE 27, 879-889. http://dx.doi. org/10.13000/jfmse.2015.27.3.879. Schutze H, Mundt E and Mettenleiter TC. Complete genomic sequence of viral haemorrhagic septicaemia virus, a fish rhabdovirus. Virus Genes 19, 59-65. Shi CY, Wang YG, Yang SL, Huang J and Wang QY. 2004. The first report of an iridovirus-like agent infection in farmed turbot Scophthalmus maximus in China. Aquaculture 236, 11-25. http://dx.doi.org/10.1016/j.aquaculture.2003.11.004. Snow M, Cunningham CO, Melvin WT and Kurath G. 1999. Analysis of the nucleoprotein gene identifies distinct lineages of viral haemorrhagic septicaemia virus within the European marine environment. Virus Res 63, 35-44. Takano R, Nishizawa T, Arimoto M and Muroga K. 2007. Isolation of viral haemorragic septicaemia (VHSV) from wild Japanese flounder, Paralichthys olivaceus. Bull Eur Assoc Fish Pathol 20, 186-192. Tamura K, Dudley J, Nei M and Kumar S. 2007. Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24, 1596-1599. Thompson JD, Higgins DG and Gibson TJ. 1994. Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22, 4673-4680. VHS 및 RSIVD 모니터링 183