The Korean Journal of Microbiology, Vol. 42, No. 3, September 2006, p. 199-204 Copyright 2006, The Microbiological Society of Korea e ³ w ³ w Á Á½ Áx Á 1 Á 2, * w w w w w w e ³ ³ w p w. e ³ w ù š» 30 cm. 2003 6 l 2005 5 ³ ³ multiplex PCR assay» w w Streptococcus iniae S. parauberis ƒƒ 46% 54%. S. iniae 9 10 ùkü ù S. parauberis 3 4 ùkû. S. iniae S. parauberis w w ù S. iniae q, k,, S. parauberis y, d. ampicillin amoxicillin, S. iniae ³ S. parauberis ³ doxycycline, erythromycin, oxytetracycline. Key words ý olive flounder, Streptococcosis, S. iniae, S. parauberis, multiplex PCR assay ³ ³ vw³ ƒ j, wš ƒ»z ùkü ƒ w ù p w ƒ w Streptococcus iniae, S. parauberis, S. difficilis, S. shiloi, Lactococcus garvieae, L. piscicum, Vagococcus salmoninarum š š (4, 5, 6, 7, 8, 9, 15). w ³ w» w, t ³ S. iniae L. garvieae w p e (LD 50 ) š (10). e(paralichthys olivaceus) ³ w š Nakatsugawa(16) w e ³ ³ S. iniae šw, ü š Lee (12) w yw 16S rrna gene p w L. garvieaeƒ e ³ š. w Jung (11) w yw 16S-23S ISR (Intergenic Spacer Region) w S. iniae w š. w w» w, x x,,, w ƒ. ù wš w w w. *To whom correspondence should be addressed. Tel: 064-780-6090, Fax: 064-710-4155 E-mail: kbc1922@jeju.go.kr wr, w w ü ù št t w ƒ ú ƒ š ƒ, ey v ƒwš. ù w» ü e»k ³ w s, x x w, p w», kw» w. w ƒ w w p w» s w š, w»» û p ƒ š (13, 18, 19). v z w kw» ƒ v w. ù t e(p. olivaceus) šƒ š, w ù w e ³ kw ww» wš w w. ³ ³ w w 2003 6 l 2004 5 ü t e(p. olivaceus), û, e ƒƒ 1,365,, 199
200 Yong-Uk Jeong et al. Kor. J. Microbiol ³ w w, w. ³ w» w 1.5% NaCl-BHIA (Brain Heart Infusion Agar, Difco, USA) x w» w x w (Komed, Korea) w z 30±0.5 C o 24-48 w. ³ Thoesen (20) Vibrio spp., Edwardsiella spp., Streptococcus spp. w, Streptococcus spp. x w ³ w z 1.5% NaCl-BHIB (Brain Heart Infusion Broth, Difco, USA) z ³ glycerol ƒw -80 C z o w. Multiplex PCR assay mw Streptococcus spp. 2003 6 l 2005 5 ³ ùkü 573 140 w š, Streptococcus spp. 198 ³ w w. ƒ ³ 1.5% NaCl-BHIA w š, 2-3 colony 5% Chelex (BioRad, USA) 100 µl ³ ywš 95 C 10 boilingw o genomic DNA w. Mata (14) w S. parauberis, S. iniae, L. garveiae ƒ 3 w ƒ w 3 primer set (Spa-2152, Spa-2870, LOX-1, LOX- 2, plg-1, plg-2) w multiplex PCR assay w š, 1.2% agarose gel s» w ƒƒ w. w KCTC (Korean collection for type cultures) l Streptococcus iniae KCTC 3657, Streptococcus parauberis KCTC 3651, Lactococcus garveiae KCTC 3772 w. Primer sequence w s j» Table 1 ùkü. S. iniae S. parauberis w w p 140 ³ w w p w. w y, q, k,, x, x, ƒ x, d w. x 198 ³ w x Muller Hinton agar w Ampicillin 8 w w disk y w w. x w w ampicillin, amoxicillin, ciprofloxacin, doxycycline, erythro-mycin, nalidic acid, oxolinic acid, oxytetracycline BBL t w. S. iniae S. parauberis w» w ³ ƒ w w ƒ w ùkü š, ³ ³ p w. š ³ w ³ w q w» w 2003 6 l 2004 5 ¾ ü e ³» q w 1,365 301 w ³ ³ w 22.1%. e j» ³ w ƒƒ 10 cm e 2 w š 10 cm 20 cm 12, 20 cm 30 cm 65, 30 cm 40 cm 137, 40 cm 85, e e l» ¾ ³ wš ù 30 cm w ùkü. w e» š ù» ùkü q (Table 2). w w 8, 9, 10 ùkû, û 1 2 q ƒƒ 5.0% 6.3 % Streptococcus spp.ƒ ƒ ù w p ùkü. w» w ƒ 5 o C z¾ w w ww w w 13 o C (1) (Table 2). wš, v w w w. ù 30 cm ùkü. w p p Table 1. Primer sequences used for species specific PCR detection assay and the expected amplicon sizes Primer Sequences (5' to 3') Target gene PCR amplicon size (bp) Pathogen Spa 2152 Spa 2870 LOX-1 LOX-2 plg-1 plg-2 TTTCGTCTGAGGCAATGTTG GCTTCATATATCGCTATACT AAGGGGAAATCGCAAGTGCC ATATCTGATTGGGCCGTCTAA CATAACAATGAGAATCGC GCACCCTCGCGGGTTG 23S rrna 718 S. parauberis Lactate oxidase (lcto) 870 S. iniae 16S rrna 1,100 L. garvieae
Vol. 42, No. 3 e ³ w 201 Table 2. Occurrence of streptococcosis related to the size and month of cultured flounder in Jeju island from 2003 to 2004 Month No. of samples for infected with streptococci <10 10 < 20 20 < 30 30 < 40 40 Sum & ratio (%) a No. of total diseased samples Jan. 9 6 15 (5.0) 75 Feb. 2 6 6 5 19 (6.3) 78 Mar. 1 10 12 23 (7.6) 92 Apr. 1 4 12 14 31 (10.2) 86 May 1 1 1 9 11 23 (7.6) 122 Jun. 1 6 5 9 21 (7.0) 182 Jul. 1 11 4 9 25 (8.3) 165 Aug. 10 16 5 31 (10.2) 117 Sep. 1 13 22 3 39 (13.0) 100 Oct. 1 9 16 3 29 (9.6) 140 Nov. 3 3 15 3 24 (8.0) 111 Dec. 2 1 13 5 21 (7.0) 97 Sum & ratio (%) b 2 (0.7) 12 (4.0) 65 (22.0) 137 (46.0) 85 (28.0) 301 No. of total samples 163 434 371 264 133 1,365 ratio(%) a, b Streptococcosis detection ratio by monthly(%) a and fish size(%) b.» q, e 2 3 wš 1 w e»» š y p š š, e» œ w t œ ƒ ù,» ƒ š ƒ œ w w ƒ š.,» w ³ w ù ú p w e»» q. e ³ kw p 2003 6 l 2005 5 ³ ùkü 573 140 w š, Streptococcus spp. 198 ³ w. ³ Gram ³, Catalase, Cytochrome oxidase. w,, l ³ ( ). ³ w w» ü w ³ ³ S. iniae (KCTC 3657), S. parauberis (KCTC 3651), L. garvieae (KCTC 3772) ü t ³ w w w.» ƒƒ ³ p primer w ƒƒ ƒ w multiplex PCR assay(14) w. t ³ w multiplex PCR» ww p, S. iniae (KCTC 3657), S. parauberis (KCTC 3651), L. garviae (KCTC 3772) ƒƒ s, 870 bp, 718 bp, 1,100 bp s y w (Fig. 1). ƒƒ t ³ w multiplex PCR» ww Table 1 ùkü s j» ew S. iniae, S. parauberis, L. garvieae 3 ³ w ƒ w y w.» x w multiplex PCR assay w w ³ 198 ³ S. iniaeƒ 91 ³ 46% š, S. parauberisƒ 107 ³ 54%. ù Lee (12) š e(p. olivaceus) ³ L. garvieae (Table 3). w multiplex PCR assay mw x x w S. iniae β x š S. Fig. 1. Multiplex PCR assay for detection of S. parauberis (718 bp), S. iniae (870 bp) and L. garvieae (1,100 bp). 198 isolated strains of streptococci identified to S. parauberis and S. iniae species in Jeju island flounder farms from 2003 to 2005. M, 100 bp DNA ladder (invitrogen, USA); lane 1-12, isolated strains; lane 13, S. parauberis (KCTC 3651); lane 14, S. iniae (KCTC 3657); lane 15, L. garvieae (KCTC 3772).
202 Yong-Uk Jeong et al. Kor. J. Microbiol Table 3. Monthly isolation rate of S. iniae, S. parauberis and L. garvieae associated of streptococcosis flounders related in Jeju Island from June 2003 to May 2005 No. of isolated streptococcosis causative pathogens No. of Month S. paruberis S. iniae L. garvieae tested strains Jan. 2 3-5 Feb. 5 5-10 Mar. 15 5-20 Apr. 19 5-24 May 13 7-20 Jun. 6 3-9 Jul. 7 9-16 Aug. 8 11-19 Sep. 4 15-19 Oct. 11 15-26 Nov. 8 9-17 Dec. 9 4-13 Sum 107 91-198 Isolate rate(%) 54 46 0 paraubris α γ x. S. iniae, S. parauberis w ³ w x w ù ³ ³ š Streptococcus spp.ƒ œm, w l ³ ( ) e ³ S. iniae S. parauberis w. ü w ³ ³ w S. iniae w ƒ, ü x ³ (18). wr, l (Scophthalmus maximus) ³ š α x S. parauberis x w, x, x w š š(6), 3 10 4 cells/fish 50% s w š (5). ü e š Baeck (3) ³ e S. parauberis w šw ƒ š, S. parauberis w s ü» w š S. iniae w šw ƒ (2). ƒ w wš 2» w» ƒ v wš, w e(p. olivaceus) ³ L. garvieae w w w ƒ w. S. iniae S. parauberis xy S. iniae š»» 9 10 ùkþ, S. parauberis 14 C o 17 C o 3 l 5 (Table 3). Nguyen (17) w S. iniae š» šw š, 9 10 ¾ šw ü ew p. wr S. parauberis w ³ w š ù, r l (S. maximus) ³ wš (6). S. parauberisƒ š»» š, ƒ ³ ³ w». S. iniae S. parauberis w e w p S. iniae, S. difficile w,, qx w š š š L. garvieae qx w y ƒ w p. w e ƒƒ š (7, 9, 10). e ƒ w w p ƒ w w v w š. ƒƒ S. iniae S. parauberis q e w y, q, k,, üd x, x, ƒ x, d(non-ocular side). S. iniae q, k, ƒ š S. parauberis y d (Table 4). w w ƒ ù, x S. parauberis w p z ù w p sƒw w» y». S. parauberis S. iniae ³ w Table 4. Comparison of external symptoms of olive flounder infected by S. parauberis and S. iniae in Jeju aqua culture area Symptoms Incidence of symptoms (%) S. parauberis S. iniae Darkened surface 26.2 10.7 Distended abdomen 3.9 17.9 Protruded anus 1.0 22.6 Ascitic fluid in the peritoneal cavity 9.7 29.8 Haemorrhaging in the inner surface of abdomen 24.3 22.6 Exophthalmia 18.4 23.8 Haemorrhaging in the eye 17.5 14.3 Haemorrhaging in the opercular region 14.6 10.7 Haemorrhaging in the non-ocular side 20.4 4.8
Vol. 42, No. 3 e ³ w 203 Table 5. Comparison of antibiotics susceptibility ratio between S. parauberis and S. iniae Antibiotics Rate of antibiotics susceptibility (%) S. parauberis S. iniae Ampicillin 96.1 95.1 Amoxicillin 99.0 97.6 Ciprofloxacin 74.5 67.5 Doxycycline 47.1 85.5 Erythromycin 47.1 91.6 Nalidixic acid 1.0 0 Oxolinic acid 14.7 2.4 Oxytetracycline 18.6 57.8 w S. parauberis S. iniae ³ œm w ampicillin amoxicillin r w 95%, S. parauberis S. iniae doxycycline, erythromycin, oxytetracycline w û (Table 5). x œm w y yw ùkü» e y».» ww e(p. olivaceus) ³ s ù wš, 30 cm š š, ³ S. iniae S. parauberis q, š» S. iniae w»» 14 o C 17 C w o S. parauberis w p ùküš. e ³ y w ³ w» w w, w e ³ w v x S. iniae S. parauberis w w p. w ey w v p w. š x 1.. 2003. e(paralichthys olivaceus) l ³ p w. w w. p.10-20 2.,,,,, ½. e, Paralichthys olivaceus w Streptococcus parauberis. 2006 wz œ w z t. p. 516-517 3. Baeck, G.W., J.H. Kim, D.K. Gomez and S.C. Park. 2006. Isolation and chracterization of Streptococcus sp. from diseased flounder (Paralichthys olivaceus) in Jeju Island. J. Vet. Sci. 7, 53-58. 4. Berovier, H., C. Ghittino, and A. Eldar. 1997. Immunization with bacterial antigens: infections wih streptococci and related organism. Dev. Biol. Stand. 90, 153-160. 5. Curras, M., B. Magarinos, A.E. Toranzo, J.L. Romalde. 2002. Dormancy as a survival strategy of the fish pathogen Streptococcus parauberis in the marine enviroment. Dis. Aquat. Org. 52, 129-136. 6. Domenech, A., J.F. Fernandez-Garayzabal, C. Pascual, J.A. Garcia, M.T. Cutuli, M.A. Moreno, M.A. Moreno, M.D. Collins, and L. Dominguez. 1996. Streptococcosis in cultured turbot, Scophthalmus maximus (L.), associated with Streptococcus parauberis. J. Fish Dis. 19, 33-38. 7. Eldar, A., Y. Bejerano, and H. Bercovier. 1994. Streptococcus shiloi and streptococcus difficile: two new streptococcal species causing a meningoencephalitis in fish. Curr. Microbiol. 28, 139-143. 8. Eldar, A., A. Horovitcz, and H. Bercovier. 1997. Development and efficacy of a vaccine against Streptococcus iniae infection in farmed rainbow trout. Vet. Immunol. Immunopathol. 56, 175-183. 9. Eldar, A., M. Goria, C. ghittino, A. Zlotkin, and H. Bercovier. 1999. Biodiversity of Lactococcus garvieae strains isolated from fish in Europe, Asia, and Australia. Appl. Environ. Microbiol. 65, 1005-1008. 10. Eldar, A. and C. Ghittino. 1999. Lactococcus garvieae and Streptococcus iniae infections in rainbow trout, Oncorhynchus mykiss: similar but different diseases. Dis. Aquat. Org. 36, 227-231. 11. Jung, Y.U., B.J. Kang, G.T. Park, and M.S. Heo. 2004. Use of 16S- 23S rrna intergenic spacer region for identification in the fish pathogenic Streptococcus iniae. J. Fish Pathol. 17, 91-98. 12. Lee, D.C., J.I. Lee, C.I. Park, and S.I. Park. 2001. The study on the casual agent of streptococcosis(lactococcus garvieae), isolated from cultured marine fishes. J. Fish Pathol. 14, 71-80. 13. Leong, J.C., E. Anderson, L.M. Bootland, P.W. Chiou, M. Johnson, C. Kim, D. Mourich, G. Trobridge. 1997. Fish vaccine antigens produced or delivered by recombinant DNA technologies. Dev. Biol. Stand. 90, 267-77. Review. 14. Mata, A. I., A. Gibello, A. Casamayor, M. M. Blanco, L. Dominguez, and J. F. Fernandez-Garayzabal. 2004. Multiplex PCR Assay for Detection of Bacterial Pathogens Associated with Warm-Water Streptococcosis in fish. Appl. Environ. Microbiol. 70, 3183-3187. 15. Muzquiz, J. L., F. M. Royo, C. Ortega, I. D. Blas, I. Ruiz, and J. L. Alonso. 1999. Pathogenicity of streptococcosis in rainbow trout (Oncorhynchus mykiss): dependence on age of diseased fish. Bull. Eur. Assoc. Fish Parthol. 19, 114-119. 16. Nakatsugawa, T. 1983. A streptococcal disease of cultured flounder. Fish Pathology 17, 281-285. 17. Nguyen, H.T., K. Kanai, and K. Yoshikoshi. 2002. Ecological investigation of Streptococcus iniae in cultured Japanese flounder (Paralichthys olivaceus) using selective isolation procedures. Aquaculture. 205, 7-17. 18. Tatner, M. 1986. The ontogeny of humoral immunity in the rainbow trout, Salmo gairdneri. Vet. Immunol. Immunopathol. 12, 93-105. 19. Tatner, M.F. and M.J. Manning. 1983. The ontogeny of the cellular immunity in the rainbow trout, Salmo gairdneri Richardson, in relation to the stage of development of the lymphoid organs. Dev. Comp. Immunol. 7, 69-75. 20. Thoesen, J. C. 1994. Bluebook, suggested procedure for the detec-
204 Yong-Uk Jeong et al. Kor. J. Microbiol tion and identification of certain finfish and shellfish pathogens. American fisheries society. (Received June 20, 2006/Accepted September 24, 2006) ABSTRACT : Characterization of Streptococcosis Occurrence and Molecular Identification of the Pathogens of Cultured Flounder in Jeju Island Yong-Uk Jeong, Chul-Young Kang, Min-Ju Kim, Moon-Soo Heo, Duck-Chul Oh 1, Bong- Jo Kang 2, * (Faculty of Applied Marine Science, Cheju National University, Jeju 690-756, Korea, 1 Department of Life Science, College of Natural Sciences, Cheju National University, Jeju 690-756, Korea, 2 Jeju Province Fisheries Resources Research Institute, Jeju 699-810, Korea) Streptococcosis of olive flounder (Paralichthys olivaceus) is an important bacterial disease in Jeju island. In this study, we investigated monthly infection pattern of this disease in different size of the flounder fish. Even though the disease occurred throughout the year, the infection ratio was relatively higher in the months with warm water season. The infection was more prevalent in adult flounder over 30 cm total length compare to these of small size fish. Two infectious species of streptococcosis pathogens were detected by multiplex PCR assay. Detection ratios of Streptococcus iniae and S. parauberis reached up to 46% and 54%, respectively, from June 2003 to May 2005 in Jeju island. S. iniae occurred intensively from September to October, whereas S. parauberis reported from March to May. S. iniae and S. parauberis infections of cultured flounder share some common features, but clinical findings showed considerable differences between two diseases. Distended abdomen, protruded anus and ascitic fluid in the peritoneal cavity are evident lesions detected in S. iniae infection, whereas, flounders infected by S. parauberis showed prominent lesions such as darkened surface and haemorrhaging in the non-ocular side. Both streptococcosis pathogens were sensitive to antibiotics, such as ampicillin and amoxicillin. However, S. iniae strains were more sensitive to doxycycline, erythromycin and oxytetracycline than S. parauberis strains.