<C3D6C1BEBAB8B0EDBCAD E616C292E687770>

Transcription

1

2 : : : : : : : :

3 Ⅰ. Ⅱ.,.,, 6,,.,.,,,. Ⅲ. 1.

4 1) peptide,. (epitope), AntheProt SciProtein antigenic index, surface probability, hydrophilicity, flexible region. 2) peptide, Protein A Protein B sequence peptide., peptide T-cell immune response L-form peptide D-form. peptide carrier protein, peptide KLH (Keyhole Limpet Hemacyanin), ELISA test Western immunoblotting peptide ovalbumin carrier protein. 3) peptide peptide. peptide forward nucleotide reverse nucleotide pet15b vector annealing cdna ligation. Ligation vector DH5α (competent cell) heat shock transformation, LB Ampicillin agarose plate colony LB liquid culture, large scale plasmid preparation DNA extraction. 2. 1) (Sprague-Dawley rat)

5 . Sprague-Dawley APM (Adipocyte Plasma Membrane) BSA (Bovine Serum Albumin)., 8,. saline Stomacher. ELISA, APM BSA Western immunoblotting -. 2). Corriedale, biopsy, saline homogenize, deep freezer., homogenize centrifuge. Primary antibody,, Secondary antibody, coating., - Western immunoblotting. 3)

6 . 1, 4 sampling., ELISA., rapid kit Dot blot. 3. rapid kit 1). (Protein B synthetic peptide), One-shot Boosting. Boosting 2,. 2) ELISA Dot blot ELISA., Nitrocellulose membrane Protein B synthetic peptide blot BSA blocking. 1, Anti-cow IgG/HRP 2., 4-chloro-1-naphthol. 3) Gold conjugate Colloidal Gold free Protein B synthetic peptide, KLH - Protein B synthetic peptide conjugate, OVA - Protein B synthetic peptide conjugate., colloidal gold conjugate

7 .,., BSA. 4) Immunostrip Adhesive card nitrocellulose membrane, absorbent pad (free Protein B synthetic peptide, KLH Protein B synthetic peptide conjugate, OVA Protein B synthetic peptide conjugate) capture buffer, 25 % Humidity. goat anti-mouse IgG. 5) Strip test Strip half test. 96 well plate well loading buffer free Protein B synthetic peptide, KLH - Protein B synthetic peptide conjugate, OVA - Protein B synthetic peptide conjugate, Protein A-gold conjugate) + strip,. Ⅳ. 1. peptide, peptide proteosomal cleavage prediction, T-cell epitope prediction, homology homology Protein A (3mer) Protein B (12mer). peptide vector vector purification. Colony, peptide. 2.

8 1) APM (adipocyte plasma memberane) BSA (bovine serum albumin),., 81,000 -,. - Western immunoblotting. 2), peptide ( )., peptide. 2 ELISA test, well 1 2. coating ELISA test, coating 10 ng/ ml, 100 ng/ ml. Western immunoblotting, membrane membrane carrier protein., ovalbumin peptide. 3),,,..,

9 .,.. Boosting,. 3. rapid kit 1) 1, 1 ~ 3 mg,,. 2 Boosting Boosting. 3 Adjuvants Adjuvants alum FCA(Freund's complete adjuvant),, alum FCA. 4 Rapid kit strip Protein A gold particle conjugation - steric hindrance. Protein A. 5 Dot blot Nitrocellulose membrane peptide binding,

10 dot blot,. 6 strip sample pad case prototype rapid kit.,,. test,.,, rapid kit.,, sample,,.,., ( ),. kit,..

11 Ⅰ. Title of the project Development of rapid and accurate technologies to identify Hanwoo beef using specific proteins Ⅱ. Purposes and importance of study The current study was conducted to develope a technology to identify Hanwoo beef from imported beef. Ever since we opened beef market to foreign country, the biggest problems enfacing is that illegal marketing of cheap imported beef as a expensive Hanwoo beef. Furthermore, it is another threat to Hanwoo farmers that beef produced from imported live beef cattle could be labeled as a "domestic beef" if they were raised at least 6 months in Korea. All these situations brought rapid collapses of Hanwoo industry in Korea recently. Thus, it is very urgent and critical to develop technologies to identify Hanwoo beef from imported beef and/or from beef of imported live beef cattle. Final goal of the current study was to develope and commercialize the developed technologies to identify beef from specific farms and areas and thus, to regain consummer's evaluations about Hanwoo beef which was disregarded because of cheap and false marketing of imported beef. The current study will eventually improve international competitiveness of Hanwoo beef against imported beef.

12 Ⅲ. Contents and scopes of the study 1. Screening and synthesis of antigens to produce specific antibodies 1) Screening of antigens Candidate antigens reported to produce antibodies in various journals were screened based on "species involution tree" which may not have relationship with bovine genetically. Epitopic sites were checked based on the amino acid sequences of selected proteins, and then analysed for antigenic index, surface probability, hydrophilicity, and flexible region using AntheProt and SciProein software. 2) Synthesis of antigenic peptides The selected peptides, protein A and protein B, were synthesized in commercial company. All peptides synthesized in the current study was a D-form because D-form was reported to have higher T-cell immune response than natural L-form. Carrier proteins were conjugated to small peptides to stimulate immune responses. KLH (Keyhole Limpet Hemacyanin) was used for immunization and ovalbumin was used for ELISA test and immunoblotting to detect antibodies. 3) Production of the antigens using recombinant DNA technology The possibilities to produce antigens using recombinant DNA technology was examined in consideration of producing antigens in cheap price. Forward and reverse nucleotides for the selected peptides were annealed into plasmid vector, pet 15b, and ligated. Ligated vectors were transformed in to DH5 competent cells by heat shock, and the colonies on ampicillin agarose plates were selected and cultured in LB liquid media for large scale plasmid preparation. 2. Antibody production and detection

13 1) Preliminary study using Sprague-Dawley rats The essential part of the current study was to determine the possibilities of detection of any antibodies remaining in the muscle tissue of immunized animals and this was tested by preliminary study using Sprague-Dawley rats. Sprague-Dawley rats were immunized with APM (adipocyte plasma membrane) and BSA (bovine serum albumin). Blood was taken from animals before and after immunization to test immune responses. And muscle tissue was collected from immunized animals after 8 weeks of immunization. ELISA test and Western immunoblotting were performed to test antibody in both serum and muscle tissue. 2) Development of specific antibodies in sheep Once again prior to immunization of Hanwoo, further preliminary study was done using sheep since it is ruminant too. Male Corriedale sheep was immunized to produce antibody. About 20 g of M. biceps femoris was isolated by biopsy after immunization. Half of the muscle sample was homogenized with PBS and the supernatant was collected after centrifugation to use as a meat juice. The other half of the biopsied muscle was frozen in deep freezer and meat juice by thawing the muscle was collected and used. Studies to detect antibodies in meat juices according to dilution factor of primary antibody, preparation method of meat juices, dilution factors for secondary antibody, and optimum concentrations of antigens for coating were performed as a preliminary studies. Western immunoblotting was performed too. 3) Immunization of Hanwoo to identify branded Hanwoo beef Based on the results of optimum antibody production conditions obtained through preliminary studies, immunization of Hanwoo was performed. Finishing Hanwoo was immunized one month before marketing and muscle was sampled when the animals were slaughtered. Meat juices were used for ELISA to test the

14 level of antibody reactions, storage times, and how to keep the meat. And dot blotting was performed as preliminary study to develope rapid kit for the identification of branded Hanwoo beef rapidly and accurately. 3. Development of rapid kit to identify Hanwoo beef 1) Screening of various conditions to develope antibody On the basis of the results obtained from previous experiments, the optimum conditions for immunization of Hanwoo (Korean Cattle) was established. Hanwoo were randomly allotted in equal numbers into two treatment groups according to the amounts of antigens. Each group was subdivided into booster injection and one-time injection group. Two weeks after boosting injection, all animals were slaughtered and meat juices from muscle were prepared and tested for antibody production. 2) ELISA and dot blot analysis Antibody titers to the peptides used for immunization were determined using an ELISA. For dot blot analysis, nitrocellulose membrane was blotted with Protein B synthetic peptide, dried at room temperature, and blocked with BSA solution. The membrane was incubated with meat juice or antiserum, and rabbit anti-cow immunoglobulin conjugated to horseradish peroxidase were used as secondary antibodies. Following the addition of substrate, 4-chloro-1-naphthol, the membrane was incubated until color was developed. 3) Preparation of gold conjugates A range of concentrations of colloidal gold was added into solutions dissolving free Protein B synthetic peptide, KLH-Protein B synthetic peptide conjugate, and OVA-Protein B synthetic peptide conjugate, respectively. The optimal concentration at which there was no change in color of solution was determined. Ten percent BSA solution was added and stirred. After centrifugation, the supernatant was discarded and the pellet was resuspended in conjugate buffer at the concentration yielding a response.

15 4) Preparation of the immunostrip Protein B synthetic peptide-ova conjugate and goat anti-mouse IgG were applied to the test and control line, respectively, on the nitrocellulose membrane using Matrix 1600 reagent dispenser and dried overnight at 25% humidity. The nitrocellulose membrane and absorbent pad were assembled and attached to a adhesive card. 5) Strip test The meat juice obtained form immunized Hanwoo was applied to the strip prepared as described. The premixed sample with loading buffer and Protein A-gold conjugate were applied to the strips to evaluate the results. Ⅳ. Results and suggestions for the application of the study Results of the study 1. Screening and synthesis of antigens to produce specific antibodies Peptide candidates to be used as antigens were selected from data analysis of computer programs, and proteosomal cleavage prediction and T-cell epitope prediction were analyzed based on web-site supported softwares. Protein A (3 mer) and Protein B (12 mer) which have no homology with any other proteins in bovine species were finally selected as antigens. Mass growth of E. coli carrying vector with inserts for the selected peptides and vector purification were performed and the possibilities of mass production of antigens with cheap price were tested. 2. Development and detection of specific antibody 1) Preliminary study using Sprague-Dawley rats Both APM (adipocyte plasma membrane) and BSA (bovine serum albumin) produced

16 high titers of antiserum. And titers in meat juices were relatively lower than those in antiserum, but were high enough to identify those from non-immunized antiserum. These results were confirmed by Western immunoblotting too. 2) Development of antibody in meat juice of sheep High antibody titers were confirmed in both antiserum and meat juices of immunized sheep comparing to non-immunized serum. Titers in meat juices were higher than those in non-immunized serum while they were lower than those in antiserum. The concentrations of secondary antibody were critical to determine titers by ELISA showing that various dilutions of secondary antibody had concentration dependent antigen-antibody reactions. Antigen-antibody reaction could be detected from 10 ng/ ml of antigen coated on the well for ELISA test, and consistent ELISA results could be obtained when more than 100 ng/ ml of antigens were coated on the wall. In Western immunoblotting, antiserum expressed strong reactions around carrier protein whereas non-immunized serum showed no reactions with those protein. These patterns of antigen-antibody reaction in antiserum in immunoblotting appeared same in meat juices showing strong reactions with peptide conjugated to ovalbumin. 3) Immunization of Hanwoo to identify branded beef High titers of antibody in muscles, fore shank, loin, and hind shank, of Hanwoo was detected by immunization of peptides subcutaneously. The titers were dependent on storage time and storage methods by showing the highest titers on the same of slaughtering. And the titers were gradually reduced as the storage times went on. Meat juice extracted from frozen muscle on slaughtering date showed lower titers than meat juice extracted from refrigerated muscle which means that refrigerated muscle is much more efficient to prepare meat juice than frozen muscle. Titers of antibody in meat juice from boosting injected Hanwoo expressed higher level comparing to non-immunized serum. 3. Development of rapid diagnostic kit to identify branded Hanwoo beef 1) Screening of optimum conditions to develope antibody

17 1 Effects of the amount of antigens There were not a significant differences among the amounts of antigens immunized in the development of antibodies. The sensitivity of individual would be much more important in antibody development than the amount of antigens. 2 Effects of boosting injection There were not a remarkable differences between one-shot immunized animals and boosting immunized animals. 3 Effect of adjuvants By using alum and FCA (Freund's complete adjuvant) as adjuvants, FCA showed higher titers than alum overall. 4 Screening of conditions to make strip for rapid kit By conjugation with gold particle to Protein A, antigen-antibody reaction was enhanced without steric hindrance. Furthermore, the use of Protein A had amplifying effects to detect very small amounts of antibody in meat juice effectively. 5 Screening of conditions using dot blot After dot blotting by binding antigenic peptides onto nitrocellulose membrane, it was confirmed that detection of antibody in meat juice is possible as far as immune reaction has been occurred in Hanwoo body. 6 Changes in reaction in strip according to dilution factors of meat juice Rapid kit was invented based on above mentioned preliminary results. Clear development of control and reaction line could be confirmed in immunized serum whereas reaction line could not be detected in negative control group which had a clear control line. Meat juices from immunized animals also showed clear reaction bands same as antiserum. Overall, the current study confirmed the possibilities to identify specific branded beef rapidly and accurately using rapid kit when the animals are immunized with specific proteins. Further studies, however, such as to enhance the sensitivity of reaction bands, to obtain stable results in various conditions and environments, to solve problems of non-reactive individuals, and to handle these kits easily by consumer group, should be

18 followed to commercialize the current results. The current study would be much more beneficial for branded beef because those beef could be identified in the market quickly and easily with the rapid kit invented in this study. Suggestions for the application of the study Taken together, the current study confirmed that specific antibodies present in Hanwoo beef produced by immunization with specific proteins could be detected (patent pending), and developed test strip kit for easy field use. Further studies to minimize variations of diagnostic kits and to confirm the results in large scale of Hanwoo populations are needed to commercialize the current study. And governmental supports to the distribution of kits and to farmers are essential for the commercialization of the current study in the near future.

19 CONTENTS Chapter 1. Introduction 23 Chapter 2. The present status of domestic and foreign technology 25 Chapter 3. Contents and results of the study 27 Part. Contents of the study Screening and synthesis of antigens to produce specific antibodies 27 1) Screening of antigens 27 2) Synthesis of antigenic peptides 28 3) Production of the antigens using recombinant DNA technology 29 1 Cloning of genes responsible to specific proteins of Hanwoo 29 2 Establishment of conditions for vector expression 30 3 Production of specific proteins Antibody production and detection 35 1) Preliminary study using Sprague-Dawley rats 35 1 Experimental animals 35 2 Preparation of antigens and immunization 35 3 Production of antiserum and meat juices 36 2) Development of specific antibodies in sheep 38 1 Experimental animals and immunization 38 2 Production of antiserum and meat juices 39 3 Purification of antibodies using affinity column 41 4 Establishment of optimum conditions to detect antibodies 41

20 3) Immunization of Hanwoo to identify branded Hanwoo beef 42 1 One-shot treatment 42 2 Boosting treatment Development of rapid kit to identify Hanwoo beef 45 1) Screening of various conditions to develope antibody 45 2) ELISA and Dot blot analysis 45 3) Preparation of gold conjugate 47 4) Preparation of the immunostrip 47 5) Preparation of half test 47 6) Preparation of prototype kit 48 Part. Results of the study Screening and synthesis of antigens 49 1) Screening and synthesis of antigens using data base 49 2) Production of antigens using recombinant DNA technology Development and detection of specific antibody 52 1) Preliminary study using Sprague-Dawley rats 52 2) Development of antibody in meat juice of sheep 56 3) Immunization of Hanwoo to identify branded beef Development of rapid diagnostic kit to identify branded Hanwoo beef 72 1) Screening of optimum conditions to develope antibody 72 1 Effects of the amount of antigens 72 2 Effects of boosting injection 73 3 Effects of adjuvants 74 2) Development for rapid kit 75 1 Screening of conditions to make strip for rapid kit 75 2 Screening of conditions using dot blot 76 3 Changes in reaction in strip according to dilution factors of meat juice 76

21 Chapter 4. Degree of attainment and contribution to the related field 81 Chapter 5. Application plan of the results of this study 83 Chapter 6. Foreign technical information collected during this R&D 84 Chapter 7. Reference 85

22 ) 27 2) peptide 28 3) vector ) (Sprague-Dawley rat) ) Affinity column ) 42 One-shot 42 Boosting 44

23 3. rapid kit 45 1) 45 2) ELISA Dot-blot 45 3) Gold conjugate 47 4) Assay strip 47 5) Half test 47 6) Prototype kit ) 49 2) ) (Sprague-Dawley rat) 52 2) 56 3) rapid kit 72 1) Boosting 73 Alum FCA Adjuvant 74 2) Rapid kit 75 Rapid kit strip 75 Dot-blot 76 strip

24 제 1 장 연구개발과제의개요 1993 UR(Uruguay Round of Multinational Trade Negotiation),, , ,476, ( %, %, %), , (,,, ).,.., 6,.,,, ,,, 1 ( ),, ( : 2000, , 1, , 1,359 ).,,

25 .,,.,. ( Holstein ),,,., Hereford ( ).,..,,,,.

26 제 2 장 국내외기술개발현황 DNA. Wyman (1980) RFLP(Restriction Fragment Length Polymorphisms), DNA probe (Chikuni, 1990), RAPD(Random Amplified Polymorphic DNA), AFLP(Amplified Fragment Length Polymorphism), MS(Microsatellite), SSCP(Single Strand Conformation Polymorphism), DAF(DNA Amplification Fingerprinting) (Kirby, 1992). Jeffreys (1985) DNA fingerprinting, (, polymorphism) (Kuhnlein, 1989; Kikawa, 1995; Pitra, 1997), AFLP, DNA marker (Otsen, 1996)., RAPD (Holstein) (, 2001), microsatellite marker genetic marker (, 2001).,,., RIA(Radio immunoassay: ), RIA RIA,, ELISA, (Demeulemester, 1991; Hsieh, 1996; Janssen, 1987; Samarajeewa, 1991), kit, kit (Dong, 2003; Langedijk, 2001; Soutullo, 2001; Drew, 1999; Eisler, 1998; Cheng, 1996; Saravi, 1995).

27 ,., (identification) (traceability), Council Regulation(EC) No. 820/97. Council Regulation(EC) No. 820/97, (meat supply chain) (key) (identification number). (scanning) EDI( ),,,,.,,.

28 제 3 장 연구개발수행내용및결과 1. 1) peptide (Lee, 2002; Tamar, 2002; Tooyama, 2000; Kramer, 1998; Mohri, 1997; Briand, 1997; Benkirane, 1995),. (epitope), AntheProt SciProtein (Fig. 1), antigenic index, surface probability, hydrophilicity, flexible region. AntheProt SciProtein Fig. 1. Antigenic site analysis using programs, Antheprot and SciProtein.

29 peptide, peptide proteosomal cleavage prediction, T-cell epitope prediction (Table 1), homology homology Protein B (12mer) Tooyama (2000) Protein A(3mer). Protein A, Protein B Table 5. Table 1. Antigenic site analysis by web programs Program Brief Descriptions Download/www locations NetChop Proprac SYFPEITHI MAPPP PREDEP A neural network based proteosomal cleavage prediction. A neural network based proteosomal cleavage prediction. A www service for predicting MHC binding prptides for 24 class I and II alleles of human/mouse and rat. A complete www service with ORF and MHC binding prediction. It combines both SYFPEITHI and BIMAS A structure-based algorithm for prediction of MHC class-i epitopes. Available as www service for 13 alleles of different species. NetChop CServer.dll/EpPredict.htm /MAPPP/expertquery.html g/teppred/mhc-bind/ 2) peptide peptide(protein A Protein B) sequence peptide (( ),, ).,

30 peptide T-cell immune response L-form peptide (Van Regenmortel, 1998) D-form. L-form peptide D-form peptide (Fig. 2). Fig. 2. Mirror symmetry between L- and D-forms of peptides. peptide carrier protein, peptide KLH(Keyhole Limpet Hemacyanin), ELISA test Western immunoblotting peptide ovalbumin carrier protein. 3) 1

31 ,, homology peptide, peptide. ( peptide) Protein A Protein B, Protein A 3mer peptide cloning, Protein B (12mer)., 12mer peptide cloning peptide (22mer, Protein B), peptide cloning. peptide cdna ( ) ( DNA, ) forward nucleotide reverse nucleotide expression vector, design Fig. 3. Forward nucleotide 5 -TAGTGATGAAGATATGGAGATATCAGCT CTCTTTAGAGGTTCTCCCTTAAAAGTCAAAC GCTCAGACTAG-3 Reverse nucleotide 5 -GATCCTAGTCTGAGCGTTTGACTTTTAA GGGAGAACCTCTAAAGAGAGCTGATATCTC CATATCTTCATCAC-3 Fig. 3. Sequence of the synthetic cdna. 2 vector expression vector pet15b vector. pet15b vector nickel column vector,

32 N-terminal his-tag his-tag antigen. pet15b vector Fig. 4. Peptide cloning vector(pet15b) LB media(sodium Chloride 10 g, Tryptone yeast 5 g, Trypton pepton 10 g, ddh 2O 1 l) agar autoclave 1% ampicillin(100 mg / ml ) petridish LB ampicillin agar plate 4. pet15b vector LB ampicillin agarose plate streaking 37 incubator 14~ mltube LB media 10 ml ampicillin 10 μl colony loop shaking incubator 37, 220 rpm ml culture ml LB media ampicillin 2 l LB media 12 shaking incubator 37, 220 rpm 2 l liquid culture. 500 ml centrifuge ware centrifuge(2,500 g, 20 min) pellet, pellet centrifuge ware 4 overnight. Fig. 4. pet15b vector.

33 QIAGEN R Plasmid Maxi Kit pellet vector purification. Purification QIAGEN R Plasmid Maxi Kit QIAGEN R Plasmid Purification Handbook, purification vector agarose gel purification. -20 vector sample 4 mixture. Mixture vector sample 1 μl, ddh 2 O 12 μl, pet15b vector BamH I site BamH I restriction enzyme(mbi Fermentas, USA) 0.5 μl 10 BamH I Buffer(MBI Fermentas, USA) 1.5 μl 6 type I gel loading buffer 3 μl total volume 18 μl, 37 water bath incubation(overnight) restriction enzyme BamH I site. 0.8% agarose gel mixture(1 TAE buffer 80 ml, agarose 0.64 g) oven agarose, EtBr 5 μl agarose gel, pet15b vector size λ Hind III marker 37 water bath incubation mixture loading, 55 volts, 1 30 band UV trans-illuminator. purification vector Peptide cloning ( peptide) cdna pet15b vector insert site restriction enzyme. Fig. 4 pet15b vector Xho I(324) site BamH I(319) site Nde I(331) site, BamH I Nde I site restriction enzyme double digestion cdna ligation. Purification pet15b vector 100 μl BamH I Nde I restriction enzyme 8 μl, 2 Y + /Tango TM enzyme buffer 60 μl, ddh 2 O 124 μl total volume 300 μl mixture, mixture incubation double digestion. Double digestion, restriction enzyme vector 0.8% agarose gel.

34 Ligation vector, forward nucleotide reverse nucleotide(fig. 7) Hubank (1994) annealing. 1 EcoR I buffer 43.4 μl forward nucleotide reverse nucleotide 3.3μl PCR machine 95, 1 94, 1 93, 1 10, 1 end ligation synthetic cdna. cdna annealing 12% non-denaturating polyacrylamide gel(30% acrylamide/bis 2.66 ml, ddh 2 O 5.27 ml, 5 TBE 2 ml, 10% AMPS 70 μl, TEMED 3.5 μl ) forward nucleotide annealing products(cdna) loading (50 volts, 2 hrs) band pattern. Double digestion pet15b vector annealing cdna insert ligation. Ligation mixture T4 ligase 1 μl, ligase buffer 1 μl, cdna 0.4 μl, pet15b vectors 1 μl ddh 2 O 6.6 μl total volume 10 μl. mixture 16 16, incubation, transformation. Transformation competent cell DH5α(Introgen Therapeutics, INC., Texas, USA). Competent cell 30 μl incubation mixture sample 3 μl tapping, ice , ice 3 shock competent cell ligation sample., LB media 500 μl, shaking incubator 37, 220 rpm, 1 shaking. X-gal(5-Bromo-4-chloro-3-indolyl-β-D-galactopyranoside, MBI, USA) 20 μl IPTG (Isopropyl-β-D-Thi-ogalactopyronoside, dioxane free, MBI, USA) 50 μl mixture LB Ampicillin agarose plate, plate. Shaking product X-gal IPTG mixture LB Ampicillin agarose plate, incubator overnight. Overnight LB plate colony liquid culture media(lb media 5 ml + Ampicillin 5 μl ) loop, 5 ml liquid culture(37, 240 rpm, 9 hrs). Liquid culture competent cell 5 ml 2 ml centrifuge(12,000 rpm, 4, 1 min), pellet

35 glycerol stock solution(lb media 75 ml, glycerol 25 ml ) 700 μl glycerol stock -80. Glycerol stock 2 ml 3 ml DNA extraction large scale plasmid preparation. 3 ml 1 ml liquid culture media(lb media 2 ml + Ampicillin 2 μl ), liquid culture(37, 220 rpm, 8 hrs). 1 ml liquid culture media(lb media 100 ml + Ampicillin 100 μl ) liquid culture(37, 220 rpm, 14 hrs), centrifuge(4, 12,000 rpm, 15 min) pellet., pellet -20 overnight. Pellet Solution Ⅰ(25 mm Tris-base ph8.2, 10 mm EDTA, 15% Sucrose, 2 mg / ml Lysozyme) 6 ml pellet, ice 20. Solution Ⅱ(0.2 N NaOH, 1% SDS) ice 10, Solution Ⅲ(3 M Sodium acetate ph5.2) ice 20. Centrifuge(12,000 rpm, 30 min) centrifuge(12,000 rpm, 15 min), RNase 1 μl incubation. Incubation, phenol solution(phenol:chloroform:isoamylalcohol = 25:24:1) 1:1, 5 vortex 3,500 rpm 30 centrifuge, tube phenol solution 1:1. tube, 100% EtOH 200%, 7.5 M ammonium acetate 10%, , 12,000 rpm 20 centrifuge, pellet, TE buffer 1,000 μl competent cell cloning DNA. DNA extraction, spectrophotometer DNA, restriction enzyme(bamh I Nde I) double digestion(37, 14 hrs), annealing cdna 0.8% agarose gel ligation, transformation DNA extraction.

36 2. 1) (Sprague-Dawley rat) ± 0.5, 50 ± 5% Sprague-Dawley rat(, 8 ) 4 APM(Adipocyte Plasma Membrane) BSA(Bovine Serum Albumin) (2 / ),. 8, 1. 2 a. APM Treatment First Immunization APM(1.929 mg / ml ) 250 μg / Saline 1 ml Freund's Incomplete Adjuvant 1 ml Freund's Complete Adjuvant 1 ml Total Amount = 3 ml (1 ml / animals) Second and Third Immunization APM(1.929 mg / ml ) 125 μg / Saline 1 ml Freund's Incomplete adjuvant 2 ml Total Amount = 3 ml (1 ml / animals)

37 b. BSA Treatment First Immunization BSA 0.25 g / Saline 1 ml Freund's Incomplete adjuvant 1 ml Freund's complete adjuvant 2 ml Total Amount = 3 ml (1 ml / animals) Second and Third Immunization BSA g / Saline 1 ml Freund's Incomplete adjuvant 2 ml Total Amount = 3 ml (1 ml / animals) 3 3, soluble proteins, 50 ~ 1,000 μg (Harlow, 1988), (1998). rabbit 400 μl /site (Harlow, 1988), 1 ml 200 μl 5 ( 1 ml /, 200 μl / site) ~3 ml 1 2,800 rpm ether, g zipper bag saline 10 ml Stomacher(LBW400, TMC, Korea) 5.,

38 ELISA test, APM BSA Western immunoblotting -. Western immunoblotting APM BSA protein Laemmli(1970) sodium dodecyl sulfate poly-acrylamide gel electrophoresis(sds-page). Separation gel(12%) stacking gel(3%) PROTEAN II xi XL Vertical Electrophoresis Cells(Biorad, USA), 4.0 ml 30% acrylamide/n,n'-methylen-bisacrylamide, 2.5 ml 1.5 M Tris-HCl, ph 8.8, 3.4 ml ddh 2O, 100 μl 10% SDS, 50 μl 10% ammonium persulfate, 5 μl N,N,N',N'-tetramethylenediamine 1 ml 30% acrylamide/n,n'-methy-lenbisacrylamide, 1.25 ml 1 M Tris-Hcl(pH 6.8), 7.65 ml ddh 2O, 100 μl 10% SDS, 50 μl 10% ammonium persulfate, 10 μl TEMED. APM BSA protein 4 sample dilution buffer(2% SDS, 5% β -mercaptoethanol, 62.5 mm Tris, 0.001% bromophenol blue, 10% glycerol), 90~100 2~3, stacking gel loading 100 volts 90. gel coomassie brilliant blue R-250, Western immunoblotting nitrocellulose membrane(hybond TM -C Pure nitrocellulose membrane, Amersham, England) electro-transfer. SDS-PAGE APM BSA protein gel gel nitrocellulose membrane(8 cm 5.5 cm ) 8 cm 10.5 cm Gel blotting paper(schleicher & Schuell, England) blotting buffer(25 mm Tris-Hcl, ph 8.3, 1.4% glycine, 20% methanol) 5, Gel blotting paper Nitrocellulose membrane Gel Gel blotting paper assemble. Mini Trans-Blot Electrophoretic Transfer Cell(Biorad, USA) 4, 110 volts 90 nitrocellulose membrane, transfer nitrocellulose membrane zipper bag 4, transfer gel coomassie brilliant blue R-250 SDS-PAGE gel transfer. Western immunoblotting, APM BSA protein nitrocellulose membrane 10, TBS-Tween(50 mm Tris-Hcl, ph 7.4, 154 mm NaCl, 0.1% Tween 20) 10 2 washing, 5% skim

39 milk/tbs-tween 1 non-specific binding block. membrane APM BSA 1% skim milk 1:10,000, 2 binding. Primary antibody binding membrane TBS-Tween 2 washing, secondary antibody anti-rat immunoglobulin G-alkaline phosphatase conjugate(sigma Chemical, San Diego, USA) 1% skim milk 1:10,000 binding. Secondary antibody binding, membrane 3 TBS-Tween washing. Washing, 66 μl Nitroblue tetrazolium(nbt; Sigma Chemical, San Diego, USA) 33 μl 5-Bromo-4-chloro-3-indoyl-phosphate(BCIP; Sigma Chemical, San Diego, USA) 10 ml alkaline phosphatase substrate (100 mm Tris-HCl, 5 mm MgCl 2, 100 mm NaCl, ph 9.5) nitrocellulose membrane,. Fig. 5 Sprague-Dawley. Fig. 5. The experimental design to produce antibody against adipocyte plasma membrane or bovine serum albumin in Sprague-Dawley rats. 2) 1

40 , 3. Corriedale ( 60 kg ), adjuvant,, (1998). A Protein A 100 μg / ml, B A peptide Protein A μg / ml. C Protein B A 100 μg / ml., adjuvant Table 2. 2 ml (boosting). Table 2. Experimental design for sheep immunization Animals Peptide Peptide concentration Adjuvant Injection amount (peptide:adjuvant ratio) Sheep A Protein A 100 μg / ml Freund's incomplete 2ml (1:1) Sheep B Protein A 10 μg / ml Freund's incomplete 2ml (1:1) Sheep C Protein B 100 μg / ml Freund's incomplete 2ml (1:1) Protein A and B will refer to Table , 2,800 rpm, 30 centrifuge, (non-immunized serum), (antiserum). 2 biopsy (Fig. 6). (, A, B C)

41 ( ( )) (Fig. 6-A),, (( ) ) (Fig. 6-B), (Fig. 6-C), (Fig. 6-D) (Fig. 6-E) 20 g (Fig. 6-F). (Fig. 6-G) (Fig. 6-H),, (Fig. 6-I). A B C D E F G H I Fig. 6. Photographs showing biopsy procedures in sheep.

42 10 g PBS 1:1 homogenize 1,000 rpm 5 centrifuge -20, 10 g -80 deep freezer 2-20., homogenize centrifuge ELISA test. 3 Affinity column ELISA test, affinity column(hitrap Protein G column, Amersham, England) sulfur group resin peptide. PBS 10 column 1 M NaCl PBS. 0.1 M glycine(ph 3.0) 1 M Tris-Hcl(pH 8.0). SDS-PAGE band, protease inhibitor a. Primary antibody ; (1 μg / ml ) 96 well plate coating primary antibody,, 1:100 1:100,000 ELISA test. b.

43 ; sample( homogenize centrifuge ) primary antibody 1:100 1:100,000 coating (1 μg / ml ). c. Secondary antibody ; (1 μg / ml ) secondary antibody 1:500, 1:1,000, 1:2,000, 1:5,000 1:10,000 ELISA test - secondary antibody. d. coating ; 96 well plate well 1 μg 10-7 μg coating affinity column anti-sheep IgG ELISA test coating. kit., - Western immunoblotting. 3). 'One-shot ' boosting 'Boosting ', Fig One-shot 1~2 3

44 . Protein B synthetic peptide C peptide, adjuvant Imject R Alum(PIERCE, USA), Freund's adjuvant vaccine ( :DTP(Diphtheria, Tetanus, and Pertussis) vaccine ) adjuvant. Protein B synthetic peptide(600 μg / ml ) 0.3 ml PBS(phosphate buffered saline) 0.2 ml, alum adjuvant 0.5 ml 30 stir 1 ml /, 1 ml 3. peptide 180 μg / ml peptide (100 μg / ml ) 1.8, ( 60 kg, 600 kg ),. 4,. ELISA test. One-shot Group Non-immunized serum bleeding and Immunization Antiserum bleeding and Slaughter Boosting Group Non-immunized serum bleeding and Immunization Bleeding Bleeding Bleeding and Immunization Bleeding Bleeding Antiserum bleeding and Slaughter 0day 1week 2 weeks 3 weeks 4 weeks 5 weeks 6 weeks 15 weeks Fig. 7. Immunization schedule for Hanwoo(Korean Cattle).

45 3 (Hanwoo A, Hanwoo B Hanwoo C) (,, ) 300 g sampling, (non-immunized Hanwoo) ( 300 g) sampling. ice-box 4 ( ), 4 (70 ~ 80 g / muscle tissue) zipper bag. 4 sample (day 0), ELISA test ELISA test. sample day3, day7 day28 sample, day3 day7 sample 3 7, day28 sample 28. day0, day3, day7 day28, ELISA test. 2 Boosting, ( ) boosting 12. Boosting One-shot peptide, boosting (300 μg / ml ),. ( ), 7 ELISA test boosting injection. One-shot sampling ( 300 g), , ELISA test,, kit dot-elisa -.

46 Dot-ELISA Macedo-Silva (2000). peptide nitrocellulose membrane 5 μl 2, zipper bag 4 overnight. Non-specific binding blocking solution 5% skim milk, One-shot Boosting (ELISA) 1:1,000 1:100., Dot-ELISA. 3. rapid kit 1) Protein B synthetic peptide Table 3. Adjuvant alum Hanwoo B Hanwoo D boosting immunization, Hanwoo A, Hanwoo C, Hanwoo E adjuvant FCA one-shot. alum adjuvant, one-shot boosting boosting immunization one-shot design. Boosting 2,. 2) ELISA Dot blot ELISA. well (Protein B synthetic peptide) 1 μg 4 coating, 3% BSA blocking. Primary antibody well PBS-Tween, anti-(cow IgG)/HRP secondary antibody.

47 PBS-Tween, O-phenylenediamine., 2 N H 2 SO 4, 492 nm. Table 3. Antigen concentration of Hanwoo(Korean Cattle) retrial Adjuvant I D Primary immunization Antigen Concentration Boosting immunization Group Hanwoo A 1 mg / ml - One-shot Hanwoo B 1 mg / ml 0.3 mg / ml Boosting Alum Hanwoo C 3 mg / ml - One-shot Hanwoo D 3 mg / ml 0.9 mg / ml Boosting Hanwoo E 3 mg / ml - One-shot No. 1 1 mg / ml - One-shot No. 2 3 mg / ml - One-shot FCA No. 3 3 mg / ml - One-shot No. 4 1 mg / ml - One-shot No. 5 1 mg / ml - One-shot Dot-blot nitrocellulose membrane Protein B synthetic peptide blot BSA blocking. 1/100 1/200 primary antibody anti-(cow IgG)/HRP secondary antibody. PBS-Tween, 4-chloro-1-naphthol.

48 3) Gold conjugate 40 nm Colloidal Gold(BBInternational Ltd Golden Gate ty Gals Avenue Cardiff, CF14 5DX, UK) 0.25 M K 2CO 3 ph 9.0 Free Protein B synthetic peptide, KLH - Protein B synthetic peptide conjugate, OVA - Protein B synthetic peptide conjugate 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 μl / ml % NaCl 1%,. 100 ml Colloidal Gold conjugate 10, 10% BSA 0.1% 2. 10,000 g nm O.D. 10 conjugate buffer(50 mm Tris-HCl, ph 7.4, 5% BSA, 0.1% PEG). Protein A gold conjugate 40 nm Colloidal Gold BBI. 4) Assay strip Adhesive card(4cm 30cm, G&L Precision Die Cutting Inc. San Jose, CA, USA) nitrocellulose membrane(millipore 290 Concord Rd. Billerica, MA USA), absorbent pad(millipore 290 Concord Rd. Billerica, MA USA) (Free Protein B synthetic peptide, KLH - Protein B synthetic peptide conjugate, OVA - Protein B synthetic peptide conjugate) 1 mg / ml, 1.5 mg / ml, 2 mg / ml capture buffer(phosphate buffer, ph 7.4, 0.5% BSA, 3% Methanol) Matrix 1600 Reagent Dispenser(Kinematic Automation, P.O. Box 69, Twain Harte, CA 95383, USA) 1 μl / cm, 25% Humidity. (Control line) goat anti-mouse IgG(BBInternational Ltd Golden Gate ty Gals Avenue Cardiff, CF14 5DX, UK) 1 mg / ml. Strip Table 4. 5) Half test Strip half test. Fig well plate well 20 μl (loading buffer) + 20 μl (Free Protein B synthetic peptide, KLH - Protein B synthetic peptide conjugate, OVA - Protein B synthetic peptide conjugate, Protein A-gold conjugate) + 5 μl (serum meat juice) strip 5.

49 Table 4. Materials used for the strips Absorbent pad (AP26) Sample pad (AP31) Conjugate pad (#6613) Matter Cellulose High purity cotton Glass fiber and PE Size 30 cm 30 cm 20 cm 30 cm 29.5 cm 50 m Weight(g / m 2 ) thickness( mm ) Flow rate( mm / min) Pore size( μm ) 3-42 Fig. 8. The photograph showing the half test. 6) Prototype kit Sample pad 1% BSA, 0.5% Tween mm borate buffer(ph 7.4) 60., anti-(mouse IgG) coating nitrocellulose membrane adhesive card, sample pad, adsorption pad plastic housing prototype kit. prototype kit loading.

50 1) Table 5 peptide AntheProt SciProtein antigenic index, surface probability, hydrophilicity, flexible region peptide. proteosomal cleavage prediction, T-cell epitope prediction, homology. Table 5. List of antigenic protein candidates Peptide Origin Species Function Protein A Phyllomedusa sauvagei Frog Opioid peptide family Protein B Phyllomedusa sauvagei Frog Amphibian defense peptide Protein C Callinectes sapidus Crab Neuropeptide Protein D Periplaneta americana Cockroach Neuropeptide 2) peptide vector vector purification. Fig. 9 purification pet15b vector 0.8% agarose gel. pet15b vector 5,708 bp size vector (Fig. 4), vector Purification gel band 5,708 bp band vector purification. vector spectrophotometer (O.D 260 O.D 280 ) O.D 260 :O.D 280 ratio vector.

51 Lambda DNA Hin d III pet15b vector 23,130 bp 9,416 bp 6,557 bp 4,361 bp 5,708 bp 2,322 bp 2,027 bp Fig. 9. The result of electrophoresis for pet15b vector purified using QIAGEN R Maxi Kit. Plasmid pet15b vector annealing synthetic cdna vector restriction enzyme, 0.8% agarose gel digestion (Fig. 10). Fig. 10 enzyme digestion pet15b vector 2 band, pet15b vector double digestion. Peptide cloning vector, insert cdna annealing. Fig. 11 peptide sequence (Fig. 3) forward reverse nucleotide annealing, 12% non-denaturating polyacrylamide gel EtBr cdna. annealing cdna( 75 bp) annealing forward nucleotide( 60 bp) size band, annealing.

52 Lambda DNA Hin d III pet15b vector 23,130 bp 9,416 bp 6,557 bp 4,361 bp 2,322 bp 2,027 bp Fig. 10. The result of electrophoresis for a double digested pet15b vector. Restriction enzymes, BamH I and Nde I, were used to linearize the vector for cloning. 100 bp 75 bp 50 bp 25 bp A B C A : Size marker(25 / 100bp mixed DNA ladder) B : Forward nucleotide C : Annealed cdna Fig. 11. Annealed cdna band pattern compared with forward nucleotide.

53 double digested pet15b vector annealing cdna ligation, competent cell heat shock transformation colony liquid culture., peptide,. 2. 1) (Sprague-Dawley rat) Sprague-Dawley, Fig. 12. APM BSA,. 2 BSA APM,, BSA. Fig Stomacher ELISA test., 30 g saline 10 ml ELISA raw data dilution factor., 30 ~ 50%., 81,000 -,. kit.

54 g Initiation 1week 2week 3week 4week 5week 6week 7week Termination APM BSA Fig. 12. Changes in the body weight of Sprague-Dawley female rats actively immunized with either APM or BSA. Error bars are expressed as means ± S.E. Relative absorbance(%) reciprocal of antiserum dilution Non-immunized serum Antiserum Meat Juice Fig. 13. Reactivity of non-immunized serum, antiserum and meat juice against adipocyte plasma membrane proteins as detected by ELISA. The relative reactivity was expressed as percentage of the maximum optical density of antiserum. Error bars are expressed as means ± S.E. for 4 time repeats.

55 Relative absorbance(%) reciprocal of antiserum dilution Non-immunized serum Antiserum Meat Juice Fig. 14. Reactivity of non-immunized serum, antiserum and meat juice against bovine serum albumin as detected by ELISA. The relative reactivity was expressed as percentage of the maximum optical density of antiserum. Error bars are expressed as means ± S.E. for 4 time repeats. ELISA test, Western immunoblotting. ELISA test, Western immunoblotting primary antibody (1:1,000) (1:10,000) 10,. Fig. 15 A APM BSA polyacrylamide gel SDS-PAGE coomassie blue gel, Fig. 12 B C nitrocellulose membrane. SDS-PAGE -. membrane 10,, - ELISA test

56 . primary antibody, kit. kit. kda M.W APM BSA A kda M.W APM APM APM M.W BSA BSA BSA kda M.W APM APM APM M.W BSA BSA BSA B C Fig. 15. Western immunoblotting of adipocyte plasma membrane or bovine serum albumin proteins with antiserum(b) or meat juice(c) raised in rat. Anti-rat immunoglobulin G-Alkaline phosphatase conjugate(sigma Chemical, San Diego, USA) was used as a secondary antibody. (A) is SDS-PAGE pattern of proteins.

57 2) Fig. 16 A, B C peptide Table 2 titer titer ELISA test., 5 g saline 10 ml, homogenize ELISA raw data dilution factor., A, B, C peptide ( )., peptide., kit. Sheep A Relative absorbance(%) reciprocal of antiserum dilution Non-immunized serum Antiserum M eat juice Fig. 16. Reactivity of non-immunized serum, antiserum and meat juice in sheep against synthetic peptides as detected by ELISA. The relative reactivity was expressed as percentage of the maximum optical density of Sheep A antiserum. Error bars are expressed as means ± S.E. for 4 time repeats.

58 Sheep B Relative absorbance(%) reciprocal of antiserum dilution Non-immunized serum Antiserum M eat juice Fig. 16. Reactivity of non-immunized serum, antiserum and meat juice in sheep against synthetic peptides as detected by ELISA(continued). The relative reactivity was expressed as percentage of the maximum optical density of Sheep B antiserum. Error bars are expressed as means ± S.E. for 4 time repeats. Sheep C 140 Relative absorbance(%) reciprocal of antiserum dilution Non-immunized serum Antiserum Meat juice Fig. 16. Reactivity of non-immunized serum, antiserum and meat juice in sheep against synthetic peptides as detected by ELISA(continued). The relative reactivity was expressed as percentage of the maximum optical density of Sheep C antiserum. Error bars are expressed as means ± S.E. for 4 time repeats.

59 , 100 μg A 10 μg B, Nargi (1999) D-form, peptide peptide peptide (carrier protein, adjuvant ),. Fig. 17 affinity column fraction. 0.8 Elution p rofile of Sheep A Absorbance at 280 nm Fraction No. 1.8 Elution profile of Sheep B Absorbance at 280 nm Fraction No. Fig. 17. A elution profiles of antibodies against synthetic peptides using affinity column.

60 A fraction no. 4~8 purified Anti-sheep A IgG, B fraction no. 2~5 purified Anti-sheep B IgG. Anti-sheep IgG fraction no. SDS-PAGE band (Fig. 17), IgG heavy chain light chain size protein band affinity column purification. Fig primary antibody Fig. 16 ELISA test. Sheep A Relative absorbance(%) K 1 K 10 K 100 K 1,000 K 10,000 K 100,000 K Dilution factor Non-immunized serum Antiserum Non-immunized meat juice Meat Juice Fig. 18. Reactivity of non-immunized serum, antiserum and meat juices(non-immunized and immunized) in sheep against synthetic peptides depending on dilution ratio of primary antibody. The relative reactivity was expressed as percentage of the maximum optical density of Sheep A meat juice.

61 Sheep B Relative absorbance(%) K 1 K 10 K 100 K 1,000 K 10,000 K 100,000 K Dilution factor Non-immunized serum Non-immunized meat juice Antiserum Meat Juice Fig. 18. Reactivity of non-immunized serum, antiserum and meat juices(non-immunized and immunized) in sheep against synthetic peptides depending on dilution ratio of primary antibody(continued). The relative reactivity was expressed as percentage of the maximum optical density of Sheep B antiserum. Sheep C Relative absorbance(%) K 1 K 10 K 100 K 1,000 K 10,000 K 100,000 K Dilution factor Non-immunized serum Non-immunized meat juice Antiserum Meat Juice Fig. 18. Reactivity of non-immunized serum, antiserum and meat juices(non-immunized and immunized) in sheep against synthetic peptides depending on dilution ratio of primary antibody(continued). The relative reactivity was expressed as percentage of the maximum optical density of Sheep C non-immunized meat juice.

62 ELISA test, (1:100) -., kit kit. kit,,,. Fig sample, PBS homogenize ELISA test. 100 Relative absorbance(%) K 1 K 10 K 100 K 1,000 K 10,000 K 100,000 K Dilution factor Sheep A Homogenized meat juice Sheep A Thawed meat juice Sheep B Homogenized meat juice Sheep B Thawed meat juice Fig. 19. Comparison of antigen-specific affinity between two methods for the preparation of meat juice. The relative reactivity was expressed as percentage of the maximum optical density of Sheep A thawed meat juice.

63 100 ng / ml 96 well plate coating, well, 2 PBS homogenize -. kit, homogenize,. 2 - Fig ELISA test, well 1 2. Fig :500 1:2,000, 1:4,000 1:10, :1, Absorbance at 405nm ,000 4,000 6,000 8,000 10,000 Dilution factor Fig. 20. The result of ELISA to determine the optimal concentration of secondary antibody.

64 -, coating ELISA(Fig. 21) coating 10 ng / ml, 100 ng / ml. kit coating 10 ng / ml Absorbance at 405 nm E+00 1.E+01 1.E+02 1.E+03 1.E+04 1.E+05 1.E+06 Antigen Concentration(ug/ml) Anti-sheep A IgG Anti-sheep B IgG Sheep A meat juice Sheep B meat juice Fig. 21. The result of ELISA to determine the optimal concentration of antigen. Fig. 22 Western immunoblotting. Fig. 22 A C (non-immunized serum) Protein B synthetic peptide Western immunoblotting, membrane membrane carrier protein(ovalbumin, 45 kda).

65 Fig. 22. Western immunoblotting using synthetic peptides as an antigen and antiserum(a) and meat juice(b) as antibodies taken from sheep. Fig. 22 B biopsy Protein B synthetic peptide C membrane. ( ), ovalbumin peptide. A B membrane primary antibody Western immunoblotting (1:10,000),. membrane membrane, ELISA test titer. membrane(fig. 22-B).

66 ,. 3), -, primary antibody, secondary antibody.. Fig. 23 One-shoot ELISA test. primary antibody( ) 1:1,000. Fig. 23. Titers of antiserum raised against synthetic peptides in three Hanwoo(Korean Cattle) steers individuals immunized with antigen once.

67 peptide.,, One-shot. kit. adjuvant. Fig. 24 One-shoot (,, ). primary antibody( ) 1:1,000. Fig. 24. Titers of meat juice raised against synthetic peptides in three Hanwoo(Korean Cattle) steers individuals immunized with antigen once.

68 , Fig. 24, (Fore shank), (Loin) (Hind shank).,. ( ).,.,. Hanwoo C,. Hanwoo A Hanwoo B, Hanwoo C,.,. Fig ELISA test.. (0 day),. (day 28),, day 7.., kit,.

69 Relative absorbance(%) Fig. 25. Changes in the reactivity of antibodies in meat juice with synthetic peptides depending on storage period and muscle. Fig. 26 Boosting 1. primary antibody( ) 1:1,000. One-shot boosting Boosting (Fig. 26). immune response, boosting immunization. boosting immunization (3 weeks) 3 (Fig. 26). Fig. 27 Boosting (, ).

70 Relative absorbance(%) Boosting immunization Fig. 26. Changes in the reactivity of antiserum raised against synthetic peptides during immunization periods. The individuals were immunized twice, 0 and 3 weeks. Relative absorbance(%) Fig. 27. Changes in the reactivity of antibodies in meat juice of Hanwoo(Korean Cattle) steers of different muscle.

71 One-shot ELISA test primary antibody( ) 1:1,000, Boosting 12 1:1.000,. One-shot, (Neck Loin) (Top Round). Hanwoo A,. Substrate ( 20~30 ) 4, One-shot, One-shot (1:1,000), Fig. 18.,,, ( boosting immunization ). Fig. 28 One-shot dot-elisa. 1:1,000,, 1:1,000 1:100., One-shot Boosting, (1:00). Fig. 18 1:1,000,, adjuvant carrier protein,

72 kit. in vivo in vitro, blocking agent kit. A B C D E F A : Non-immunized serum B : Antiserum C : One-shot Hanwoo C loin non-immunized meat juice D : One-shot Hanwoo C loin meat juice E : Boosting Hanwoo A neck loin non-immunized meat juice F : Boosting Hanwoo A neck loin meat juice Fig. 28. Dot-ELISA results using synthetic peptides as antigens and antibodies in serum and meat juice of Hanwoo(Korean Cattle) steers.

73 3. rapid kit 1) 1 peptide, 7 (Hanwoo A, Hanwoo B, Hanwoo C, Hanwoo D, Hanwoo E, Hanwoo P, Hanwoo N). Table 3 1 mg 3 mg, 1 mg Hanwoo A one-shot, Hanwoo B 3 0.3mg boosting immunization. 3 mg Hanwoo C Hanwoo E one-shot 3mg 1, Hanwoo D boosting 0.9 mg boosting immunization, (one-shot 3, boosting ). 2 mg (Hanwoo P), (Hanwoo N). Adjuvant alum,, ELISA. Fig mg (Hanwoo C, Hanwoo D, Hanwoo E) 2 mg (Hanwoo P). 1 mg, Hanwoo B 3 mg, Hanwoo A. 1 mg 3 mg, 3 mg Hanwoo D 1 mg Hanwoo A. 1 ~ 3 mg, Hanwoo D,..

74 Titration of Meat Juice E E E E E E E-07 Hanwoo A Hanwoo B Hanwoo C Hanwoo D Hanwoo E Hanwoo P Hanwoo N Fig. 29. Antibody titration in immunized meat juice against the peptide conjugates differing in high-(hanwoo C, D, and E; 3 mg ) and low-(hanwoo A and B; 1 mg ) dosage injection. 2 Boosting primary injection(one-shot) boosting ELISA titer (Fig. 30). Titration of Meat Juice Absorbance E E E E-04 Dilutio n facto r 1.0E E-06 Hanw oo C Hanw oo E Hanw oo B Hanw oo D Hanw oo P Hanw oo N immu n iz ed se ru m Non-immunized serum Fig. 30. Antibody titration in immunized meat juice against the peptide conjugates differing in additional boosting(hanwoo B and D) or not(hanwoo C and E).

75 Fig. 30 boosting (Hanwoo B, Hanwoo D) (Hanwoo C, Hanwoo E). Boosting Hanwoo D, boosting boosting. 3 Alum FCA Adjuvant Adjuvant alum FCA(Freund's complete adjuvant), 5 (No. 1, No. 2, No. 3, No. 4, No. 5). alum, design Table 3, Fig. 31 ELISA titer. Fig. 31 alum adjuvant titer FCA adjuvant ELISA, alum FCA. alum FCA adjuvant (No. 4), alum FCA E-06 1E-07 Hanw oo P Hanw oo N Hanw oo E No.1 No.2 No.3 No.4 No.5 Fig. 31. Antibody titration in immunized meat juice against the peptide conjugates differing in adjuvant, alum(hanwoo E) and FCA(No.1, 2, 3, 4, and 5).

76 2) Rapid kit 1 Rapid kit strip Free peptide(protein B synthetic peptide) capture line coating. nitrocellulose membrane dot blot ELISA, Protein B synthetic peptide., carrier protein ovalbumin conjugation peptide(ova - Protein B synthetic peptide conjugate) capture line coating. rapid kit Fig. 32-A capture line OVA - Protein B synthetic peptide conjugate, detector OVA - Protein B synthetic peptide conjugate gold particle conjugate, strip coating. gold particle OVA - Protein B synthetic peptide conjugate conjugation gold particle steric hindrance. Fig. 32. Principles of the rapid kit manufacture.

77 rapid kit Fig. 32-B gold particle conjugation, Protein A. Protein A gold particle conjugation, steric hindrance. Protein A., Protein A anti-(cow IgG) gold particle conjugation. 2 Dot blot dot blot. ELISA Hanwoo E Hanwoo D. Fig. 33 nitrocellulose membrane peptide Row 1 ~ 3 binding, dot blot. 1/1000 Line A, binding signal, Line B. Hanwoo E Line C, 2 Line D Line C. ELISA Hanwoo D, 1/100 2 mg / ml binding row (Line E), 1/200 Line F Negative Control Line B.,. 3 strip - strip. Fig. 34-A 2, Fig. 34-B 4, Fig. 34-C 8, Fig. 34-D 16, Fig. 34-E 100, FCA (No. 1, No. 2, No. 3, No. 4, No. 5).

78 Row 1 : OVA - Protein B synthetic peptide, 2mg / ml Row 2 : OVA - Protein B synthetic peptide, 0.2mg / ml Row 3 : OVA - Protein B synthetic peptide, 0.02mg / ml Line Treatment Dilution Factor Line Treatment Dilution Factor A Antiserum 1:1000 B Hanwoo N 1:100 C Hanwoo E 1:100 D Hanwoo E 1:200 E Hanwoo D 1:100 F Hanwoo D 1:200 Fig. 33. The result of dot blot. Fig. 34-A, strip gold conjugate. Fig. 34-A-No 3 (control line)., 8 Fig. 34-C. Fig. 34-C.

79 Fig. 34. Determination of the optimum dilution factor of meat juice for application. The immunized meat juice was diluted to 1:2(A), 1:4(B), 1:8(C), 1:16(D), and 1:100(E) and applied to the immunochromaphy strips. No ELISA,.. (Fig. 34-E-Hanwoo P), ELISA 100, No. 4. alum adjuvant FCA ELISA, alum Hanwoo E FCA. Fig. 35. gold conjugate 8. No. 2 No. 3.. detergent loading buffer loading buffer rapid kit

80 sample pad sample conjugate pad. Fig. 35. Comparison of strips resulting from immunized meat juices differing in dilution factors for application. half test sample pad case prototype rapid kit test (Fig. 36). Test sample loading buffer(pbs ph 7.4, 10% Methanol, 0.1% SDS) 10.,. test,,. ELISA., rapid kit.., sample,,

81 .. A : Immunized meat juice B : Non-immunized meat juice C : Antiserum Fig. 36. Application of immunized meat juice to the developed immunochromatography strips.