<C3D6C1BEBAB8B0EDBCAD E616C292E687770>
|
|
- 진웅 매
- 6 years ago
- Views:
Transcription
1
2 : : : : : : : :
3 Ⅰ. Ⅱ.,.,, 6,,.,.,,,. Ⅲ. 1.
4 1) peptide,. (epitope), AntheProt SciProtein antigenic index, surface probability, hydrophilicity, flexible region. 2) peptide, Protein A Protein B sequence peptide., peptide T-cell immune response L-form peptide D-form. peptide carrier protein, peptide KLH (Keyhole Limpet Hemacyanin), ELISA test Western immunoblotting peptide ovalbumin carrier protein. 3) peptide peptide. peptide forward nucleotide reverse nucleotide pet15b vector annealing cdna ligation. Ligation vector DH5α (competent cell) heat shock transformation, LB Ampicillin agarose plate colony LB liquid culture, large scale plasmid preparation DNA extraction. 2. 1) (Sprague-Dawley rat)
5 . Sprague-Dawley APM (Adipocyte Plasma Membrane) BSA (Bovine Serum Albumin)., 8,. saline Stomacher. ELISA, APM BSA Western immunoblotting -. 2). Corriedale, biopsy, saline homogenize, deep freezer., homogenize centrifuge. Primary antibody,, Secondary antibody, coating., - Western immunoblotting. 3)
6 . 1, 4 sampling., ELISA., rapid kit Dot blot. 3. rapid kit 1). (Protein B synthetic peptide), One-shot Boosting. Boosting 2,. 2) ELISA Dot blot ELISA., Nitrocellulose membrane Protein B synthetic peptide blot BSA blocking. 1, Anti-cow IgG/HRP 2., 4-chloro-1-naphthol. 3) Gold conjugate Colloidal Gold free Protein B synthetic peptide, KLH - Protein B synthetic peptide conjugate, OVA - Protein B synthetic peptide conjugate., colloidal gold conjugate
7 .,., BSA. 4) Immunostrip Adhesive card nitrocellulose membrane, absorbent pad (free Protein B synthetic peptide, KLH Protein B synthetic peptide conjugate, OVA Protein B synthetic peptide conjugate) capture buffer, 25 % Humidity. goat anti-mouse IgG. 5) Strip test Strip half test. 96 well plate well loading buffer free Protein B synthetic peptide, KLH - Protein B synthetic peptide conjugate, OVA - Protein B synthetic peptide conjugate, Protein A-gold conjugate) + strip,. Ⅳ. 1. peptide, peptide proteosomal cleavage prediction, T-cell epitope prediction, homology homology Protein A (3mer) Protein B (12mer). peptide vector vector purification. Colony, peptide. 2.
8 1) APM (adipocyte plasma memberane) BSA (bovine serum albumin),., 81,000 -,. - Western immunoblotting. 2), peptide ( )., peptide. 2 ELISA test, well 1 2. coating ELISA test, coating 10 ng/ ml, 100 ng/ ml. Western immunoblotting, membrane membrane carrier protein., ovalbumin peptide. 3),,,..,
9 .,.. Boosting,. 3. rapid kit 1) 1, 1 ~ 3 mg,,. 2 Boosting Boosting. 3 Adjuvants Adjuvants alum FCA(Freund's complete adjuvant),, alum FCA. 4 Rapid kit strip Protein A gold particle conjugation - steric hindrance. Protein A. 5 Dot blot Nitrocellulose membrane peptide binding,
10 dot blot,. 6 strip sample pad case prototype rapid kit.,,. test,.,, rapid kit.,, sample,,.,., ( ),. kit,..
11 Ⅰ. Title of the project Development of rapid and accurate technologies to identify Hanwoo beef using specific proteins Ⅱ. Purposes and importance of study The current study was conducted to develope a technology to identify Hanwoo beef from imported beef. Ever since we opened beef market to foreign country, the biggest problems enfacing is that illegal marketing of cheap imported beef as a expensive Hanwoo beef. Furthermore, it is another threat to Hanwoo farmers that beef produced from imported live beef cattle could be labeled as a "domestic beef" if they were raised at least 6 months in Korea. All these situations brought rapid collapses of Hanwoo industry in Korea recently. Thus, it is very urgent and critical to develop technologies to identify Hanwoo beef from imported beef and/or from beef of imported live beef cattle. Final goal of the current study was to develope and commercialize the developed technologies to identify beef from specific farms and areas and thus, to regain consummer's evaluations about Hanwoo beef which was disregarded because of cheap and false marketing of imported beef. The current study will eventually improve international competitiveness of Hanwoo beef against imported beef.
12 Ⅲ. Contents and scopes of the study 1. Screening and synthesis of antigens to produce specific antibodies 1) Screening of antigens Candidate antigens reported to produce antibodies in various journals were screened based on "species involution tree" which may not have relationship with bovine genetically. Epitopic sites were checked based on the amino acid sequences of selected proteins, and then analysed for antigenic index, surface probability, hydrophilicity, and flexible region using AntheProt and SciProein software. 2) Synthesis of antigenic peptides The selected peptides, protein A and protein B, were synthesized in commercial company. All peptides synthesized in the current study was a D-form because D-form was reported to have higher T-cell immune response than natural L-form. Carrier proteins were conjugated to small peptides to stimulate immune responses. KLH (Keyhole Limpet Hemacyanin) was used for immunization and ovalbumin was used for ELISA test and immunoblotting to detect antibodies. 3) Production of the antigens using recombinant DNA technology The possibilities to produce antigens using recombinant DNA technology was examined in consideration of producing antigens in cheap price. Forward and reverse nucleotides for the selected peptides were annealed into plasmid vector, pet 15b, and ligated. Ligated vectors were transformed in to DH5 competent cells by heat shock, and the colonies on ampicillin agarose plates were selected and cultured in LB liquid media for large scale plasmid preparation. 2. Antibody production and detection
13 1) Preliminary study using Sprague-Dawley rats The essential part of the current study was to determine the possibilities of detection of any antibodies remaining in the muscle tissue of immunized animals and this was tested by preliminary study using Sprague-Dawley rats. Sprague-Dawley rats were immunized with APM (adipocyte plasma membrane) and BSA (bovine serum albumin). Blood was taken from animals before and after immunization to test immune responses. And muscle tissue was collected from immunized animals after 8 weeks of immunization. ELISA test and Western immunoblotting were performed to test antibody in both serum and muscle tissue. 2) Development of specific antibodies in sheep Once again prior to immunization of Hanwoo, further preliminary study was done using sheep since it is ruminant too. Male Corriedale sheep was immunized to produce antibody. About 20 g of M. biceps femoris was isolated by biopsy after immunization. Half of the muscle sample was homogenized with PBS and the supernatant was collected after centrifugation to use as a meat juice. The other half of the biopsied muscle was frozen in deep freezer and meat juice by thawing the muscle was collected and used. Studies to detect antibodies in meat juices according to dilution factor of primary antibody, preparation method of meat juices, dilution factors for secondary antibody, and optimum concentrations of antigens for coating were performed as a preliminary studies. Western immunoblotting was performed too. 3) Immunization of Hanwoo to identify branded Hanwoo beef Based on the results of optimum antibody production conditions obtained through preliminary studies, immunization of Hanwoo was performed. Finishing Hanwoo was immunized one month before marketing and muscle was sampled when the animals were slaughtered. Meat juices were used for ELISA to test the
14 level of antibody reactions, storage times, and how to keep the meat. And dot blotting was performed as preliminary study to develope rapid kit for the identification of branded Hanwoo beef rapidly and accurately. 3. Development of rapid kit to identify Hanwoo beef 1) Screening of various conditions to develope antibody On the basis of the results obtained from previous experiments, the optimum conditions for immunization of Hanwoo (Korean Cattle) was established. Hanwoo were randomly allotted in equal numbers into two treatment groups according to the amounts of antigens. Each group was subdivided into booster injection and one-time injection group. Two weeks after boosting injection, all animals were slaughtered and meat juices from muscle were prepared and tested for antibody production. 2) ELISA and dot blot analysis Antibody titers to the peptides used for immunization were determined using an ELISA. For dot blot analysis, nitrocellulose membrane was blotted with Protein B synthetic peptide, dried at room temperature, and blocked with BSA solution. The membrane was incubated with meat juice or antiserum, and rabbit anti-cow immunoglobulin conjugated to horseradish peroxidase were used as secondary antibodies. Following the addition of substrate, 4-chloro-1-naphthol, the membrane was incubated until color was developed. 3) Preparation of gold conjugates A range of concentrations of colloidal gold was added into solutions dissolving free Protein B synthetic peptide, KLH-Protein B synthetic peptide conjugate, and OVA-Protein B synthetic peptide conjugate, respectively. The optimal concentration at which there was no change in color of solution was determined. Ten percent BSA solution was added and stirred. After centrifugation, the supernatant was discarded and the pellet was resuspended in conjugate buffer at the concentration yielding a response.
15 4) Preparation of the immunostrip Protein B synthetic peptide-ova conjugate and goat anti-mouse IgG were applied to the test and control line, respectively, on the nitrocellulose membrane using Matrix 1600 reagent dispenser and dried overnight at 25% humidity. The nitrocellulose membrane and absorbent pad were assembled and attached to a adhesive card. 5) Strip test The meat juice obtained form immunized Hanwoo was applied to the strip prepared as described. The premixed sample with loading buffer and Protein A-gold conjugate were applied to the strips to evaluate the results. Ⅳ. Results and suggestions for the application of the study Results of the study 1. Screening and synthesis of antigens to produce specific antibodies Peptide candidates to be used as antigens were selected from data analysis of computer programs, and proteosomal cleavage prediction and T-cell epitope prediction were analyzed based on web-site supported softwares. Protein A (3 mer) and Protein B (12 mer) which have no homology with any other proteins in bovine species were finally selected as antigens. Mass growth of E. coli carrying vector with inserts for the selected peptides and vector purification were performed and the possibilities of mass production of antigens with cheap price were tested. 2. Development and detection of specific antibody 1) Preliminary study using Sprague-Dawley rats Both APM (adipocyte plasma membrane) and BSA (bovine serum albumin) produced
16 high titers of antiserum. And titers in meat juices were relatively lower than those in antiserum, but were high enough to identify those from non-immunized antiserum. These results were confirmed by Western immunoblotting too. 2) Development of antibody in meat juice of sheep High antibody titers were confirmed in both antiserum and meat juices of immunized sheep comparing to non-immunized serum. Titers in meat juices were higher than those in non-immunized serum while they were lower than those in antiserum. The concentrations of secondary antibody were critical to determine titers by ELISA showing that various dilutions of secondary antibody had concentration dependent antigen-antibody reactions. Antigen-antibody reaction could be detected from 10 ng/ ml of antigen coated on the well for ELISA test, and consistent ELISA results could be obtained when more than 100 ng/ ml of antigens were coated on the wall. In Western immunoblotting, antiserum expressed strong reactions around carrier protein whereas non-immunized serum showed no reactions with those protein. These patterns of antigen-antibody reaction in antiserum in immunoblotting appeared same in meat juices showing strong reactions with peptide conjugated to ovalbumin. 3) Immunization of Hanwoo to identify branded beef High titers of antibody in muscles, fore shank, loin, and hind shank, of Hanwoo was detected by immunization of peptides subcutaneously. The titers were dependent on storage time and storage methods by showing the highest titers on the same of slaughtering. And the titers were gradually reduced as the storage times went on. Meat juice extracted from frozen muscle on slaughtering date showed lower titers than meat juice extracted from refrigerated muscle which means that refrigerated muscle is much more efficient to prepare meat juice than frozen muscle. Titers of antibody in meat juice from boosting injected Hanwoo expressed higher level comparing to non-immunized serum. 3. Development of rapid diagnostic kit to identify branded Hanwoo beef 1) Screening of optimum conditions to develope antibody
17 1 Effects of the amount of antigens There were not a significant differences among the amounts of antigens immunized in the development of antibodies. The sensitivity of individual would be much more important in antibody development than the amount of antigens. 2 Effects of boosting injection There were not a remarkable differences between one-shot immunized animals and boosting immunized animals. 3 Effect of adjuvants By using alum and FCA (Freund's complete adjuvant) as adjuvants, FCA showed higher titers than alum overall. 4 Screening of conditions to make strip for rapid kit By conjugation with gold particle to Protein A, antigen-antibody reaction was enhanced without steric hindrance. Furthermore, the use of Protein A had amplifying effects to detect very small amounts of antibody in meat juice effectively. 5 Screening of conditions using dot blot After dot blotting by binding antigenic peptides onto nitrocellulose membrane, it was confirmed that detection of antibody in meat juice is possible as far as immune reaction has been occurred in Hanwoo body. 6 Changes in reaction in strip according to dilution factors of meat juice Rapid kit was invented based on above mentioned preliminary results. Clear development of control and reaction line could be confirmed in immunized serum whereas reaction line could not be detected in negative control group which had a clear control line. Meat juices from immunized animals also showed clear reaction bands same as antiserum. Overall, the current study confirmed the possibilities to identify specific branded beef rapidly and accurately using rapid kit when the animals are immunized with specific proteins. Further studies, however, such as to enhance the sensitivity of reaction bands, to obtain stable results in various conditions and environments, to solve problems of non-reactive individuals, and to handle these kits easily by consumer group, should be
18 followed to commercialize the current results. The current study would be much more beneficial for branded beef because those beef could be identified in the market quickly and easily with the rapid kit invented in this study. Suggestions for the application of the study Taken together, the current study confirmed that specific antibodies present in Hanwoo beef produced by immunization with specific proteins could be detected (patent pending), and developed test strip kit for easy field use. Further studies to minimize variations of diagnostic kits and to confirm the results in large scale of Hanwoo populations are needed to commercialize the current study. And governmental supports to the distribution of kits and to farmers are essential for the commercialization of the current study in the near future.
19 CONTENTS Chapter 1. Introduction 23 Chapter 2. The present status of domestic and foreign technology 25 Chapter 3. Contents and results of the study 27 Part. Contents of the study Screening and synthesis of antigens to produce specific antibodies 27 1) Screening of antigens 27 2) Synthesis of antigenic peptides 28 3) Production of the antigens using recombinant DNA technology 29 1 Cloning of genes responsible to specific proteins of Hanwoo 29 2 Establishment of conditions for vector expression 30 3 Production of specific proteins Antibody production and detection 35 1) Preliminary study using Sprague-Dawley rats 35 1 Experimental animals 35 2 Preparation of antigens and immunization 35 3 Production of antiserum and meat juices 36 2) Development of specific antibodies in sheep 38 1 Experimental animals and immunization 38 2 Production of antiserum and meat juices 39 3 Purification of antibodies using affinity column 41 4 Establishment of optimum conditions to detect antibodies 41
20 3) Immunization of Hanwoo to identify branded Hanwoo beef 42 1 One-shot treatment 42 2 Boosting treatment Development of rapid kit to identify Hanwoo beef 45 1) Screening of various conditions to develope antibody 45 2) ELISA and Dot blot analysis 45 3) Preparation of gold conjugate 47 4) Preparation of the immunostrip 47 5) Preparation of half test 47 6) Preparation of prototype kit 48 Part. Results of the study Screening and synthesis of antigens 49 1) Screening and synthesis of antigens using data base 49 2) Production of antigens using recombinant DNA technology Development and detection of specific antibody 52 1) Preliminary study using Sprague-Dawley rats 52 2) Development of antibody in meat juice of sheep 56 3) Immunization of Hanwoo to identify branded beef Development of rapid diagnostic kit to identify branded Hanwoo beef 72 1) Screening of optimum conditions to develope antibody 72 1 Effects of the amount of antigens 72 2 Effects of boosting injection 73 3 Effects of adjuvants 74 2) Development for rapid kit 75 1 Screening of conditions to make strip for rapid kit 75 2 Screening of conditions using dot blot 76 3 Changes in reaction in strip according to dilution factors of meat juice 76
21 Chapter 4. Degree of attainment and contribution to the related field 81 Chapter 5. Application plan of the results of this study 83 Chapter 6. Foreign technical information collected during this R&D 84 Chapter 7. Reference 85
22 ) 27 2) peptide 28 3) vector ) (Sprague-Dawley rat) ) Affinity column ) 42 One-shot 42 Boosting 44
23 3. rapid kit 45 1) 45 2) ELISA Dot-blot 45 3) Gold conjugate 47 4) Assay strip 47 5) Half test 47 6) Prototype kit ) 49 2) ) (Sprague-Dawley rat) 52 2) 56 3) rapid kit 72 1) Boosting 73 Alum FCA Adjuvant 74 2) Rapid kit 75 Rapid kit strip 75 Dot-blot 76 strip
24 제 1 장 연구개발과제의개요 1993 UR(Uruguay Round of Multinational Trade Negotiation),, , ,476, ( %, %, %), , (,,, ).,.., 6,.,,, ,,, 1 ( ),, ( : 2000, , 1, , 1,359 ).,,
25 .,,.,. ( Holstein ),,,., Hereford ( ).,..,,,,.
26 제 2 장 국내외기술개발현황 DNA. Wyman (1980) RFLP(Restriction Fragment Length Polymorphisms), DNA probe (Chikuni, 1990), RAPD(Random Amplified Polymorphic DNA), AFLP(Amplified Fragment Length Polymorphism), MS(Microsatellite), SSCP(Single Strand Conformation Polymorphism), DAF(DNA Amplification Fingerprinting) (Kirby, 1992). Jeffreys (1985) DNA fingerprinting, (, polymorphism) (Kuhnlein, 1989; Kikawa, 1995; Pitra, 1997), AFLP, DNA marker (Otsen, 1996)., RAPD (Holstein) (, 2001), microsatellite marker genetic marker (, 2001).,,., RIA(Radio immunoassay: ), RIA RIA,, ELISA, (Demeulemester, 1991; Hsieh, 1996; Janssen, 1987; Samarajeewa, 1991), kit, kit (Dong, 2003; Langedijk, 2001; Soutullo, 2001; Drew, 1999; Eisler, 1998; Cheng, 1996; Saravi, 1995).
27 ,., (identification) (traceability), Council Regulation(EC) No. 820/97. Council Regulation(EC) No. 820/97, (meat supply chain) (key) (identification number). (scanning) EDI( ),,,,.,,.
28 제 3 장 연구개발수행내용및결과 1. 1) peptide (Lee, 2002; Tamar, 2002; Tooyama, 2000; Kramer, 1998; Mohri, 1997; Briand, 1997; Benkirane, 1995),. (epitope), AntheProt SciProtein (Fig. 1), antigenic index, surface probability, hydrophilicity, flexible region. AntheProt SciProtein Fig. 1. Antigenic site analysis using programs, Antheprot and SciProtein.
29 peptide, peptide proteosomal cleavage prediction, T-cell epitope prediction (Table 1), homology homology Protein B (12mer) Tooyama (2000) Protein A(3mer). Protein A, Protein B Table 5. Table 1. Antigenic site analysis by web programs Program Brief Descriptions Download/www locations NetChop Proprac SYFPEITHI MAPPP PREDEP A neural network based proteosomal cleavage prediction. A neural network based proteosomal cleavage prediction. A www service for predicting MHC binding prptides for 24 class I and II alleles of human/mouse and rat. A complete www service with ORF and MHC binding prediction. It combines both SYFPEITHI and BIMAS A structure-based algorithm for prediction of MHC class-i epitopes. Available as www service for 13 alleles of different species. NetChop CServer.dll/EpPredict.htm /MAPPP/expertquery.html g/teppred/mhc-bind/ 2) peptide peptide(protein A Protein B) sequence peptide (( ),, ).,
30 peptide T-cell immune response L-form peptide (Van Regenmortel, 1998) D-form. L-form peptide D-form peptide (Fig. 2). Fig. 2. Mirror symmetry between L- and D-forms of peptides. peptide carrier protein, peptide KLH(Keyhole Limpet Hemacyanin), ELISA test Western immunoblotting peptide ovalbumin carrier protein. 3) 1
31 ,, homology peptide, peptide. ( peptide) Protein A Protein B, Protein A 3mer peptide cloning, Protein B (12mer)., 12mer peptide cloning peptide (22mer, Protein B), peptide cloning. peptide cdna ( ) ( DNA, ) forward nucleotide reverse nucleotide expression vector, design Fig. 3. Forward nucleotide 5 -TAGTGATGAAGATATGGAGATATCAGCT CTCTTTAGAGGTTCTCCCTTAAAAGTCAAAC GCTCAGACTAG-3 Reverse nucleotide 5 -GATCCTAGTCTGAGCGTTTGACTTTTAA GGGAGAACCTCTAAAGAGAGCTGATATCTC CATATCTTCATCAC-3 Fig. 3. Sequence of the synthetic cdna. 2 vector expression vector pet15b vector. pet15b vector nickel column vector,
32 N-terminal his-tag his-tag antigen. pet15b vector Fig. 4. Peptide cloning vector(pet15b) LB media(sodium Chloride 10 g, Tryptone yeast 5 g, Trypton pepton 10 g, ddh 2O 1 l) agar autoclave 1% ampicillin(100 mg / ml ) petridish LB ampicillin agar plate 4. pet15b vector LB ampicillin agarose plate streaking 37 incubator 14~ mltube LB media 10 ml ampicillin 10 μl colony loop shaking incubator 37, 220 rpm ml culture ml LB media ampicillin 2 l LB media 12 shaking incubator 37, 220 rpm 2 l liquid culture. 500 ml centrifuge ware centrifuge(2,500 g, 20 min) pellet, pellet centrifuge ware 4 overnight. Fig. 4. pet15b vector.
33 QIAGEN R Plasmid Maxi Kit pellet vector purification. Purification QIAGEN R Plasmid Maxi Kit QIAGEN R Plasmid Purification Handbook, purification vector agarose gel purification. -20 vector sample 4 mixture. Mixture vector sample 1 μl, ddh 2 O 12 μl, pet15b vector BamH I site BamH I restriction enzyme(mbi Fermentas, USA) 0.5 μl 10 BamH I Buffer(MBI Fermentas, USA) 1.5 μl 6 type I gel loading buffer 3 μl total volume 18 μl, 37 water bath incubation(overnight) restriction enzyme BamH I site. 0.8% agarose gel mixture(1 TAE buffer 80 ml, agarose 0.64 g) oven agarose, EtBr 5 μl agarose gel, pet15b vector size λ Hind III marker 37 water bath incubation mixture loading, 55 volts, 1 30 band UV trans-illuminator. purification vector Peptide cloning ( peptide) cdna pet15b vector insert site restriction enzyme. Fig. 4 pet15b vector Xho I(324) site BamH I(319) site Nde I(331) site, BamH I Nde I site restriction enzyme double digestion cdna ligation. Purification pet15b vector 100 μl BamH I Nde I restriction enzyme 8 μl, 2 Y + /Tango TM enzyme buffer 60 μl, ddh 2 O 124 μl total volume 300 μl mixture, mixture incubation double digestion. Double digestion, restriction enzyme vector 0.8% agarose gel.
34 Ligation vector, forward nucleotide reverse nucleotide(fig. 7) Hubank (1994) annealing. 1 EcoR I buffer 43.4 μl forward nucleotide reverse nucleotide 3.3μl PCR machine 95, 1 94, 1 93, 1 10, 1 end ligation synthetic cdna. cdna annealing 12% non-denaturating polyacrylamide gel(30% acrylamide/bis 2.66 ml, ddh 2 O 5.27 ml, 5 TBE 2 ml, 10% AMPS 70 μl, TEMED 3.5 μl ) forward nucleotide annealing products(cdna) loading (50 volts, 2 hrs) band pattern. Double digestion pet15b vector annealing cdna insert ligation. Ligation mixture T4 ligase 1 μl, ligase buffer 1 μl, cdna 0.4 μl, pet15b vectors 1 μl ddh 2 O 6.6 μl total volume 10 μl. mixture 16 16, incubation, transformation. Transformation competent cell DH5α(Introgen Therapeutics, INC., Texas, USA). Competent cell 30 μl incubation mixture sample 3 μl tapping, ice , ice 3 shock competent cell ligation sample., LB media 500 μl, shaking incubator 37, 220 rpm, 1 shaking. X-gal(5-Bromo-4-chloro-3-indolyl-β-D-galactopyranoside, MBI, USA) 20 μl IPTG (Isopropyl-β-D-Thi-ogalactopyronoside, dioxane free, MBI, USA) 50 μl mixture LB Ampicillin agarose plate, plate. Shaking product X-gal IPTG mixture LB Ampicillin agarose plate, incubator overnight. Overnight LB plate colony liquid culture media(lb media 5 ml + Ampicillin 5 μl ) loop, 5 ml liquid culture(37, 240 rpm, 9 hrs). Liquid culture competent cell 5 ml 2 ml centrifuge(12,000 rpm, 4, 1 min), pellet
35 glycerol stock solution(lb media 75 ml, glycerol 25 ml ) 700 μl glycerol stock -80. Glycerol stock 2 ml 3 ml DNA extraction large scale plasmid preparation. 3 ml 1 ml liquid culture media(lb media 2 ml + Ampicillin 2 μl ), liquid culture(37, 220 rpm, 8 hrs). 1 ml liquid culture media(lb media 100 ml + Ampicillin 100 μl ) liquid culture(37, 220 rpm, 14 hrs), centrifuge(4, 12,000 rpm, 15 min) pellet., pellet -20 overnight. Pellet Solution Ⅰ(25 mm Tris-base ph8.2, 10 mm EDTA, 15% Sucrose, 2 mg / ml Lysozyme) 6 ml pellet, ice 20. Solution Ⅱ(0.2 N NaOH, 1% SDS) ice 10, Solution Ⅲ(3 M Sodium acetate ph5.2) ice 20. Centrifuge(12,000 rpm, 30 min) centrifuge(12,000 rpm, 15 min), RNase 1 μl incubation. Incubation, phenol solution(phenol:chloroform:isoamylalcohol = 25:24:1) 1:1, 5 vortex 3,500 rpm 30 centrifuge, tube phenol solution 1:1. tube, 100% EtOH 200%, 7.5 M ammonium acetate 10%, , 12,000 rpm 20 centrifuge, pellet, TE buffer 1,000 μl competent cell cloning DNA. DNA extraction, spectrophotometer DNA, restriction enzyme(bamh I Nde I) double digestion(37, 14 hrs), annealing cdna 0.8% agarose gel ligation, transformation DNA extraction.
36 2. 1) (Sprague-Dawley rat) ± 0.5, 50 ± 5% Sprague-Dawley rat(, 8 ) 4 APM(Adipocyte Plasma Membrane) BSA(Bovine Serum Albumin) (2 / ),. 8, 1. 2 a. APM Treatment First Immunization APM(1.929 mg / ml ) 250 μg / Saline 1 ml Freund's Incomplete Adjuvant 1 ml Freund's Complete Adjuvant 1 ml Total Amount = 3 ml (1 ml / animals) Second and Third Immunization APM(1.929 mg / ml ) 125 μg / Saline 1 ml Freund's Incomplete adjuvant 2 ml Total Amount = 3 ml (1 ml / animals)
37 b. BSA Treatment First Immunization BSA 0.25 g / Saline 1 ml Freund's Incomplete adjuvant 1 ml Freund's complete adjuvant 2 ml Total Amount = 3 ml (1 ml / animals) Second and Third Immunization BSA g / Saline 1 ml Freund's Incomplete adjuvant 2 ml Total Amount = 3 ml (1 ml / animals) 3 3, soluble proteins, 50 ~ 1,000 μg (Harlow, 1988), (1998). rabbit 400 μl /site (Harlow, 1988), 1 ml 200 μl 5 ( 1 ml /, 200 μl / site) ~3 ml 1 2,800 rpm ether, g zipper bag saline 10 ml Stomacher(LBW400, TMC, Korea) 5.,
38 ELISA test, APM BSA Western immunoblotting -. Western immunoblotting APM BSA protein Laemmli(1970) sodium dodecyl sulfate poly-acrylamide gel electrophoresis(sds-page). Separation gel(12%) stacking gel(3%) PROTEAN II xi XL Vertical Electrophoresis Cells(Biorad, USA), 4.0 ml 30% acrylamide/n,n'-methylen-bisacrylamide, 2.5 ml 1.5 M Tris-HCl, ph 8.8, 3.4 ml ddh 2O, 100 μl 10% SDS, 50 μl 10% ammonium persulfate, 5 μl N,N,N',N'-tetramethylenediamine 1 ml 30% acrylamide/n,n'-methy-lenbisacrylamide, 1.25 ml 1 M Tris-Hcl(pH 6.8), 7.65 ml ddh 2O, 100 μl 10% SDS, 50 μl 10% ammonium persulfate, 10 μl TEMED. APM BSA protein 4 sample dilution buffer(2% SDS, 5% β -mercaptoethanol, 62.5 mm Tris, 0.001% bromophenol blue, 10% glycerol), 90~100 2~3, stacking gel loading 100 volts 90. gel coomassie brilliant blue R-250, Western immunoblotting nitrocellulose membrane(hybond TM -C Pure nitrocellulose membrane, Amersham, England) electro-transfer. SDS-PAGE APM BSA protein gel gel nitrocellulose membrane(8 cm 5.5 cm ) 8 cm 10.5 cm Gel blotting paper(schleicher & Schuell, England) blotting buffer(25 mm Tris-Hcl, ph 8.3, 1.4% glycine, 20% methanol) 5, Gel blotting paper Nitrocellulose membrane Gel Gel blotting paper assemble. Mini Trans-Blot Electrophoretic Transfer Cell(Biorad, USA) 4, 110 volts 90 nitrocellulose membrane, transfer nitrocellulose membrane zipper bag 4, transfer gel coomassie brilliant blue R-250 SDS-PAGE gel transfer. Western immunoblotting, APM BSA protein nitrocellulose membrane 10, TBS-Tween(50 mm Tris-Hcl, ph 7.4, 154 mm NaCl, 0.1% Tween 20) 10 2 washing, 5% skim
39 milk/tbs-tween 1 non-specific binding block. membrane APM BSA 1% skim milk 1:10,000, 2 binding. Primary antibody binding membrane TBS-Tween 2 washing, secondary antibody anti-rat immunoglobulin G-alkaline phosphatase conjugate(sigma Chemical, San Diego, USA) 1% skim milk 1:10,000 binding. Secondary antibody binding, membrane 3 TBS-Tween washing. Washing, 66 μl Nitroblue tetrazolium(nbt; Sigma Chemical, San Diego, USA) 33 μl 5-Bromo-4-chloro-3-indoyl-phosphate(BCIP; Sigma Chemical, San Diego, USA) 10 ml alkaline phosphatase substrate (100 mm Tris-HCl, 5 mm MgCl 2, 100 mm NaCl, ph 9.5) nitrocellulose membrane,. Fig. 5 Sprague-Dawley. Fig. 5. The experimental design to produce antibody against adipocyte plasma membrane or bovine serum albumin in Sprague-Dawley rats. 2) 1
40 , 3. Corriedale ( 60 kg ), adjuvant,, (1998). A Protein A 100 μg / ml, B A peptide Protein A μg / ml. C Protein B A 100 μg / ml., adjuvant Table 2. 2 ml (boosting). Table 2. Experimental design for sheep immunization Animals Peptide Peptide concentration Adjuvant Injection amount (peptide:adjuvant ratio) Sheep A Protein A 100 μg / ml Freund's incomplete 2ml (1:1) Sheep B Protein A 10 μg / ml Freund's incomplete 2ml (1:1) Sheep C Protein B 100 μg / ml Freund's incomplete 2ml (1:1) Protein A and B will refer to Table , 2,800 rpm, 30 centrifuge, (non-immunized serum), (antiserum). 2 biopsy (Fig. 6). (, A, B C)
41 ( ( )) (Fig. 6-A),, (( ) ) (Fig. 6-B), (Fig. 6-C), (Fig. 6-D) (Fig. 6-E) 20 g (Fig. 6-F). (Fig. 6-G) (Fig. 6-H),, (Fig. 6-I). A B C D E F G H I Fig. 6. Photographs showing biopsy procedures in sheep.
42 10 g PBS 1:1 homogenize 1,000 rpm 5 centrifuge -20, 10 g -80 deep freezer 2-20., homogenize centrifuge ELISA test. 3 Affinity column ELISA test, affinity column(hitrap Protein G column, Amersham, England) sulfur group resin peptide. PBS 10 column 1 M NaCl PBS. 0.1 M glycine(ph 3.0) 1 M Tris-Hcl(pH 8.0). SDS-PAGE band, protease inhibitor a. Primary antibody ; (1 μg / ml ) 96 well plate coating primary antibody,, 1:100 1:100,000 ELISA test. b.
43 ; sample( homogenize centrifuge ) primary antibody 1:100 1:100,000 coating (1 μg / ml ). c. Secondary antibody ; (1 μg / ml ) secondary antibody 1:500, 1:1,000, 1:2,000, 1:5,000 1:10,000 ELISA test - secondary antibody. d. coating ; 96 well plate well 1 μg 10-7 μg coating affinity column anti-sheep IgG ELISA test coating. kit., - Western immunoblotting. 3). 'One-shot ' boosting 'Boosting ', Fig One-shot 1~2 3
44 . Protein B synthetic peptide C peptide, adjuvant Imject R Alum(PIERCE, USA), Freund's adjuvant vaccine ( :DTP(Diphtheria, Tetanus, and Pertussis) vaccine ) adjuvant. Protein B synthetic peptide(600 μg / ml ) 0.3 ml PBS(phosphate buffered saline) 0.2 ml, alum adjuvant 0.5 ml 30 stir 1 ml /, 1 ml 3. peptide 180 μg / ml peptide (100 μg / ml ) 1.8, ( 60 kg, 600 kg ),. 4,. ELISA test. One-shot Group Non-immunized serum bleeding and Immunization Antiserum bleeding and Slaughter Boosting Group Non-immunized serum bleeding and Immunization Bleeding Bleeding Bleeding and Immunization Bleeding Bleeding Antiserum bleeding and Slaughter 0day 1week 2 weeks 3 weeks 4 weeks 5 weeks 6 weeks 15 weeks Fig. 7. Immunization schedule for Hanwoo(Korean Cattle).
45 3 (Hanwoo A, Hanwoo B Hanwoo C) (,, ) 300 g sampling, (non-immunized Hanwoo) ( 300 g) sampling. ice-box 4 ( ), 4 (70 ~ 80 g / muscle tissue) zipper bag. 4 sample (day 0), ELISA test ELISA test. sample day3, day7 day28 sample, day3 day7 sample 3 7, day28 sample 28. day0, day3, day7 day28, ELISA test. 2 Boosting, ( ) boosting 12. Boosting One-shot peptide, boosting (300 μg / ml ),. ( ), 7 ELISA test boosting injection. One-shot sampling ( 300 g), , ELISA test,, kit dot-elisa -.
46 Dot-ELISA Macedo-Silva (2000). peptide nitrocellulose membrane 5 μl 2, zipper bag 4 overnight. Non-specific binding blocking solution 5% skim milk, One-shot Boosting (ELISA) 1:1,000 1:100., Dot-ELISA. 3. rapid kit 1) Protein B synthetic peptide Table 3. Adjuvant alum Hanwoo B Hanwoo D boosting immunization, Hanwoo A, Hanwoo C, Hanwoo E adjuvant FCA one-shot. alum adjuvant, one-shot boosting boosting immunization one-shot design. Boosting 2,. 2) ELISA Dot blot ELISA. well (Protein B synthetic peptide) 1 μg 4 coating, 3% BSA blocking. Primary antibody well PBS-Tween, anti-(cow IgG)/HRP secondary antibody.
47 PBS-Tween, O-phenylenediamine., 2 N H 2 SO 4, 492 nm. Table 3. Antigen concentration of Hanwoo(Korean Cattle) retrial Adjuvant I D Primary immunization Antigen Concentration Boosting immunization Group Hanwoo A 1 mg / ml - One-shot Hanwoo B 1 mg / ml 0.3 mg / ml Boosting Alum Hanwoo C 3 mg / ml - One-shot Hanwoo D 3 mg / ml 0.9 mg / ml Boosting Hanwoo E 3 mg / ml - One-shot No. 1 1 mg / ml - One-shot No. 2 3 mg / ml - One-shot FCA No. 3 3 mg / ml - One-shot No. 4 1 mg / ml - One-shot No. 5 1 mg / ml - One-shot Dot-blot nitrocellulose membrane Protein B synthetic peptide blot BSA blocking. 1/100 1/200 primary antibody anti-(cow IgG)/HRP secondary antibody. PBS-Tween, 4-chloro-1-naphthol.
48 3) Gold conjugate 40 nm Colloidal Gold(BBInternational Ltd Golden Gate ty Gals Avenue Cardiff, CF14 5DX, UK) 0.25 M K 2CO 3 ph 9.0 Free Protein B synthetic peptide, KLH - Protein B synthetic peptide conjugate, OVA - Protein B synthetic peptide conjugate 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 μl / ml % NaCl 1%,. 100 ml Colloidal Gold conjugate 10, 10% BSA 0.1% 2. 10,000 g nm O.D. 10 conjugate buffer(50 mm Tris-HCl, ph 7.4, 5% BSA, 0.1% PEG). Protein A gold conjugate 40 nm Colloidal Gold BBI. 4) Assay strip Adhesive card(4cm 30cm, G&L Precision Die Cutting Inc. San Jose, CA, USA) nitrocellulose membrane(millipore 290 Concord Rd. Billerica, MA USA), absorbent pad(millipore 290 Concord Rd. Billerica, MA USA) (Free Protein B synthetic peptide, KLH - Protein B synthetic peptide conjugate, OVA - Protein B synthetic peptide conjugate) 1 mg / ml, 1.5 mg / ml, 2 mg / ml capture buffer(phosphate buffer, ph 7.4, 0.5% BSA, 3% Methanol) Matrix 1600 Reagent Dispenser(Kinematic Automation, P.O. Box 69, Twain Harte, CA 95383, USA) 1 μl / cm, 25% Humidity. (Control line) goat anti-mouse IgG(BBInternational Ltd Golden Gate ty Gals Avenue Cardiff, CF14 5DX, UK) 1 mg / ml. Strip Table 4. 5) Half test Strip half test. Fig well plate well 20 μl (loading buffer) + 20 μl (Free Protein B synthetic peptide, KLH - Protein B synthetic peptide conjugate, OVA - Protein B synthetic peptide conjugate, Protein A-gold conjugate) + 5 μl (serum meat juice) strip 5.
49 Table 4. Materials used for the strips Absorbent pad (AP26) Sample pad (AP31) Conjugate pad (#6613) Matter Cellulose High purity cotton Glass fiber and PE Size 30 cm 30 cm 20 cm 30 cm 29.5 cm 50 m Weight(g / m 2 ) thickness( mm ) Flow rate( mm / min) Pore size( μm ) 3-42 Fig. 8. The photograph showing the half test. 6) Prototype kit Sample pad 1% BSA, 0.5% Tween mm borate buffer(ph 7.4) 60., anti-(mouse IgG) coating nitrocellulose membrane adhesive card, sample pad, adsorption pad plastic housing prototype kit. prototype kit loading.
50 1) Table 5 peptide AntheProt SciProtein antigenic index, surface probability, hydrophilicity, flexible region peptide. proteosomal cleavage prediction, T-cell epitope prediction, homology. Table 5. List of antigenic protein candidates Peptide Origin Species Function Protein A Phyllomedusa sauvagei Frog Opioid peptide family Protein B Phyllomedusa sauvagei Frog Amphibian defense peptide Protein C Callinectes sapidus Crab Neuropeptide Protein D Periplaneta americana Cockroach Neuropeptide 2) peptide vector vector purification. Fig. 9 purification pet15b vector 0.8% agarose gel. pet15b vector 5,708 bp size vector (Fig. 4), vector Purification gel band 5,708 bp band vector purification. vector spectrophotometer (O.D 260 O.D 280 ) O.D 260 :O.D 280 ratio vector.
51 Lambda DNA Hin d III pet15b vector 23,130 bp 9,416 bp 6,557 bp 4,361 bp 5,708 bp 2,322 bp 2,027 bp Fig. 9. The result of electrophoresis for pet15b vector purified using QIAGEN R Maxi Kit. Plasmid pet15b vector annealing synthetic cdna vector restriction enzyme, 0.8% agarose gel digestion (Fig. 10). Fig. 10 enzyme digestion pet15b vector 2 band, pet15b vector double digestion. Peptide cloning vector, insert cdna annealing. Fig. 11 peptide sequence (Fig. 3) forward reverse nucleotide annealing, 12% non-denaturating polyacrylamide gel EtBr cdna. annealing cdna( 75 bp) annealing forward nucleotide( 60 bp) size band, annealing.
52 Lambda DNA Hin d III pet15b vector 23,130 bp 9,416 bp 6,557 bp 4,361 bp 2,322 bp 2,027 bp Fig. 10. The result of electrophoresis for a double digested pet15b vector. Restriction enzymes, BamH I and Nde I, were used to linearize the vector for cloning. 100 bp 75 bp 50 bp 25 bp A B C A : Size marker(25 / 100bp mixed DNA ladder) B : Forward nucleotide C : Annealed cdna Fig. 11. Annealed cdna band pattern compared with forward nucleotide.
53 double digested pet15b vector annealing cdna ligation, competent cell heat shock transformation colony liquid culture., peptide,. 2. 1) (Sprague-Dawley rat) Sprague-Dawley, Fig. 12. APM BSA,. 2 BSA APM,, BSA. Fig Stomacher ELISA test., 30 g saline 10 ml ELISA raw data dilution factor., 30 ~ 50%., 81,000 -,. kit.
54 g Initiation 1week 2week 3week 4week 5week 6week 7week Termination APM BSA Fig. 12. Changes in the body weight of Sprague-Dawley female rats actively immunized with either APM or BSA. Error bars are expressed as means ± S.E. Relative absorbance(%) reciprocal of antiserum dilution Non-immunized serum Antiserum Meat Juice Fig. 13. Reactivity of non-immunized serum, antiserum and meat juice against adipocyte plasma membrane proteins as detected by ELISA. The relative reactivity was expressed as percentage of the maximum optical density of antiserum. Error bars are expressed as means ± S.E. for 4 time repeats.
55 Relative absorbance(%) reciprocal of antiserum dilution Non-immunized serum Antiserum Meat Juice Fig. 14. Reactivity of non-immunized serum, antiserum and meat juice against bovine serum albumin as detected by ELISA. The relative reactivity was expressed as percentage of the maximum optical density of antiserum. Error bars are expressed as means ± S.E. for 4 time repeats. ELISA test, Western immunoblotting. ELISA test, Western immunoblotting primary antibody (1:1,000) (1:10,000) 10,. Fig. 15 A APM BSA polyacrylamide gel SDS-PAGE coomassie blue gel, Fig. 12 B C nitrocellulose membrane. SDS-PAGE -. membrane 10,, - ELISA test
56 . primary antibody, kit. kit. kda M.W APM BSA A kda M.W APM APM APM M.W BSA BSA BSA kda M.W APM APM APM M.W BSA BSA BSA B C Fig. 15. Western immunoblotting of adipocyte plasma membrane or bovine serum albumin proteins with antiserum(b) or meat juice(c) raised in rat. Anti-rat immunoglobulin G-Alkaline phosphatase conjugate(sigma Chemical, San Diego, USA) was used as a secondary antibody. (A) is SDS-PAGE pattern of proteins.
57 2) Fig. 16 A, B C peptide Table 2 titer titer ELISA test., 5 g saline 10 ml, homogenize ELISA raw data dilution factor., A, B, C peptide ( )., peptide., kit. Sheep A Relative absorbance(%) reciprocal of antiserum dilution Non-immunized serum Antiserum M eat juice Fig. 16. Reactivity of non-immunized serum, antiserum and meat juice in sheep against synthetic peptides as detected by ELISA. The relative reactivity was expressed as percentage of the maximum optical density of Sheep A antiserum. Error bars are expressed as means ± S.E. for 4 time repeats.
58 Sheep B Relative absorbance(%) reciprocal of antiserum dilution Non-immunized serum Antiserum M eat juice Fig. 16. Reactivity of non-immunized serum, antiserum and meat juice in sheep against synthetic peptides as detected by ELISA(continued). The relative reactivity was expressed as percentage of the maximum optical density of Sheep B antiserum. Error bars are expressed as means ± S.E. for 4 time repeats. Sheep C 140 Relative absorbance(%) reciprocal of antiserum dilution Non-immunized serum Antiserum Meat juice Fig. 16. Reactivity of non-immunized serum, antiserum and meat juice in sheep against synthetic peptides as detected by ELISA(continued). The relative reactivity was expressed as percentage of the maximum optical density of Sheep C antiserum. Error bars are expressed as means ± S.E. for 4 time repeats.
59 , 100 μg A 10 μg B, Nargi (1999) D-form, peptide peptide peptide (carrier protein, adjuvant ),. Fig. 17 affinity column fraction. 0.8 Elution p rofile of Sheep A Absorbance at 280 nm Fraction No. 1.8 Elution profile of Sheep B Absorbance at 280 nm Fraction No. Fig. 17. A elution profiles of antibodies against synthetic peptides using affinity column.
60 A fraction no. 4~8 purified Anti-sheep A IgG, B fraction no. 2~5 purified Anti-sheep B IgG. Anti-sheep IgG fraction no. SDS-PAGE band (Fig. 17), IgG heavy chain light chain size protein band affinity column purification. Fig primary antibody Fig. 16 ELISA test. Sheep A Relative absorbance(%) K 1 K 10 K 100 K 1,000 K 10,000 K 100,000 K Dilution factor Non-immunized serum Antiserum Non-immunized meat juice Meat Juice Fig. 18. Reactivity of non-immunized serum, antiserum and meat juices(non-immunized and immunized) in sheep against synthetic peptides depending on dilution ratio of primary antibody. The relative reactivity was expressed as percentage of the maximum optical density of Sheep A meat juice.
61 Sheep B Relative absorbance(%) K 1 K 10 K 100 K 1,000 K 10,000 K 100,000 K Dilution factor Non-immunized serum Non-immunized meat juice Antiserum Meat Juice Fig. 18. Reactivity of non-immunized serum, antiserum and meat juices(non-immunized and immunized) in sheep against synthetic peptides depending on dilution ratio of primary antibody(continued). The relative reactivity was expressed as percentage of the maximum optical density of Sheep B antiserum. Sheep C Relative absorbance(%) K 1 K 10 K 100 K 1,000 K 10,000 K 100,000 K Dilution factor Non-immunized serum Non-immunized meat juice Antiserum Meat Juice Fig. 18. Reactivity of non-immunized serum, antiserum and meat juices(non-immunized and immunized) in sheep against synthetic peptides depending on dilution ratio of primary antibody(continued). The relative reactivity was expressed as percentage of the maximum optical density of Sheep C non-immunized meat juice.
62 ELISA test, (1:100) -., kit kit. kit,,,. Fig sample, PBS homogenize ELISA test. 100 Relative absorbance(%) K 1 K 10 K 100 K 1,000 K 10,000 K 100,000 K Dilution factor Sheep A Homogenized meat juice Sheep A Thawed meat juice Sheep B Homogenized meat juice Sheep B Thawed meat juice Fig. 19. Comparison of antigen-specific affinity between two methods for the preparation of meat juice. The relative reactivity was expressed as percentage of the maximum optical density of Sheep A thawed meat juice.
63 100 ng / ml 96 well plate coating, well, 2 PBS homogenize -. kit, homogenize,. 2 - Fig ELISA test, well 1 2. Fig :500 1:2,000, 1:4,000 1:10, :1, Absorbance at 405nm ,000 4,000 6,000 8,000 10,000 Dilution factor Fig. 20. The result of ELISA to determine the optimal concentration of secondary antibody.
64 -, coating ELISA(Fig. 21) coating 10 ng / ml, 100 ng / ml. kit coating 10 ng / ml Absorbance at 405 nm E+00 1.E+01 1.E+02 1.E+03 1.E+04 1.E+05 1.E+06 Antigen Concentration(ug/ml) Anti-sheep A IgG Anti-sheep B IgG Sheep A meat juice Sheep B meat juice Fig. 21. The result of ELISA to determine the optimal concentration of antigen. Fig. 22 Western immunoblotting. Fig. 22 A C (non-immunized serum) Protein B synthetic peptide Western immunoblotting, membrane membrane carrier protein(ovalbumin, 45 kda).
65 Fig. 22. Western immunoblotting using synthetic peptides as an antigen and antiserum(a) and meat juice(b) as antibodies taken from sheep. Fig. 22 B biopsy Protein B synthetic peptide C membrane. ( ), ovalbumin peptide. A B membrane primary antibody Western immunoblotting (1:10,000),. membrane membrane, ELISA test titer. membrane(fig. 22-B).
66 ,. 3), -, primary antibody, secondary antibody.. Fig. 23 One-shoot ELISA test. primary antibody( ) 1:1,000. Fig. 23. Titers of antiserum raised against synthetic peptides in three Hanwoo(Korean Cattle) steers individuals immunized with antigen once.
67 peptide.,, One-shot. kit. adjuvant. Fig. 24 One-shoot (,, ). primary antibody( ) 1:1,000. Fig. 24. Titers of meat juice raised against synthetic peptides in three Hanwoo(Korean Cattle) steers individuals immunized with antigen once.
68 , Fig. 24, (Fore shank), (Loin) (Hind shank).,. ( ).,.,. Hanwoo C,. Hanwoo A Hanwoo B, Hanwoo C,.,. Fig ELISA test.. (0 day),. (day 28),, day 7.., kit,.
69 Relative absorbance(%) Fig. 25. Changes in the reactivity of antibodies in meat juice with synthetic peptides depending on storage period and muscle. Fig. 26 Boosting 1. primary antibody( ) 1:1,000. One-shot boosting Boosting (Fig. 26). immune response, boosting immunization. boosting immunization (3 weeks) 3 (Fig. 26). Fig. 27 Boosting (, ).
70 Relative absorbance(%) Boosting immunization Fig. 26. Changes in the reactivity of antiserum raised against synthetic peptides during immunization periods. The individuals were immunized twice, 0 and 3 weeks. Relative absorbance(%) Fig. 27. Changes in the reactivity of antibodies in meat juice of Hanwoo(Korean Cattle) steers of different muscle.
71 One-shot ELISA test primary antibody( ) 1:1,000, Boosting 12 1:1.000,. One-shot, (Neck Loin) (Top Round). Hanwoo A,. Substrate ( 20~30 ) 4, One-shot, One-shot (1:1,000), Fig. 18.,,, ( boosting immunization ). Fig. 28 One-shot dot-elisa. 1:1,000,, 1:1,000 1:100., One-shot Boosting, (1:00). Fig. 18 1:1,000,, adjuvant carrier protein,
72 kit. in vivo in vitro, blocking agent kit. A B C D E F A : Non-immunized serum B : Antiserum C : One-shot Hanwoo C loin non-immunized meat juice D : One-shot Hanwoo C loin meat juice E : Boosting Hanwoo A neck loin non-immunized meat juice F : Boosting Hanwoo A neck loin meat juice Fig. 28. Dot-ELISA results using synthetic peptides as antigens and antibodies in serum and meat juice of Hanwoo(Korean Cattle) steers.
73 3. rapid kit 1) 1 peptide, 7 (Hanwoo A, Hanwoo B, Hanwoo C, Hanwoo D, Hanwoo E, Hanwoo P, Hanwoo N). Table 3 1 mg 3 mg, 1 mg Hanwoo A one-shot, Hanwoo B 3 0.3mg boosting immunization. 3 mg Hanwoo C Hanwoo E one-shot 3mg 1, Hanwoo D boosting 0.9 mg boosting immunization, (one-shot 3, boosting ). 2 mg (Hanwoo P), (Hanwoo N). Adjuvant alum,, ELISA. Fig mg (Hanwoo C, Hanwoo D, Hanwoo E) 2 mg (Hanwoo P). 1 mg, Hanwoo B 3 mg, Hanwoo A. 1 mg 3 mg, 3 mg Hanwoo D 1 mg Hanwoo A. 1 ~ 3 mg, Hanwoo D,..
74 Titration of Meat Juice E E E E E E E-07 Hanwoo A Hanwoo B Hanwoo C Hanwoo D Hanwoo E Hanwoo P Hanwoo N Fig. 29. Antibody titration in immunized meat juice against the peptide conjugates differing in high-(hanwoo C, D, and E; 3 mg ) and low-(hanwoo A and B; 1 mg ) dosage injection. 2 Boosting primary injection(one-shot) boosting ELISA titer (Fig. 30). Titration of Meat Juice Absorbance E E E E-04 Dilutio n facto r 1.0E E-06 Hanw oo C Hanw oo E Hanw oo B Hanw oo D Hanw oo P Hanw oo N immu n iz ed se ru m Non-immunized serum Fig. 30. Antibody titration in immunized meat juice against the peptide conjugates differing in additional boosting(hanwoo B and D) or not(hanwoo C and E).
75 Fig. 30 boosting (Hanwoo B, Hanwoo D) (Hanwoo C, Hanwoo E). Boosting Hanwoo D, boosting boosting. 3 Alum FCA Adjuvant Adjuvant alum FCA(Freund's complete adjuvant), 5 (No. 1, No. 2, No. 3, No. 4, No. 5). alum, design Table 3, Fig. 31 ELISA titer. Fig. 31 alum adjuvant titer FCA adjuvant ELISA, alum FCA. alum FCA adjuvant (No. 4), alum FCA E-06 1E-07 Hanw oo P Hanw oo N Hanw oo E No.1 No.2 No.3 No.4 No.5 Fig. 31. Antibody titration in immunized meat juice against the peptide conjugates differing in adjuvant, alum(hanwoo E) and FCA(No.1, 2, 3, 4, and 5).
76 2) Rapid kit 1 Rapid kit strip Free peptide(protein B synthetic peptide) capture line coating. nitrocellulose membrane dot blot ELISA, Protein B synthetic peptide., carrier protein ovalbumin conjugation peptide(ova - Protein B synthetic peptide conjugate) capture line coating. rapid kit Fig. 32-A capture line OVA - Protein B synthetic peptide conjugate, detector OVA - Protein B synthetic peptide conjugate gold particle conjugate, strip coating. gold particle OVA - Protein B synthetic peptide conjugate conjugation gold particle steric hindrance. Fig. 32. Principles of the rapid kit manufacture.
77 rapid kit Fig. 32-B gold particle conjugation, Protein A. Protein A gold particle conjugation, steric hindrance. Protein A., Protein A anti-(cow IgG) gold particle conjugation. 2 Dot blot dot blot. ELISA Hanwoo E Hanwoo D. Fig. 33 nitrocellulose membrane peptide Row 1 ~ 3 binding, dot blot. 1/1000 Line A, binding signal, Line B. Hanwoo E Line C, 2 Line D Line C. ELISA Hanwoo D, 1/100 2 mg / ml binding row (Line E), 1/200 Line F Negative Control Line B.,. 3 strip - strip. Fig. 34-A 2, Fig. 34-B 4, Fig. 34-C 8, Fig. 34-D 16, Fig. 34-E 100, FCA (No. 1, No. 2, No. 3, No. 4, No. 5).
78 Row 1 : OVA - Protein B synthetic peptide, 2mg / ml Row 2 : OVA - Protein B synthetic peptide, 0.2mg / ml Row 3 : OVA - Protein B synthetic peptide, 0.02mg / ml Line Treatment Dilution Factor Line Treatment Dilution Factor A Antiserum 1:1000 B Hanwoo N 1:100 C Hanwoo E 1:100 D Hanwoo E 1:200 E Hanwoo D 1:100 F Hanwoo D 1:200 Fig. 33. The result of dot blot. Fig. 34-A, strip gold conjugate. Fig. 34-A-No 3 (control line)., 8 Fig. 34-C. Fig. 34-C.
79 Fig. 34. Determination of the optimum dilution factor of meat juice for application. The immunized meat juice was diluted to 1:2(A), 1:4(B), 1:8(C), 1:16(D), and 1:100(E) and applied to the immunochromaphy strips. No ELISA,.. (Fig. 34-E-Hanwoo P), ELISA 100, No. 4. alum adjuvant FCA ELISA, alum Hanwoo E FCA. Fig. 35. gold conjugate 8. No. 2 No. 3.. detergent loading buffer loading buffer rapid kit
80 sample pad sample conjugate pad. Fig. 35. Comparison of strips resulting from immunized meat juices differing in dilution factors for application. half test sample pad case prototype rapid kit test (Fig. 36). Test sample loading buffer(pbs ph 7.4, 10% Methanol, 0.1% SDS) 10.,. test,,. ELISA., rapid kit.., sample,,
81 .. A : Immunized meat juice B : Non-immunized meat juice C : Antiserum Fig. 36. Application of immunized meat juice to the developed immunochromatography strips.
항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보
Preparation Service AbFrontier Custom service 장점 실험 담당자와의 원활한 1:1 커뮤니케이션 (신속한 feedback을 통한 맞춤형 제작 서비스) 고객연구센터 - 개별 서비스의 진행 상황 및 결과 즉시 확인 http://center.abfrontier.com (e-mail & SMS 전송) 회원제 -연구자의 프로젝트 보안
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More information#Ȳ¿ë¼®
http://www.kbc.go.kr/ A B yk u δ = 2u k 1 = yk u = 0. 659 2nu k = 1 k k 1 n yk k Abstract Web Repertoire and Concentration Rate : Analysing Web Traffic Data Yong - Suk Hwang (Research
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information` Companies need to play various roles as the network of supply chain gradually expands. Companies are required to form a supply chain with outsourcing or partnerships since a company can not
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More informationPJTROHMPCJPS.hwp
제 출 문 농림수산식품부장관 귀하 본 보고서를 트위스트 휠 방식 폐비닐 수거기 개발 과제의 최종보고서로 제출 합니다. 2008년 4월 24일 주관연구기관명: 경 북 대 학 교 총괄연구책임자: 김 태 욱 연 구 원: 조 창 래 연 구 원: 배 석 경 연 구 원: 김 승 현 연 구 원: 신 동 호 연 구 원: 유 기 형 위탁연구기관명: 삼 생 공 업 위탁연구책임자:
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More information석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More information歯3이화진
http://www.kbc.go.kr/ Abstract Terrestrial Broadcasters Strategies in the Age of Digital Broadcasting Wha-Jin Lee The purpose of this research is firstly to investigate the
More information12È«±â¼±¿Ü339~370
http://www.kbc.go.kr/ k Si 2 i= 1 Abstract A Study on Establishment of Fair Trade Order in Terrestrial Broadcasting Ki - Sun Hong (Professor, Dept. of Journalism & Mass Communication,
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More information(Establishment and Management of Proteomics Core Facility)
(Establishment and Management of Proteomics Core Facility) 1 sample running on SDS-PAGE Gel (10well) 163570 10 16357 1D size marker 225500 100 2255 Buffer(20X, 500ml) 119900 20 5995 Staining
More information135 Jeong Ji-yeon 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 머리말 협저불상( 夾 紵 佛 像 )이라는 것은 불상을 제작하는 기법의 하나로써 삼베( 麻 ), 모시( 苧 ), 갈포( 葛 ) 등의 인피섬유( 靭 皮 纖 維 )와 칠( 漆 )을 주된 재료
MUNHWAJAE Korean Journal of Cultural Heritage Studies Vol. 47. No. 1, March 2014, pp.134~151. Copyright 2014, National Research Institute of Cultural Heritage 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 정지연 a 明 珍 素 也
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More informationDevelopment of culture technic for practical cultivation under structure in Gastrodia elate Blume
Development of culture technic for practical cultivation under structure in Gastrodia elate Blume 1996. : 1. 8 2. 1 1998. 12. : : ( ) : . 1998. 12 : : : : : : : : : : - 1 - .. 1.... 2.. 3.... 1..,,.,,
More information04-다시_고속철도61~80p
Approach for Value Improvement to Increase High-speed Railway Speed An effective way to develop a highly competitive system is to create a new market place that can create new values. Creating tools and
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More informationPierce-Plus-Alpha.pdf
Save 40% on antibodies Primary antibody 전제품 40% 할인가로만나보세요 Count on Invitrogen 42,000 antibodies highly validated primary and secondary antibodies in our portfolio and growing 4,500 primary conjugated antibodies
More information10송동수.hwp
종량제봉투의 불법유통 방지를 위한 폐기물관리법과 조례의 개선방안* 1) 송 동 수** 차 례 Ⅰ. 머리말 Ⅱ. 종량제봉투의 개요 Ⅲ. 종량제봉투의 불법유통사례 및 방지대책 Ⅳ. 폐기물관리법의 개선방안 Ⅴ. 지방자치단체 조례의 개선방안 Ⅵ. 결론 국문초록 1995년부터 쓰레기 종량제가 시행되면서 각 지방자치단체별로 쓰레기 종량제 봉투가 제작, 판매되기 시작하였는데,
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information<BCF6BDC3323030392D31385FB0EDBCD3B5B5B7CEC8DEB0D4C5B8BFEEB5B5C0D4B1B8BBF3BFACB1B85FB1C7BFB5C0CE2E687770>
... 수시연구 2009-18.. 고속도로 휴게타운 도입구상 연구 A Study on the Concept of Service Town at the Expressway Service Area... 권영인 임재경 이창운... 서 문 우리나라는 경제성장과 함께 도시화가 지속적으로 진행되어 지방 지역의 인구감소와 경기의 침체가 계속되고 있습니다. 정부의 다각 적인
More informationDBPIA-NURIMEDIA
Mass-production of Four Specific Proteins Originated from Deformed Wing Virus, Honeybee-viral Pathogen Joo-seong Lee, Giang Thi Huong Luong and Byoung-Su Yoon* Department of Life Science, College of Natural
More information2017.09 Vol.255 C O N T E N T S 02 06 26 58 63 78 99 104 116 120 122 M O N T H L Y P U B L I C F I N A N C E F O R U M 2 2017.9 3 4 2017.9 6 2017.9 7 8 2017.9 13 0 13 1,007 3 1,004 (100.0) (0.0) (100.0)
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information전용]
A Study of select the apropos processing mechanical method by the presume of transformation of teeth s surface degree ABSTRACT This study has been tried to select the apropos processing method by the
More informationCloning
Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군
More information한약재품질표준화연구사업단 작약 ( 芍藥 ) Paeoniae Radix 생약연구과
한약재품질표준화연구사업단 작약 ( 芍藥 ) Paeoniae Radix 생약연구과 - 2 - KP 11 CP 2015 JP 16 Paeoniae Radix Paeoniae Radix Alba Paeoniae Radix Rubra Paeoniae Radix Paeonia lactiflora Pallas paeoniflorin, albiflorin 2.3% Paeonia
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More information서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소
2012 년도기초과학연구소 대학중점연구소심포지엄 마이크로파센서를이용한 혈당측정연구 일시 : 2012 년 3 월 20 일 ( 화 ) 14:00~17:30 장소 : 서강대학교과학관 1010 호 주최 : 서강대학교기초과학연구소 Contents Program of Symposium 2 Non-invasive in vitro sensing of D-glucose in
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More informationDBPIA-NURIMEDIA
27(2), 2007, 96-121 S ij k i POP j a i SEXR j i AGER j i BEDDAT j ij i j S ij S ij POP j SEXR j AGER j BEDDAT j k i a i i i L ij = S ij - S ij ---------- S ij S ij = k i POP j a i SEXR j i AGER j i BEDDAT
More informationOutput file
240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 An Application for Calculation and Visualization of Narrative Relevance of Films Using Keyword Tags Choi Jin-Won (KAIST) Film making
More information현대패션의 로맨틱 이미지에 관한 연구
한지닥섬유제품의인체생리반응및쾌적성평가 임순 Evaluation of Thermal Physiological Responses and Comfort in Dox Fabric Soon Im Professor, Dept. of Fashion Industry, Incheon National University This study performed the evaluation
More information... 수시연구 국가물류비산정및추이분석 Korean Macroeconomic Logistics Costs in 권혁구ㆍ서상범...
... 수시연구 2013-01.. 2010 국가물류비산정및추이분석 Korean Macroeconomic Logistics Costs in 2010... 권혁구ㆍ서상범... 서문 원장 김경철 목차 표목차 그림목차 xi 요약 xii xiii xiv xv xvi 1 제 1 장 서론 2 3 4 제 2 장 국가물류비산정방법 5 6 7 8 9 10 11 12 13
More informationGEAR KOREA
GEAR Original Equipment Manufacturing Gears Support your various needs with our world class engineering skill and the newest manufacturing facilities. 1 2 Nissei creates high-quality high-precision gears
More information한약재품질표준화연구사업단 금은화 ( 金銀花 ) Lonicerae Flos 생약연구과
한약재품질표준화연구사업단 금은화 ( 金銀花 ) Lonicerae Flos 생약연구과 - 2 - KP 11 Lonicerae Flos Lonicera japonica Thunberg - CP 2015 JP 16 Lonicerae Japonicae Flos Lonicerae Folium Cum Caulis Lonicera japonica Thunberg - Lonicera
More information82-01.fm
w y wz 8«( 2y) 57~61, 2005 J. of the Korean Society for Environmental Analysis p w w Á Á w w» y l Analysis of Influence Factors and Corrosion Characteristics of Water-pipe in Potable Water System Jae Seong
More information11¹ÚÇý·É
Journal of Fashion Business Vol. 6, No. 5, pp.125~135(2002) The Present State of E-Business according to the Establishment Year and the Sales Approach of Dongdaemun Clothing Market Park, Hea-Ryung* and
More information기관고유연구사업결과보고
기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106
More informationOutput file
connect educational content with entertainment content and that production of various contents inducing educational motivation is important. Key words: edutainment, virtual world, fostering simulation
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More information음주측정을 위한 긴급강제채혈의 절차와 법리, A Study on the Urgent Compulsory Blood
음주측정을 위한 긴급강제채혈의 절차와 법리 A Study on the Urgent Compulsory Blood Collecting for Investigation of Driving while Intoxicated 양 동 철 * (Yang, Dong-Chul) < 차 례 > Ⅰ. 서론 Ⅱ. 체내신체검사와 긴급압수ㆍ수색ㆍ검증의 허용범위 Ⅲ. 긴급강제채혈의 허용범위와
More informationMicrosoft PowerPoint - ch03ysk2012.ppt [호환 모드]
전자회로 Ch3 iode Models and Circuits 김영석 충북대학교전자정보대학 2012.3.1 Email: kimys@cbu.ac.kr k Ch3-1 Ch3 iode Models and Circuits 3.1 Ideal iode 3.2 PN Junction as a iode 3.4 Large Signal and Small-Signal Operation
More information성공적인 Western Blot 을위한 Total Solution 기간 : 2013 년 4 월 22 일 ~ 6 월 14 일 Mini-PROTEAN Tetra & Power Supply 구매시, 전기영동 Plastic 소모품, Acrylamide/Bis Solution
성공적인 Western Blot 을위한 Total Solution 기간 : 2013 년 4 월 22 일 ~ 6 월 14 일 Mini-PROTEAN Tetra & Power Supply 구매시, 전기영동 Plastic 소모품, Acrylamide/Bis Solution TGX Gel 6 box 구매시, 전기영동장치 LaboGene tube 50 ml 1 box
More information한약재품질표준화연구사업단 강활 ( 羌活 ) Osterici seu Notopterygii Radix et Rhizoma 생약연구과
한약재품질표준화연구사업단 강활 ( 羌活 ) Osterici seu Notopterygii Radix et Rhizoma 생약연구과 - 2 - - 3 - KP 11 Osterici seu Notopterygii Radix et Rhizoma Ostericum koreanum Maximowicz, Notopterygium incisum Ting, Notopterygium
More informationIntroduction 신뢰성 있는 결과 높은 품질의 제품을 생산하기 위해서는 제품의 공정 시스템이 중요 품질관리실험실은 품질보증과정에서 매우 중요한 역할 분석시스템은 품질관리실험실의 매우 중요한 요소 분석시스템의 결과를 기본으로 하여 제품의 품질을 결정 R&D 실험실
적정의 올바른 분석방법 Kopack Seminar May 2012 Agenda Introduction Risks and Measures Summary 1 1 Introduction 신뢰성 있는 결과 높은 품질의 제품을 생산하기 위해서는 제품의 공정 시스템이 중요 품질관리실험실은 품질보증과정에서 매우 중요한 역할 분석시스템은 품질관리실험실의 매우 중요한 요소
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More information한약재품질표준화연구사업단 단삼 ( 丹參 ) Salviae Miltiorrhizae Radix 생약연구과
한약재품질표준화연구사업단 단삼 ( 丹參 ) Salviae Miltiorrhizae Radix 생약연구과 - 1 - KP 11 CP 2015 Salvia miltiorrhizae Radix Salviae Miltiorrhizae Radix et Rhizoma Salvia miltiorrhiza Bunge Salvia miltiorrhiza Bunge salvianolic
More informationÆ÷Àå½Ã¼³94š
Cho, Mun Jin (E-mail: mjcho@ex.co.kr) ABSTRACT PURPOSES : The performance of tack coat, commonly used for layer interface bonding, is affected by application rate and curing time. In this study, bonding
More informationMicrosoft PowerPoint - Chapter 3-2
Chapter 3 단백질의탐구및단백체학 (3) 겔거르기 (Gel filtration) chromatography: 크기에의한분리 - Resin: 다공성구슬 = Sephadex, Sepharose, Biogel = Bead size: 100 mm - 원리 : 분배 (partition) chromatograph = 분배 : 용질이이동상 (mobile phase)
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More information,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012). (2007) 26%., (,,, 2011;, 2006;
,,.. 400,,,,,,.,,, -, -, -., 3.. :, Tel : 010-9540-0640, E-mail : sunney05@hanmail.net ,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012).
More information09김정식.PDF
00-09 2000. 12 ,,,,.,.,.,,,,,,.,,..... . 1 1 7 2 9 1. 9 2. 13 3. 14 3 16 1. 16 2. 21 3. 39 4 43 1. 43 2. 52 3. 56 4. 66 5. 74 5 78 1. 78 2. 80 3. 86 6 88 90 Ex e cu t iv e Su m m a r y 92 < 3-1> 22 < 3-2>
More information<31325FB1E8B0E6BCBA2E687770>
88 / 한국전산유체공학회지 제15권, 제1호, pp.88-94, 2010. 3 관내 유동 해석을 위한 웹기반 자바 프로그램 개발 김 경 성, 1 박 종 천 *2 DEVELOPMENT OF WEB-BASED JAVA PROGRAM FOR NUMERICAL ANALYSIS OF PIPE FLOW K.S. Kim 1 and J.C. Park *2 In general,
More information12Á¶±ÔÈŁ
Journal of Fashion Business Vol. 5, No. 4. pp.158~175(2001) A Study on the Apparel Industry and the Clothing Culture of North Korea + Kyu Hwa Cho Prof., Dept. of Clothing & Textiles, Ewha Womans University
More information저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
More information44-3대지.08류주현c
A Comparative Study on the Commuting Regional Type According to the Features of Foreigner Commuting Ju-Hyun Ryu* Abstract The purposes of this study are to identify many implications of commuting regional
More information歯49손욱.PDF
2002 14 C Inventory An Estimation of 14 C Inventory on Each Unit of Wolsong NPP,,, 103-16 14 C 14 C Inventory 14 C Inventory 14 C 14 C, [Inventory] = [ 14 C ] - [ 14 C ] 14 C 14 C 13 C, 14 N 17 O [ 13
More information5
26 3 (2005 9 ) J Korean Oriental Med 2005;26(3):55-65 The Effcects of Psoraleae fructus Extract on Melanin Synthesis of B16 Melanoma Cells Jae-Ho Chung, Hyung-Sik Seo Dept. of Ophthamology, Otolaryngology
More informationWIDIN - Toolholding Catalogue.pdf
T CH CHUC UCK K 60 ER Strong Torque Power ER Chuck have strong torque power. Slim designed ER Nut were minimized an interruption to workpiece. If using Carbide Drill and coated drill, it can be improve
More information: : : : : : : : : : : : - 1 -
: : : : : : : : : : : : - 1 - Ⅰ Ⅱ Ⅲ - 2 - Ⅳ - 3 - Ⅴ - 4 - - 5 - - 6 - - 7 - - 8 - 제 1 장 연구개발과제의개요 μm mm cm cm - 9 - - 1 - - 11 - - 12 - - 13 - - 14 - 제 2 장 국내외기술개발현황 - 15 - - 16 - - 17 - - 18 - - 19 -
More information김도희_HT protein expression 표준 보고서_v1.5
Production of Recombinant Proteins For Further Information, Please Contact Neurogenex Co., Ltd. Biotechnology Incubating Center "Golden Helix" Seoul Natl' Univ. Seoul 151-744, Korea TEL 82-2-875-8998 FAX
More information<313630313032C6AFC1FD28B1C7C7F5C1DF292E687770>
양성자가속기연구센터 양성자가속기 개발 및 운영현황 DOI: 10.3938/PhiT.25.001 권혁중 김한성 Development and Operational Status of the Proton Linear Accelerator at the KOMAC Hyeok-Jung KWON and Han-Sung KIM A 100-MeV proton linear accelerator
More information- 2 -
- 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 - - 27 - - 28 - - 29 - - 30 -
More information국립국어원 20010-00-00 발간등록번호 00-000000-000000-00 국어정책 통계 조사 및 통계 연보 작성 연구책임자 이순영 제 출 문 국립국어원장 귀하 국어정책 통계 조사 및 통계 연보 작성 에 관하여 귀 원과 체결한 연 구 용역 계약에 의하여 연구 보고서를 작성하여 제출합니다. 2010년 12월 2일 연구책임자: 이순영(고려대학교 국어교육과)
More informationCrt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
More informationexample code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for
2003 Development of the Software Generation Method using Model Driven Software Engineering Tool,,,,, Hoon-Seon Chang, Jae-Cheon Jung, Jae-Hack Kim Hee-Hwan Han, Do-Yeon Kim, Young-Woo Chang Wang Sik, Moon
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: NCS : G * The Analy
Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.133-158 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.133 NCS : G * The Analysis of the Cognitive Level of Basic Job Skills of Specialized
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI: * Suggestions of Ways
Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp.65-89 DOI: http://dx.doi.org/10.21024/pnuedi.29.1.201903.65 * Suggestions of Ways to Improve Teaching Practicum Based on the Experiences
More information<BFA9BAD02DB0A1BBF3B1A4B0ED28C0CCBCF6B9FC2920B3BBC1F62E706466>
001 002 003 004 005 006 008 009 010 011 2010 013 I II III 014 IV V 2010 015 016 017 018 I. 019 020 021 022 023 024 025 026 027 028 029 030 031 032 033 034 035 036 037 038 039 040 III. 041 042 III. 043
More information슬라이드 제목 없음
물리화학 1 문제풀이 130403 김대형교수님 Chapter 1 Exercise (#1) A sample of 255 mg of neon occupies 3.00 dm 3 at 122K. Use the perfect gas law to calculate the pressure of the gas. Solution 1) The perfect gas law p
More information<C0C7B7CAC0C720BBE7C8B8C0FB20B1E2B4C9B0FA20BAAFC8AD5FC0CCC7F6BCDB2E687770>
ꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚ ꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏ 儀 禮 의 社 會 的 機 能 과 變 化 李 顯 松 裵 花 玉 ꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏ ꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚ
More information(....).hwp
연구기관 한국식품연구원 농림부 연구기관 한국식품연구원 농림부 Analytical Semi-preparative Solution A 1) Solution B 2) Mixing Spreading Coating medium Corona treated OPP 3) film Casting Drying
More information<28BCF6BDC320323031352D31332920B0E6B1E2B5B520C1F6BFAABAB020BFA9BCBAC0CFC0DAB8AE20C1A4C3A520C3DFC1F8C0FCB7AB5FC3D6C1BE2830312E3036292E687770>
수시과제 2015-13 경기도 지역별 여성일자리 정책 추진 전략 연구책임자 : 최 윤 선 (본원선임연구위원) : 남 승 연 (본원연구위원) 연 구 지 원 : 이 상 아 (본원위촉연구원) 연 구 기 간 : 2015. 9 ~12 2015 발 간 사 여성 일자리는 사회 내 여성과 남성간의 차이를 좁히고 개개인의 삶을 윤택하게 만드는 중요 한 부분입니다. 이에 정부는
More information1. 서론 1-1 연구 배경과 목적 1-2 연구 방법과 범위 2. 클라우드 게임 서비스 2-1 클라우드 게임 서비스의 정의 2-2 클라우드 게임 서비스의 특징 2-3 클라우드 게임 서비스의 시장 현황 2-4 클라우드 게임 서비스 사례 연구 2-5 클라우드 게임 서비스에
IPTV 기반의 클라우드 게임 서비스의 사용성 평가 - C-Games와 Wiz Game 비교 중심으로 - Evaluation on the Usability of IPTV-Based Cloud Game Service - Focus on the comparison between C-Games and Wiz Game - 주 저 자 : 이용우 (Lee, Yong Woo)
More information1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
More information사용시 기본적인 주의사항 경고 : 전기 기구를 사용할 때는 다음의 기본적인 주의 사항을 반드시 유의하여야 합니다..제품을 사용하기 전에 반드시 사용법을 정독하십시오. 2.물과 가까운 곳, 욕실이나 부엌 그리고 수영장 같은 곳에서 제품을 사용하지 마십시오. 3.이 제품은
OPERATING INSTRUCTIONS OPERATING INSTRUCTIONS 사용자설명서 TourBus 0 & TourBus 5 사용시 기본적인 주의사항 경고 : 전기 기구를 사용할 때는 다음의 기본적인 주의 사항을 반드시 유의하여야 합니다..제품을 사용하기 전에 반드시 사용법을 정독하십시오. 2.물과 가까운 곳, 욕실이나 부엌 그리고 수영장 같은 곳에서
More information슬라이드 1
CJ 2007 CONTENTS 2006 CJ IR Presentation Overview 4 Non-performing Asset Company Profile Vision & Mission 4 4 - & 4-4 - & 4 - - - - ROE / EPS - - DreamWorks Animation Net Asset Value (NAV) Disclaimer IR
More information<32382DC3BBB0A2C0E5BED6C0DA2E687770>
논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학
More informationhttp://www.kbc.go.kr/pds/2.html Abstract Exploring the Relationship Between the Traditional Media Use and the Internet Use Mee-Eun Kang This study examines the relationship between
More information한약재품질표준화연구사업단 고삼 ( 苦參 ) Sophorae Radix 생약연구과
한약재품질표준화연구사업단 고삼 ( 苦參 ) Sophorae Radix 생약연구과 - 1 - KP 11 Sophorae Radix Sophora flavescens Solander ex Aiton oxymatrine, matrine 1.0% CP 2015 Sophorae Flavescentis Radix Sophora flavescens Aiton - JP 16
More informationhttp://www.kbc.go.kr/ Abstract Competition and Concentration in the Market for the Multichannel Video Programming G h e e - Young Noh ( P r o f e s s o, rschool of Communication,
More information3월 온라인 교육
2013 년 2 분기대리점집체교육 - Protein - Takara Korea Biomedical Protein Workflow Chapter 1: 샘플준비 Chapter 2: Electrophoresis -Precast gel (Lonza/NuSep) -ProSieve EX running buffer -Protein marker Chapter 3: Staining
More information<35BFCFBCBA2E687770>
주요개념 : 컴퓨터음란물 접촉자, 성지식, 성태도 남자중학생의 컴퓨터음란물 접촉자와 비접촉자간의 성지식과 태도의 차이 김 영 혜* 이 화 자** 정 향 미*** 1. 연구의 필요성 한국은 I. 서 론 1960 년대 이후부터 시작된 돌진적 산업화 ( 한 상진, 1996) 로 인하여 경제적 부흥을 이루어 집집마다 TV 수상기를 가질 수 있게 되었고 최근에는 PC보급율
More information00약제부봄호c03逞풚
경희대학교 동서신의학병원 약품 정보지 2 0 0 7. S P R I N G. V O L. 0 1 신약 소개 02 Journal Review 03 Special Subject 04 복약 지도 06 의약품 안전성 정보 07 약제부 알림 07 약제부 업무 소개 08 E A S T - W E S T N E O M E D I C A L C E N T E R 본 약품
More information이 발명을 지원한 국가연구개발사업 과제고유번호 G1111700300320000000000000 부처명 한국환경산업기술원 연구사업명 토양지하수오염방지기술개발사업 연구과제명 시데로포아(Siderophore)의 대량생산을 통한 토양 및 지하수의 친환경 중금속 제거기술 개 발
(19) 대한민국특허청(KR) (12) 공개특허공보(A) (11) 공개번호 10-2013-0029213 (43) 공개일자 2013년03월22일 (51) 국제특허분류(Int. Cl.) C12N 1/15 (2006.01) C12P 21/00 (2006.01) C12R 1/77 (2006.01) (21) 출원번호 10-2011-0092470 (22) 출원일자 2011년09월14일
More informationTitle: Biacore getting started kit 를이용한 KD 값도출방법 목차 1. 실험목적 2. 실험개요와필요한시약및소모품 2.1 실험개요 2.2 필요한시약및소모품 3. 실험방법과결과 3.1 ph-scouting for pre-concentration
Title: Biacore getting started kit 를이용한 KD 값도출방법 목차 1. 실험목적 2. 실험개요와필요한시약및소모품 2.1 실험개요 2.2 필요한시약및소모품 3. 실험방법과결과 3.1 ph-scouting for pre-concentration 3.2 Immobilization 3.3 Regeneration scouting 3.4 Interaction
More information<313120B9DABFB5B1B82E687770>
한국민족문화 40, 2011. 7, 347~388쪽 1)중화학공업화선언과 1973년 공업교육제도 변화* 2)박 영 구** 1. 머리말 2. 1973년, 중화학공업화선언과 과학기술인력의 부족 3. 1973년 전반기의 교육제도 개편과 정비 1) 계획과 개편 2) 기술교육 개선안과 인력개발 시책 4. 1973년 후반기의 개편과 정비 5. 정비된 정규교육제도의 특징
More information°í¼®ÁÖ Ãâ·Â
Performance Optimization of SCTP in Wireless Internet Environments The existing works on Stream Control Transmission Protocol (SCTP) was focused on the fixed network environment. However, the number of
More informationStatistical Data of Dementia.
Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.
More information저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
More information204 205
-Road Traffic Crime and Emergency Evacuation - 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 Abstract Road Traffic Crime
More information<B9CCB5F0BEEEB0E6C1A6BFCDB9AEC8AD5F31322D32C8A35FBABBB9AE5FC3CAC6C731BCE25F6F6B5F32303134303531362E687770>
미디어 경제와 문화 2014년 제12권 2호, 7 43 www.jomec.com TV광고 시청률 예측방법 비교연구 프로그램의 장르 구분에 따른 차이를 중심으로 1)2) 이인성* 단국대학교 커뮤니케이션학과 박사과정 박현수** 단국대학교 커뮤니케이션학부 교수 본 연구는 TV프로그램의 장르에 따라 광고시청률 예측모형들의 정확도를 비교하고 자 하였다. 본 연구에서
More information