<30372D28C0CFB9DD29C1B6B0ADC8F15F D E687770>
|
|
- 다현 마
- 5 years ago
- Views:
Transcription
1 J Plant Biotechnol (2015) 42:43 48 DOI: ISSN Research Article 전라남도지역감바이로이드의감염상황및무병화효율연구 김대현 김인수 이건섭 조인숙 조강희 신일섭 김세희 천재안 최인명 Current occurrence of persimmon viroid and citrus viroid in persimmon in JellaNam-do and testing for viroid inactivation methods Dae Hyun Kim In-Soo Kim Gunsup Lee In-Sook Cho Kang Hee Cho Il Sheob Shin Se Hee Kim Jae An Chun In-Myung Choi Received: 9 March 2015 / Revised: 20 March 2015 / Accepted: 20 March 2015 c Korean Society for Plant Biotechnology Abstract It is a serious situation that the farmers' income has gradually decreased due to the decline of productivity of fruit trees infected with viroids. It has been known that Persimmon viroid (PVd) and Citrus viroid (CVd) are economically important viroids that can infected persimmon. In this study, the incidence of CVd and PVd in Fuyu persimmon were identified as 41% and 34% in JeollaNam-do, respectively. The collected persimmon samples infected by both PVd and CVd were used for testing efficiency of the viroid inactivation methods. The samples were subjected to single treatment of the heat treatment (37 C), cold treatment (4 C), or antiviral agent treatment (Ribavirin), and double treatment of combinations of the three methods. Viroid inactivation efficiency was confirmed through RT-PCR. In the case of the samples subjected to cold treatment for 4 weeks, the viroid inactivation efficiency was most significantly high as 67% against the survival rate of 100%. In addition, in the case of the samples treated for 2 weeks with the antiviral agents and cold D. H. Kim I.-S. Kim G. S. Lee K. H. Cho ( ) S. H. Kim J. A. Chun I.-M. Choi 농촌진흥청국립원예특작과학원과수과 (Fruit Research Division, National Institute of Horticultural and Herbal Science, RDA, Wanju , Korea) khc7027@korea.kr I.-S. Cho 농촌진흥청국립원예특작과학원원예특작환경과 (Horticultural and Herbal Crop Environment Division, National Institute of Horticultural and Herbal Science, RDA, Wanju , Korea) I. S. Shin 농촌진흥청국립원예특작과학원배연구소 (Pear Research Institute, National Institute of Horticultural and Herbal Science, RDA, Naju , Korea) treatment, the viroid inactivation rate was similar to that of the cold treatment. In conclusion, the cold treatment showed the highest viroid inactivation efficiency, and this result will provide valuable information for production of viroid-free persimmon. Keywords Antiviral agents, Citrus viroid, Cold treatment, Heat treatment, Persimmon viroid 서론 감은매우중요한과수작물중하나로농림축산식품부통계자료에따르면 2000 년대에들어전체감생산면적은약 3.1 만 ha, 생산량은 28 만톤으로전세계적으로중국에이어두번째로많이재배되고있다. 그러나감의병해충연구특히, 바이러스및바이로이드에관한연구는거의이루어지지않고있다. 감에감염되는대표적인바이로이드는 persimmon viroid(pvd) 와 citrus viroid(cvd) 등이존재하는것으로알려져있다 (Ito et al. 2013; Nakaune and Nakano 2008). 일반적으로알려진감바이로이드증상은잎에검은반점및얼룩이생성되거나과실의괴사반점, 줄기및가지의검은색얼룩등이있으나아직까지는이러한증상에의한피해가어느정도인지구체적인자료가없는실정이다 (Morton 1987). 사과에감염이가능한바이로이드인 ASSVd(Apple Scar Skin Viroid) 의경우과피얼룩반점및코르크화반점등의증상을유발하며, 수확기에과피전체의 50% 이상이노란색반점들로덮여착색이불균일하고정상과에비해크기가작아지는등상품성을잃는것으로보고되었다 (Kim et al. 2010). 감또한
2 44 J Plant Biotechnol (2015) 42:43 48 과실에바이로이드에의한증상이보고되고있는만큼근본적인감염률조사및바이로이드무병묘생산연구가반드시수행되어야할것으로판단된다. 과수에서바이러스및바이로이드를제거하고무병묘를생산하는연구는매우다양한방법으로수행되었다. 무병묘를생산하는방법은 38 C 로일정기간동안처리하는열처리요법 (Thermotherapy) 과 4 C 로일정기간처리하는한냉요법 (Coldtherapy), 그리고 ribavirin 과같은항바이러스제를처리하는화학적인요법 (Chemotherapy) 등으로나뉠수있다 (Feng et al. 2013; Hollings 1965; Paduch-Cichal and Kryczynski 1987; Savitri et al. 2013). Campbell(1962) 은 Virginia Crab, Spy 227, Malus platycarpa 등이열처리와경정배양에의해바이러스가제거됨을확인하였다. Paprstein 등 (2008) 은사과품종인 Idared 와 Sampion 을이용하여열처리를통해실험한결과 Idared 는바이러스가제거되었지만 Sampion 는제거되지않았다. 따라서품종에따라무병화함에있어서처리방법에차이가있음을보여주었다. Paduch-Cichal 과 Kryczynski(1987) 는한냉처리에의해 PSTVd(Potato Spindle tuber viroid) 의제거효과를보여주었으며, Hansen 과 Lane(1985) 은 Malus pumila Mill 사과에항바이러스제 (ribavirin) 를 10, 20, 40, 그리고 80 μm 농도로처리함으로써온실과과수원에식재되어있는사과신초에서 ACLSV(Apple Chlorotic Leaf Spot Virus) 제거효과를확인하였다. 또한국립원예특작과학원에서 Citrus tristeza virus, Satsuma dwarf virus, Citrus tatter leaf virus 에감염된감귤품종을이용하여열처리와경정접목 (shoot-tip grafting) 방법에의해서감귤무병화를수행한바있으며 (Kim et al. 2005), 사과에서도 Apple chlorotic leaf spot virus, Apple stem grooving virus, Apple mosaic virus 와 Apple scar skin viroid 에대해열처리및경정배양에의한무병화신품종을확보하였다 (Lee et al. 2013). 본연구에서는전라남도지역단감재배농가에서수집한부유품종을이용하여바이로이드감염현황을파악하였고, 확보된 CVd 와 PVd 가동시에감염된감식물체의무병화를수행하였다. 또한바이로이드감염이확인된감식물체를이용하여열처리, 한냉처리및항바이러스제처리를통하여무병화효율실험을수행하였다. 재료및방법 시험재료 감바이로이드감염률을조사하기위해전라남도 5 지역 ( 나주, 영암, 담양, 순천, 구례 ) 의 20 농가를선정하였다. 시료는바이로이드진단효율을높이기위하여 6 월에 198 개체의단감부유품종의신초부위에서잎을채취하여실험에이용하였다 (Fig. 1). Fig. 1 Sampling locations in Jeollanam-do and representative symptoms appeared in persimmon infected by citrus viroid and persimmon viroid. A. Locations 1: Naju, 2: Yeongam, 3: Damyang, 4: Suncheon, 5 Gurye B. Viroid symptom in fruit. C. Viroid symptom in leaf
3 J Plant Biotechnol (2015) 42: Table 1 Primer pairs used for detection of persimmon-infecting viroids a and expected sizes of RT-PCR products Target Primer Sequence (5' 3') PCR product (bp) Originated accession No. Upstream CGACAGGTGAGTCTCCTTGC CVd b Downstream TCGTCGACGAAGGCATGTGA 336 AB Upstream CGGCAGGGAGCCTTGCGAAC PVd c Downstream AGCTCGGGGCTGGAGCTTGG 396 NC_ Upstream CGCATCATTCAAATTTCTGC 18S d Downstream TTCAGCCTTGCGACCATACT 843 DQ a The primers for each viroid were designed as species-specific. b CVd: Citrus viroid. c PVd: Persimmon viroid. d 18S: 18s ribosomal RNA. RNA 분리및 RT-PCR 을통한바이로이드진단 채취한단감의신초를이용하여바이로이드진단을위해 CTAB 방법을통해 total RNA 를분리하였다 (Gambino et al. 2008). 확보된 total RNA 는 M-MLV reverse transcriptase (Invitrogen, Carlsbad, CA, USA) 를이용해 cdna 를합성하였으며, Table 1 에언급한프라이머를이용하여 PCR 을수행하였다. CVd 진단의경우 PCR 증폭은총 20 μl 의반응액에 cdna 50 ng, 1 PCR buffer, 250 μm dntps, 1.5 units Ex Taq DNA polymerase(takara, Tokyo, Japan) 를혼합하여수행하였고반응조건은 94 C 에서 40 초, 60 C 에서 40 초그리고 72 C 에서 40 초씩각각 35 회반복하였다. PVd 의경우는위의조건에 extension 시간을 20 초단축하여진단하였다. 또한 total RNA 및 cdna 가완전히합성이확인하기위해 18s 유전자를이용하여 65 C 의 annealing 온도로 PCR 을수행하였다. 경정배양과기내도입 바이로이드진단후무병화효율을확인하기위해 2 종류의바이로이드가모두감염된감시료를이용하여경정배양을통해기내도입을수행하였다. 신초의생장점부위를약 5 mm 크기로잘라내어기내도입배지에치상하였다. 기내도입배지의조성은 MS 배지 1 L 에 BA 2 mg, sucrose 30 g, plant agar 8g 을첨가하여 ph 5.8 로조정한후사용하였다. 약 4 주동안기내도입배지에서경정배양후잎과신초가생성되면바이로이드감염묘를증식배지에옮겼다. 증식배지는 MS 배지 1 L 에 BA 1 mg, IBA 0.3 mg, GA mg, sucrose 30 g, plant agar 8 g 을첨가하였으며, ph 는기내도입배지와같이 5.8 로조정한후사용하였다. 또한 RNA 추출및 RT-PCR 을통해감염여부를확인하였다. 열처리, 한냉처리및항바이러스제처리에의한무병화효율실험 CVd 및 PVd 감염이확인된감부유품종을이용하여열 처리, 한냉처리및항바이러스제처리에의한방법을통하여무병화효율실험을수행하였다. 5 cm 길이로배양된감신초를이용하여각그룹별 9 개의개체를확보하여실험하였다. 열처리와한냉처리는각각 38 C 와 4 C 가유지되는항온항습장치에서처리하였으며항바이러스제처리군은 ribavirin 을배지에 20 ppm 과 40 ppm 의농도로첨가하여 28 C 에서처리하였다. 또한열처리와항바이러스제를복합적으로처리한그룹과한냉처리와항바이러스제를복합처리한그룹으로나누어처리하였으며, 처리기간은각각 2 주, 4 주, 8 주였다. 각시기및처리별그룹들은생장점배양과기내증식을통해증식하였고약 8 주후에 RNA 추출과 RT-PCR 을이용하여바이러스진단을하였다. 결과및고찰 바이로이드감염상황 전라남도지역에서수집한단감 198 개체의바이로이드진단은 RT-PCR 을이용하였다. CVd 는나주지역에서수집한 10 개체중 8 개체가감염됨에따라 80% 의높은감염 Table 2 Incidence of Persimmon viroid (PVd) and Citrus viroid (CVd) on persimmon in Jeollanam-do Region Viroid infection rate (%) CVd a PVd b CVd+PVd Naju 8/10 (80%) 1/10 (10%) 1/10 (10%) Yeongam 26/38 (68%) 7/38 (18%) 5/38 (13%) Damyang 20/50 (40%) 10/50 (20%) 7/50 (14%) Suncheon 22/50 (44%) 30/50 (60%) 17/50 (34%) Gurye 5/50 (10%) 19/50 (38%) 3/50 (6%) In Total 81/198 (41%) 67/198 (34%) 33/198 (17%) a CVd: Citrus viroid. b PVd: Persimmon viroid.
4 46 J Plant Biotechnol (2015) 42:43 48 률을보였고, 영암은 38 개체중 26 개체 (68%), 담양은 50 개체중 20 개체 (40%), 순천은 50 개체중 22 개체 (44%), 마지막으로구례는 50 개체중 5 개체로 10% 의가장낮은감염률을나타냈다. PVd 의경우나주지역은 10% 의감염률을나타냈고, 영암 18%, 담양 20%, 순천 60%, 구례지역은 38% 의감염률을확인할수있었다. 두종류의바이로이드가복합적으로감염되어있는경우는나주 10%, 영암 13%, 담양 14%, 순천 34%, 구례 6% 로확인되었다 (Table 2). 농촌진흥청의 2013 년보고서에의하면경상남도의경우총 227 개체의단감을확인한결과 CVd 는 7.1%, PVd 는 1.7% 의감염률을보고하였으나, 전라남도의경우높은바이로이드감염률을나타냈다. 이는접수를이용해증식되는과수의특성상지역적으로편중되는현상이관찰되는것으로판단되었다. 바이로이드진단결과를기준으로하여과실및잎에서바이로이드증상을확인해본결과검은반점의증상및잎이말리는바이로이드의심증상을관찰할수있었다 (Fig. 1B, 1C). Morton(1987) 은감바이로이드증상으로잎에검은반점이나타나거나과살에괴사반점이발생하는것을보고한바있다. 따라서, 본연구에서관찰된병징은바이로이드증상으로파악하고있으나금후정확한감바이로이드관련증상연구를수행할예정이다. 단감의무병화효율 두종류의바이로이드에대해복합감염된감을경정배양하였고바이로이드진단결과기내증식된감식물체는 Fig. 2 Detection of citrus viroid and persimmon viroid in persimmon PVd and CVd were detected by RT-PCR method in persimmon plants. N: negative, PVd: Persimmon viroid, CVd: Citrus viroid Fig. 3 In vitro propagation of viroid-infected persimmon and treatments of thermotherapy, cold therapy and chemotherapy. A: In vitro culture, B: 2 weeks treated group shoot tip culture, C: 4 weeks treated group shoot tip culture, D: 8 weeks treated group shoot tip culture, E: Subculture of treated persimmon
5 J Plant Biotechnol (2015) 42: 바이로이드에대해모두감염되어있었다 (Fig. 2). CVd 및 PVd 가감염된기내배양감을이용하여무병화효율실험을수행하였다 (Fig. 3). 감무병화묘목을생산하기위해서열처리및한냉처리그리고항바이러스제처리를하는단독처리군과열처리와항바이러스제동시처리군및한냉처리와항바이러스제처리를동시에한복합처리군으로나누어각각의무병화효율을조사하였다. 각각의처리에따른감의생존율은열처리의경우 2 주처리군에서 9 개체중 9 개체모두생존하였지만 4 주및 8 주에서는생존율이 78% 와 44% 로점차낮아졌다. 한냉처리의경우 2 주와 4 주의경우 100% 의생존율을보였으나 8 주처리군에서는생존율이 33% 로급격히저하됨을알수있었다. 항바이러스제 (ribavirin) 의경우는감생존율에큰영향을보여주지않아각처리별생존율에있어서는항바이러스제처리가가장좋은것으로판단되었다. 복합처리의경우단독처리보다처리기간이증가함에따라생존율이감소하는현상이뚜렸하였으며 40 ppm 의항바이러스제와복합처리군의경우는 4 주에서도 44% 와 33% 의낮은생존율을보였고, 특히 8 주차의경우는 33% 이하의낮은생존율을확인할수있었다. 바이로이드제거효율에있어서는단독처리군의경우한냉 4 주차의결과가생존율에있어서 100% 결과를나타냈고바이로이드제거효율도 67% 로가장높은무병화효율을보여주었다 (Table 3). 열처리의경우 71% 의무병화효율을확인하였으나생존율이낮아확보한무병화개체수는한냉처리에비해적었다. Paduch-Cichal 과 Kryczynski (1987) 는국화의 potato spindle tuber viroid 가저온처리에의해효과적으로제거됨을보고하였으며, 본결과에서도바이로이드제거효율에있어서는열처리군에비해한냉처리가무병화효율이높음을알수있었다. 복합처리군의경우, 열처리와항바이러스제 40 ppm 농도로 8 주간처리한군과한냉처리와항바이러스제를 40 ppm 농도 로 8 주간처리한군에서 100% 의바이로이드제거효율을보여주었으나생존율이 11% 와 33% 로매우낮았고, 결론적으로확보된무병개체수가적었다. 열처리와항바이러스제를 20 ppm 농도로 4 주간처리한군에서도 71% 의무병화효율을보였으나최종적인 6 개체의무병묘가획득된처리는한냉처리와항바이러스제를 40 ppm 농로로 2 주간처리한군이었다 (Table 3). El-Dougdoug et al. (2010) 은단독처리에의한방법이외에도한냉처리와항바이러스제복합처리에의해효과적인무병화방법을보고하였다. Hop stunt viroid 를제거하기위해단독처리의경우항바이러스제처리가가장효과적임을확인하였으며복합처리의경우는한냉처리와항바이러스제처리를같이하였을경우생존률이높아지고무병화효율또한높아짐을보고하였다. 본결과에서는단독처리의경우한냉처리가가장좋은효과를보여주었지만복합처리의경우위논문과유사한결과를도출하였다. 결론적으로한냉처리만으로는약 4 주간처리한군에서 67% 의항바이러스제거효율을보여주었으나한냉처리에항바이러스제를복합처리한군의경우시간을단축시켜 2 주간의처리만으로도효과적으로바이로이드를제거할수있을것으로판단할수있었다. 적요 바이로이드에감염된과수의생산성하락으로인한농업인의소득이점점감소하고있는실정이다. 감에감염이가능한바이로이드는 PVd(Persimmon viroid) 와 CVd(Citrus viroid) 등이존재하는것으로알려져있다. 따라서본연구에서는전라남도감재배농가에서의감바이로이드감염현황을확인하였고열처리, 한냉처리, 항바이러스 Table 3 The percentage of survival rate and viroid inactivation efficiency upon thermotherapy, cold-therapy and chemotherapy Ribavirin 37 + Ribavirin 4 + Ribavirin Group Shoot survival rate a Viroid inactivation efficiency b 2 weeks 4 weeks 8 weeks 2 weeks 4 weeks 8 weeks % (9/9) 78% (7/9) 44% (4/9) 44% (4/9) 71% (5/7) 50% (2/4) 4 100% (9/9) 100% (9/9) 33% (3/9) 33% (3/9) 67% (6/9) 67% (2/3) 20 ppm 100% (9/9) 100% (9/9) 100% (9/9) 33% (3/9) 33% (3/9) 33% (3/9) 40 ppm 100% (9/9) 100% (9/9) 89% (8/9) 44% (4/9) 55% (5/9) 50% (4/8) 20 ppm 89% (8/9) 78% (7/9) 33% (3/9) 38% (3/8) 71% (5/7) 0% (0/3) 40 ppm 89% (8/9) 44% (4/9) 11% (1/9) 63% (5/8) 25% (1/4) 100% (1/1) 20 ppm 89% (8/9) 100% (9/9) 33% (3/9) 38% (3/8) 44% (4/9) 33% (1/3) 40 ppm 100% (9/9) 33% (3/9) 33% (3/9) 67% (6/9) 67% (2/3) 100% (3/3) Virus infection was evaluated by RT-PCR. a The number in parentheses refers to numbers of survival plant /numbers of total plants b The number in parentheses refers to numbers of viroid free plant /numbers of survival plants
6 48 J Plant Biotechnol (2015) 42:43 48 제처리를통해무병화효율성을알아보았다. 전라남도나주, 영암, 담양, 순천, 구례의 20 농가에서감부유품종 198 개체를샘플링하였다. RT-PCR 실험을통해감바이로이드의감염률을확인해본결과 CVd 41%, PVd 34% 로확인되었으며이미알려진수준에비해높게감염되어있음을알수있었다. 무병화효율실험은 PVd 와 CVd 가감염된감을이용하였으며처리방법에따라열처리 (38 C), 한냉처리 (4 C), 항바이러스제 (Ribavirin) 단독처리그룹과열처리와항바이러스제를동시에처리한그룹및한냉처리및항바이러스제를동시에처리한그룹으로나누었으며처리시간에따라 2 주와 4 주로나누어각각의바이로이드제거효율을확인하였다. 한냉처리한그룹의경우생존율이 100% 에무병화효율또한 67% 의높은제거효율을확인할수있었고, 한냉처리와항바이러스제를 2 주간복합처리한군에서도 67% 의높은효율을확인하였다. 결론적으로한냉처리가가장높은무병화율을보여주었으며본연구결과를통해감무병화연구에좋은자료가될것으로판단된다. 사사 본연구는 2015 년농촌진흥청국립원예특작과학원의기관고유사업 ( 과제번호 : PJ ) 의지원에의해수행되었음. Reference Campbell AI (1962) Apple virus inactivation by heat therapy and tip propagation. Nature 195 : 520 El-Dougdoug KA, Osman M, Abdelkader HS, Dawoud RA (2010) Elimination of Hop stunt viroid (HSVd) from infected peach and pear plants using cold therapy and chemotherapy. Aust. J. Basic Appl. Sci. 4 : Feng C, Wang R, Li J, Wang B, Yin Z, Cui Z, Li B, Bi W, Zhang Z, Li M, Wang Q (2013) Production of pathogen-free horticultural crops by cryotherapy of in vitro-grown shoot tips. Methods Mol. Biol. 994 : Gambino G, Perrone I, Gribaudo I (2008) A Rapid and effective method for RNA extraction from different tissues of grapevine and other woody plants. Phytochem. Anal. 19 : Hansen A and Lane W (1985) Elimination of apple chlorotic leaf spot virus from apple shoot cultures by ribavirin. Plant Dis. 69 : Hollings M (1965) Disease control through virus-free stock. Annu. Rev. Phytopathol. 3 : Ito T, Suzaki K, Nakano M (2013) Genetic characterization of novel putative rhabdovirus and dsrna virus from Japanese persimmon. J. Gene. Virol. 94 : Kim DH, Kim HR, Heo S, Kim SH, Kim MA, Shin IS, Kim JH, Cho KH, Hwang JH (2010) Occurrence of Apple scar skin viroid and relative quantity analysis using Real-time RT-PCR. Res. Plant Dis. 16 : Kim DH, Shim HK, Kwon HM, Hyun JW, Kim KS, Lee JK, Lee SC (2005) Production of virus-free stocks from citrus plant by the shoot-tip grafting and heat treatment. Korean J. Plant Biotech. 32 : Lee G, Kim JS, Kim HR, Shin IL, Cho KH, Kim SH, Shin J, Kim DH (2013) Production system of virus-free apple plants using heat treatment and shoot tip culture. Res. Plant Dis. 19 : Morton JF (1987) Fruit of warm climates. Julia Frances Nakaune R and Nakano M (2008) Identification of a new Apscaviroid from Japanese persimmon. Arch. Virol. 153 : Paduch-Cichal E and Kryczynski S (1987) A low temperature therapy and meristem-tip culture for eliminating four viroids from infected pplants. J. Phytopathol. 118 : Paprstein F, Sedlak J, Polak J, Svobodova L, Hassan M, Bryxiova M (2008) Results of in vitro thermotherapy of apple cultivars. Plant Cell. Tiss. Org. 94 : Savitri WD, Park KI, Jeon SM, Chung MY, Han JS, Kim CK (2013) Elimination of Chrysanthemum stunt viroid (CSVd) from meristem tip culture combined with prolonged cold treatment. Hortic. Environ. Biotechnol. 54 :
392 J Plant Biotechnol (2016) 43: 바이러스를무병화하는방법은 37 C 로일정기간처리하는열처리요법 (thermotherapy), 4 C 로일정기간처리하는한냉요법 (cold therapy), ribavirin 과같은항바이러스제를처리하는
J Plant Biotechnol (2016) 43:391 396 DOI:http://dx.doi.org/10.5010/JPB.2016.43.3.391 ISSN 1229-2818 (Print) ISSN 2384-1397 (Online) Research Article 항바이러스제처리와경정배양에의한배 (Pyrus pyrifolia L.) 만수 의 Apple stem
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More informationAbstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More information연구목표 재료및방법 년도시험연구보고서
ABSTRACT This study was conducted to determine the optimum concentration of cactus standard nutrient solution for hydroponic culture in potted succulents, Echeveria derenbergii, Sedeveria Letizia and Cotyledon
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More information농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 : ~ ) 과제의최종보고서로제출합니다 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 (
농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 :2014. 7. 29 ~ 2016. 7. 28.) 과제의최종보고서로제출합니다. 2016. 7. 28. 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 ( 인 ) 협동연구기관명 : 목원대학교산학협력단 ( 대표자 ) 고대식 ( 인 ) 협동연구기관명
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information01-15(3)-12(최장경).fm
Res. Plant Dis. 15(3) : 165-169 (2009) Research in Plant Disease The Korean Society of Plant Pathology GM s ü š w Cucumber mosaic virus v y 1 Á y Á»x 1 Á * w w, 1 w y w Comparative Analysis of Coat Protein
More information3 Development of Long-term Storage Method in Fruit Nursery Stock
3 Development of Long-term Storage Method in Fruit Nursery Stock . 1997. 12. 29 : : : . (Development of Long-term Storage Method in Fruit Nursery Stock). 1. O O O (5 8 ) 2.,. 1,. 3-4 (5-8 ) - 1 - , 1.,..
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More information기관고유연구사업결과보고
기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106
More information384 Research in Plant Disease Vol. 23 No. 4,, 1. (INSV),,, (vein clearing), (Tomato spotted wilt virus, TSWV),.,,,,,, (Brisco-McCann Hausbeck, 2016; S
식물병연구 Note Open Access Res. Plant Dis. 23(4) : 383-387 (2017) https://doi.org/10.5423/rpd.2017.23.4.383 First Report of Impatiens necrotic spot virus in Hoya carnosa in Korea 1 2 1 1 1 3 1 * 1, 2, 3 *Corresponding
More information( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
More information유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012
11-1480523-001163-01 유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 목 차 ⅰ ⅲ ⅳ Abstract ⅵ Ⅰ Ⅱ Ⅲ i 목 차 Ⅳ ii 목 차 iii 목 차 iv 목 차 v Abstract vi Abstract σ ε vii Abstract viii Ⅰ. 서론 Ⅰ. 1 Ⅰ. 서론.
More informationAnalysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
More information04조남훈
Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache
More informationÆ÷Àå82š
Lee, Kyungbae (E-mail : kblee6078@ex.co.kr) Lee, Jaehoon (E-mail : ranian74@ex.co.kr) Sohn, Duecksu (E-mail : mgsds@ex.co.kr) Kwon, Soonmin (E-mail : soonmini2@ex.co.kr) ABSTRACT PURPOSES : The purpose
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More informationDevelopment of culture technic for practical cultivation under structure in Gastrodia elate Blume
Development of culture technic for practical cultivation under structure in Gastrodia elate Blume 1996. : 1. 8 2. 1 1998. 12. : : ( ) : . 1998. 12 : : : : : : : : : : - 1 - .. 1.... 2.. 3.... 1..,,.,,
More information저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
More information(조인숙)-o.fm
식물병연구 Res. Plant Dis. 19(4) : 326 330 (2013) http://dx.doi.org/10.5423/rpd.2013.19.4.326 Note Open Access Research in Plant Disease The Korean Society of Plant Pathology 국내양앵두나무에서발생한 Cherry green ring
More information°Ç°�°úÁúº´6-2È£
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information<313430333033C6AFC1FD28C3E0B1B8292E687770>
스포츠와 물리학: 구기운동 안티-싸커 와 간접-축구 DOI: 10.3938/PhiT.23.005 이 인 호 Anti-soccer and Indirect Soccer 편성은 없다고 장담한다. 벨기에(FIFA 랭킹 11위), 러시아 (FIFA 랭킹 22위), 알제리(FIFA 랭킹 26위), 그리고 한국(FIFA 랭킹 61위)으로 이어지는 H조 편성 결과이다. 이
More informationMicrosoft Word - pv_0602.doc
1 씨감자 생산 체계와 바이러스병 검사 (화란체계를 중심으로) 함 영 일 대관령원예농협 기술자문위원 To whom correspondence should be addressed. E-mail :yih0512430@yahoo.co.kr 목 차 1. 서언 2. 화란 씨감자 생산단계와 검사 2.1. 보증된 씨감자의 중요성 2.1.1. 최소한의 질적 요구조건 2.1.2.
More informationMicrosoft Word - KSR2016S168
2016 년도 한국철도학회 춘계학술대회 논문집 KSR2016S168 GPR 을 이용한 자갈궤도 파울링층 파악을 위한 실내실험적 접근 Evaluation of Applicability of GPR to Detect Fouled Layer in Ballast Using Laboratory Tests 신지훈 *, 최영태 **, 장승엽 *** Ji-hoon. Shin
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More information<32382DC3BBB0A2C0E5BED6C0DA2E687770>
논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information212 Research in Plant Disease Vol. 20 No. 3., 7 (Kim, 2004). Colletotrichum (Park Kim, 1992),.. (Agrios, 2008)... 1,202, 256 92, 147, 11 (RDA, 2014).
식물병연구 Research Article Open Access Res. Plant Dis. 20(3) : 211-215(2014) http://dx.doi.org/10.5423/rpd.2014.20.3.211 Protective Activity of the Mixtures of Pine Oil and Copper Hydroxide against Bacterial
More information03-2ƯÁý -14š
Management on hazardous chemicals for production of safe produce Namjun Cho, Sumyeong Hong, Wonil Kim, Byungjun Park Chemical Safety Division, National Academy of Agricultural Science, RDA * Correspondence
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information조사보고서 완본(최종인쇄본).hwp
뉴질랜드 농업투자환경조사보고서 ( 주 ) 제이앤드에이 Ÿ Ÿ Ÿ Ÿ Ÿ Ÿ Ÿ Ÿ Ÿ 2.3) Waipara Limestone Vineyard Estate 토양특성 [표 2-7] Waipara Limestone Vineyard Estate 부지 토양 특성 유효
More informationK O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More information12.077~081(A12_이종국).fm
J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 77-81 y w» e wx Á w œw Fabrication of Ceramic Batch Composition for Porcelain by Using Recycled Waste Ceramic Powder Hyun Guen Han, and
More information12이문규
Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental
More information04김호걸(39~50)ok
Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More information식물병연구 Research Article Open Access Res. Plant Dis. 24(3): (2018) Incidence Rates of Major Diseases o
식물병연구 Research Article Open Access Res. Plant Dis. 24(3): 175-181 (2018) https://doi.org/10.5423/rpd.2018.24.3.175 Incidence Rates of Major Diseases on Green-Fleshed Kiwifruit cv. Hayward and Yellow-Fleshed
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 16 Jul.; 27(7), 64662. http://dx.doi.org/./kjkiees.16.27.7.646 ISSN 1226-3133 (Print)ISSN 2288-226 (Online) 2D Microwave Image
More information디지털포렌식학회 논문양식
ISSN : 1976-5304 http://www.kdfs.or.kr Virtual Online Game(VOG) 환경에서의 디지털 증거수집 방법 연구 이 흥 복, 정 관 모, 김 선 영 * 대전지방경찰청 Evidence Collection Process According to the Way VOG Configuration Heung-Bok Lee, Kwan-Mo
More information황지웅
Comparison of Laparoscopy and Exploration in the Distal Pancreatectomy BACKGROUND: To determine the benefits of laparoscopic surgery compared with exploration, the clinical outcomes of open and laparoscopic
More information` Companies need to play various roles as the network of supply chain gradually expands. Companies are required to form a supply chain with outsourcing or partnerships since a company can not
More information자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr
Original Article pissn 1738-2637 J Korean Soc Radiol 2012;67(2):129-134 The Survey of Magnetic Resonance Imaging Quality according to in Korea 1 자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 1 Hyun-Hae
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More informationCrt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
More information( )Jkstro011.hwp
비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 30(3),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Mar.; 30(3), 223 228. http://dx.doi.org/10.5515/kjkiees.2019.30.3.223 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Analysis
More informationexample code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for
2003 Development of the Software Generation Method using Model Driven Software Engineering Tool,,,,, Hoon-Seon Chang, Jae-Cheon Jung, Jae-Hack Kim Hee-Hwan Han, Do-Yeon Kim, Young-Woo Chang Wang Sik, Moon
More informationjaeryomading review.pdf
4 5 6 7 8 9 10 11 12 13 1. S. Kim, H. Y. Jeong, S. K. Kim, S. Y. Choi and K. J. Lee, Nano Lett. 11, 5438 (2011). 2. E. Menard, K. J. Lee, D. Y. Khang, R. G. Nuzzo and J. A. Rogers, Appl. Phys. Lett. 84,
More informationÆ÷Àå½Ã¼³94š
Cho, Mun Jin (E-mail: mjcho@ex.co.kr) ABSTRACT PURPOSES : The performance of tack coat, commonly used for layer interface bonding, is affected by application rate and curing time. In this study, bonding
More informationISSN 제 3 호 치안정책연구 The Journal of Police Policies ( 제29권제3호 ) 치안정책연구소 POLICE SCIENCE INSTITUTE
11-1320082-000013-09 ISSN 1738-2963 2015 제 3 호 치안정책연구 The Journal of Police Policies 2015. 12 ( 제29권제3호 ) 치안정책연구소 POLICE SCIENCE INSTITUTE : 통학버스를중심으로 차례 전병주 * 최은영 ** Ⅰ. 서론 1) Ⅱ. 이론적배경 Ⅲ. 연구방법 Ⅳ. 연구결과
More information???춍??숏
Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY
More information<313630313032C6AFC1FD28B1C7C7F5C1DF292E687770>
양성자가속기연구센터 양성자가속기 개발 및 운영현황 DOI: 10.3938/PhiT.25.001 권혁중 김한성 Development and Operational Status of the Proton Linear Accelerator at the KOMAC Hyeok-Jung KWON and Han-Sung KIM A 100-MeV proton linear accelerator
More information(01) hwp
Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of
More informationDBPIA-NURIMEDIA
개화기 다언어(多言語) 학습서와 근대 한일 양국어* 李康民 ** i kangmin@hanmail.net The purpose of this study is to conduct a survey to analyze the 13 types of multi language textbooks published in Japan during the time
More informationÀÇÇа�ÁÂc00Ì»óÀÏ˘
Common Allergic Diseases in Children Sang - Il Lee, M.D. Department of pediatrics Sungkyunkwan University School of Medicine, Samsung Medical Center E - mail : silee@smc.samsung.co.kr Abstract Allergy
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More information12È«±â¼±¿Ü339~370
http://www.kbc.go.kr/ k Si 2 i= 1 Abstract A Study on Establishment of Fair Trade Order in Terrestrial Broadcasting Ki - Sun Hong (Professor, Dept. of Journalism & Mass Communication,
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More information?
http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ
More information09구자용(489~500)
The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal
More information°Ç°�°úÁúº´5-44È£ÃÖÁ¾
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis
More information<BFACBCBCC0C7BBE7C7D02831302031203139292E687770>
延 世 醫 史 學 제12권 제2호: 29-40, 2009년 12월 Yonsei J Med Hist 12(2): 29-40, 2009 특집논문 3 한국사회의 낙태에 대한 인식변화 이 현 숙 이화여대 한국문화연구원 1. 들어가며 1998년 내가 나이 마흔에 예기치 않은 임신을 하게 되었을 때, 내 주변 사람들은 모두 들 너무나도 쉽게 나에게 임신중절을 권하였다.
More information대한한의학원전학회지24권6호-전체최종.hwp
小兒藥證直訣 의 五臟辨證에 대한 小考 - 病證과 處方을 중심으로 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 ㆍ 韓醫學古典硏究所 白裕相1,2*1)2) A study on The Diagnosis and Treatment Using The Theory of Five Organs in Soayakjeungjikgyeol(小兒藥證直訣) 1 Dept. of Oriental
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI: : * Research Subject
Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp.91-116 DOI: http://dx.doi.org/10.21024/pnuedi.29.1.201903.91 : * Research Subject Trend Analysis on Educational Innovation with Network
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A S
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.461-487 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.461 * - 2008 2018 - A Study on the Change of Issues with Adolescent Problem
More information,.,..,....,, Abstract The importance of integrated design which tries to i
- - The Brand Touchpoint Analysis through Corporate Identity Typeface of Mobile Telecommunication Companies - Focusing on and - : Lee, Ka Young Dept. Lifestyle Design, Dankook University : Kim, Ji In Dept.
More information지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., KOSPI200.,. * 지능정보연구제 16 권제 1 호 2010 년 3 월
지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., 2004 5 2009 12 KOSPI200.,. * 2009. 지능정보연구제 16 권제 1 호 2010 년 3 월 김선웅 안현철 社 1), 28 1, 2009, 4. 1. 지능정보연구제 16 권제 1 호 2010 년 3 월 Support
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More information학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and
More information10(3)-09.fm
w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½
More information이상훈 심재국 Vegetation of Mt. Yeonin Provincial Park Department of Life Science, Chung-Ang University The forest vegetation of Mt. Yeonin Provincial Park
이상훈 심재국 Vegetation of Mt. Yeonin Provincial Park Department of Life Science, Chung-Ang University The forest vegetation of Mt. Yeonin Provincial Park was surveyed from August 2016 to October 2016. The
More information저작자표시 - 동일조건변경허락 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 이차적저작물을작성할수있습니다. 이저작물을영리목적으로이용할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원
저작자표시 - 동일조건변경허락 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 이차적저작물을작성할수있습니다. 이저작물을영리목적으로이용할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 동일조건변경허락. 귀하가이저작물을개작, 변형또는가공했을경우에는, 이저작물과동일한이용허락조건하에서만배포할수있습니다.
More information1. KT 올레스퀘어 미디어파사드 콘텐츠 개발.hwp
Journal of Next-generation Convergence Information Services Technology Vol.4, No.1, June (2015), pp. 1-8 차세대컨버전스정보서비스기술논문지 KT 올레스퀘어 미디어파사드 콘텐츠 개발 Media Fasade Contents Development of KT Olleh Square 김동조
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
More information발간사 반구대 암각화는 고래잡이 배와 어부, 사냥하는 광경, 다양한 수륙동물 등 약 300여점의 그림이 바위면에 새겨져 있는 세계적 암각화입니다. 오랜 기간 새겨진 그림들 가운데 고래를 잡는 배와 어부모습은 전 세계적으로 유례를 찾기 힘들 정도로 그 중요성과 가치가 큽
울주 대곡리 반구대 암각화 발굴조사보고서 BANGUDAE PETROGLYPH IN DAEGOK-RI, ULJOO EXCAVATION 발간사 반구대 암각화는 고래잡이 배와 어부, 사냥하는 광경, 다양한 수륙동물 등 약 300여점의 그림이 바위면에 새겨져 있는 세계적 암각화입니다. 오랜 기간 새겨진 그림들 가운데 고래를 잡는 배와 어부모습은 전 세계적으로 유례를
More information歯49손욱.PDF
2002 14 C Inventory An Estimation of 14 C Inventory on Each Unit of Wolsong NPP,,, 103-16 14 C 14 C Inventory 14 C Inventory 14 C 14 C, [Inventory] = [ 14 C ] - [ 14 C ] 14 C 14 C 13 C, 14 N 17 O [ 13
More information저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 25(3),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2014 Mar.; 25(3), 304310. http://dx.doi.org/10.5515/kjkiees.2014.25.3.304 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
More informationPJTROHMPCJPS.hwp
제 출 문 농림수산식품부장관 귀하 본 보고서를 트위스트 휠 방식 폐비닐 수거기 개발 과제의 최종보고서로 제출 합니다. 2008년 4월 24일 주관연구기관명: 경 북 대 학 교 총괄연구책임자: 김 태 욱 연 구 원: 조 창 래 연 구 원: 배 석 경 연 구 원: 김 승 현 연 구 원: 신 동 호 연 구 원: 유 기 형 위탁연구기관명: 삼 생 공 업 위탁연구책임자:
More information<BABBB9AE2E687770>
253 단소산조 퉁소산조 피리산조 형성시기 재검토 49) 이진원* Ⅰ. 머리말 Ⅱ. 기존 연구성과 검토 Ⅲ. 단소산조 퉁소산조 피리산조 형성시기 검토 Ⅳ. 단소산조 퉁소산조 피리산조 형성시기 재검토의 의의 Ⅴ. 맺음말 Ⅰ. 머릿말 우리나라의 대표적인 종취관악기(縱吹管樂器)에는 무황악기(無簧樂器)인 퉁소 단소가 있 고, 유황악기(有簧樂器)로 피리와 쇄납 등이
More information..........5-45..
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals
More information