392 J Plant Biotechnol (2016) 43: 바이러스를무병화하는방법은 37 C 로일정기간처리하는열처리요법 (thermotherapy), 4 C 로일정기간처리하는한냉요법 (cold therapy), ribavirin 과같은항바이러스제를처리하는

Size: px
Start display at page:

Download "392 J Plant Biotechnol (2016) 43: 바이러스를무병화하는방법은 37 C 로일정기간처리하는열처리요법 (thermotherapy), 4 C 로일정기간처리하는한냉요법 (cold therapy), ribavirin 과같은항바이러스제를처리하는"

Transcription

1 J Plant Biotechnol (2016) 43: DOI: ISSN (Print) ISSN (Online) Research Article 항바이러스제처리와경정배양에의한배 (Pyrus pyrifolia L.) 만수 의 Apple stem grooving virus 무병화 조강희 신주희 김대현 박서준 김세희 천재안 김미영 한점화 이한찬 Elimination of Apple stem grooving virus from Mansoo pear (Pyrus pyrifolia L.) by an antiviral agent combined with shoot tip culture Kang Hee Cho Juhee Shin Dae-Hyun Kim Seo Jun Park Se Hee Kim Jae An Chun Mi Young Kim Jeom Hwa Han Han Chan Lee Received: 2 May 2016 / Revised: 7 June 2016 / Accepted: 7 June 2016 c Korean Society for Plant Biotechnology Abstract In this study, in vitro-cultured Mansoo pear (Pyrus pyrifolia L.) plants infected with Apple stem grooving virus (ASGV) were used for testing the efficiency of the virus elimination methods. The shoot tips cut from infected plants were treated by thermotherapy (37 C), cold therapy (4 C), chemotherapy with ribavirin, and combination of these methods. Treatment periods were 2, 4, and 8 weeks, and concentrations of ribavirin were 20 and 40 mg L -1. The efficiency of ASGV elimination was evaluated by reverse transcription polymerase chain reaction. The shoot survival rate was the highest at 100% after cold therapy, chemotherapy, and combination of two methods, while the rate was the lowest at 33.3% after thermotherapy for 2 weeks. The shoot survival rate after chemotherapy decreased gradually as the treatment period was prolonged. The ASGV elimination rate was the highest at 100% after ribavirin treatment at a concentration of 40 mg L -1 and combination of ribavirin treatment and thermotherapy for 2 weeks, whereas the ASGV elimination rate after cold therapy was the lowest at 16.7%. However, the efficiency of ASGV elimination was enhanced up to 43.3% by the combination of cold therapy and ribavirin treatment. The efficiency of ASGV elimination for all treatments was increased as the treatment period was K. H. Cho ( ) J. H. Shin D.-H. Kim S. J. Park S. H. Kim J. A. Chun M. Y. Kim J. H. Han H. C. Lee 농촌진흥청국립원예특작과학원과수과 (Fruit Research Division, National Institute of Horticultural and Herbal Science, Rural Development Administration, Wanju 55365, Korea) khc7027@korea.kr prolonged. Based on these results, we suggest that ribavirin treatment at a concentration of 20 mg L -1 for 4 weeks or at a concentration of 40 mg L -1 for 2 weeks combined with shoot tip culture was efficient for the elimination of ASGV from pear. Keywords Shoot tip, Thermotherapy, Cold therapy, Chemotherapy, Elimination 서언 배 (Pyrus pyrifolia L.) 는우리나라의신선농산물수출 2 위작목으로농업생산에서중요한원예작물로알려져있다 (MAFRA 2015). 배에서주로발생하는대표적인바이러스는 Apple chlorotic leaf spot virus (ACLSV), Apple stem grooving virus (ASGV), Apple stem pitting virus (ASPV) 가있다 (Cho et al. 2010; Wang et al. 2010). 이중국내배재배단지에서는 ASGV 의발생률이가장높으며 ASPV 는 2010 년에국내에서처음발생이보고되었다 (Cho et al. 2010). 이러한바이러스에감염된배나무는생장과과실품질이저하되고생산량이감소된다 (Desvignes and Boye 1989). 특히 ASPV 와 ACLSV 가감염된식물체와달리 ASGV 가감염된 신고 의잎에서는부정형의검은점증상이나타나피해가큰것으로관찰되었다 (Cho et al. 2010). 바이러스는주로접목에의해전염이되며감염된식물체는소각외에는다른방제대책이없기때문에무병묘생산시스템의개발이중요하다 (Lee et al. 2013). 따라서과수에서바이러스를제거하기위한무병화연구는다양한방법으로수행되었다. This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

2 392 J Plant Biotechnol (2016) 43: 바이러스를무병화하는방법은 37 C 로일정기간처리하는열처리요법 (thermotherapy), 4 C 로일정기간처리하는한냉요법 (cold therapy), ribavirin 과같은항바이러스제를처리하는화학적요법 (chemotherapy) 등이있다 (El-Dougdoug et al. 2010; Paprstein et al. 2008; Wang et al. 2006). 경정배양과열처리는사과 (Lee et al. 2013; Paprstein et al. 2008), 배 (Tan et al. 2010; Zilka et al. 2002), 복숭아 (Gella and Errea 1998), 포도 (Maliogka et al. 2009) 등의바이러스를제거하는데효과적으로사용되어왔다. Tan et al. (2010) 은 ACLSV, ASGV, ASPV 가감염된배 Fengshui 의식물체를주간 42 C, 야간 34 C 에서 55 일이상의열처리와경정배양을통해바이러스가제거되는것을확인하였다. 열처리에의해경정조직에서바이러스가제거되는기작은고온에서바이러스의복제또는이동이저해되고식물체의생장속도가빨라그결과생정점부위로부터바이러스가제거되는것으로알려져있다 (Cooper and Walkey 1978). 또한고온처리에의해 RNA 의 silencing 이증가되고경정조직에서바이러스 RNA 가분해되는되는것이확인되었다 (Chellappan et al. 2005; Wang et al. 2008). El-Dougdoug et al. (2010) 은 Hop stunt viroid (HSVd) 에감염된복숭아 Florida prince 와배 Balady 를이용하여한냉처리와항바이러스제처리를통해 40% 의무병화개체를획득하였다. 이러한바이러스제거효율은바이러스와기주식물체의종류와복합감염된바이러스의조합에따라달라진다고보고되었다 (Knapp et al. 1995). 본연구에서는 ASGV 감염이확인된배기내식물체를이용하여열처리, 한냉처리및항바이러스제단독및복합처리를통하여효율적인 ASGV 무병화방법을찾고자하였다. 재료및방법 시험재료 배바이러스무병화효율실험을위하여국립원예특작과학원에보존중인배 만수 의기내배양묘신초부위의잎을 채취하여실험에이용하였다. RNA 추출및 reverse transcription polymerase chain reaction (RT-PCR) 을이용한바이러스진단 바이러스를진단하기위하여배 만수 의신초를이용하여 Cetyl trimethyl ammonium bromide 방법을통해 total RNA 를추출하였다 (Gambino et al. 2008). 확보된 total RNA 는 M-MLV reverse transcriptase (Invitrogen, Carlsbad, CA, USA) 와 random hexamer 프라이머를이용하여 cdna 를합성하였으며, 바이러스특이프라이머 (Table 1) 를이용하여 PCR 을수행하였다. 진단바이러스와바이로이드종류는 ACLSV, ASGV, Apple scar skin viroid (ASSVd) 의 3 종이었다. PCR 조건은총 20 μl 의반응액에 cdna 50 ng, 1 PCR buffer, 250 μm dntps, 1.5 units Ex Taq DNA polymerase (TaKaRa, Tokyo, Japan) 를혼합하였다. PCR 반응조건은 94 C 에서 5 분간초기변성시키고, 94 C 에서 40 초, 60 C 에서 40 초, 72 C 에서 40 초씩 35 회반복하였다. 마지막으로 5 분간처리후반응을종료하였다. 또한 18S ribosomal RNA 를함께증폭시켜 RT-PCR 반응이제대로이루어졌는지확인하기위한대조구로이용하였다. 바이러스감염식물체의기내증식 바이러스감염이확인된배기내식물체를증식하기위하여증식배지에치상하였다. 사용한증식배지의조성은 Murashige & Skoog (MS) 배지 4.4 g L -1, 6-benzylaminpurin 1.0 mg L -1, 3-indole-butyric acid 0.1 mg L -1, sucrose 30 g L -1, plant agar 8 g L -1 였으며 ph 5.8 로조정하였다. 증식배지에치상한식물체는 3 주마다계대배양을실시하여실험재료를확보하였다. 무병화처리 RT-PCR 을통해바이러스감염이확인된배 만수 의기내식물체를이용하여열처리, 한냉처리및항바이러스제처 Table 1 RT-PCR primer pairs used for the detection of pear-infecting viruses and viroid infected pear plants Target Apple chlorotic leaf spot virus Apple stem grooving virus Apple scar skin viroid 18S ribosomal RNA Primer sequence (5' 3') F: TTCATGGAAAGACAGGGGCAA R: AAGTCTACAGGCTATTTATTATAAGTCTAA F: ATGAGTTTGGAAGACGTGCTTCAA R: CTAACCCTCCAGTTCCAAGTTACT F: CCCGGTAAACACCGTGCGGT R: ACCGCGAAACACCTATTGTG F: CGCATCATTCAAATTTCTGC R: TTCAGCCTTGCGACCATACT PCR product size (bp) Original accession No. 677 KC JX JX DQ341382

3 J Plant Biotechnol (2016) 43: 리를통하여무병화효율실험을수행하였다. 각처리별 30 개의배양된배신초를확보하였고약 5 mm 크기로잘라실험에이용하였다. 열처리와한냉처리는각각 37 C 와 4 C 가유지되는항온항습장치에서처리하였으며항바이러스제처리그룹은 ribavirin (1-B-D-ribofuransyl-1,2,4-triazole caboxamide, Virazole) 을배지에 20 mg L -1 과 40 mg L -1 의농도로첨가하여 25 C 에서처리하였다. 또한열처리와항바이러스제를복합적으로처리한그룹과한냉처리와항바이러스제를복합처리한그룹으로나누어처리하였다. 처리기간은 2 주, 4 주및 8 주였으며처리후경정배양을통해자란식물체는 RT-PCR 를이용하여무병화여부를확인하였다. 통계처리는 SAS 프로그램 (SAS 9.2, SAS Institute Inc., NC, USA) 을이용하였으며 Duncan 의다중검정 (p < 0.05) 으로평균치간의차이에대한유의성을검정하였다. 결과및고찰 배 만수 의기내식물체를이용하여 RT-PCR 로 ACLSV, ASGV, ASSVd 를진단한결과 ASGV 의감염이확인된식물체를확보할수있었다 (Fig. 1A). 무병화효율실험을위한재료를확보하기위하여 ASGV 가감염된기내식물체를증식하였고 (Fig. 1B), 증식된식물체의 ASGV 를진단하여감염 여부를재확인하였다 (Fig. 1C). 증식된식물체를이용하여열처리, 한냉처리, 항바이러스제를단독또는복합처리하여신초생존율과바이러스제거율을조사하였다 (Fig. 2). 처리에따른신초생존율은 37 C 열처리의경우 2 주간처리그룹에서 33.3% 였고, 4 주및 8 주간처리그룹에서는 3.3% 와 0% 으로낮아졌다 (Table 2). 이와같이열처리에의한바이러스제거방법의가장큰문제는본실험에서같이식물체의낮은생존율이다 (Hu et al. 2012; Lee et al. 2013). 고온이거나처리기간이길어지면바이러스의불활성화율은높아지지만식물체가분화되는비율은현저하게저하된다. Lee et al. (2013) 은사과 썸머드림 등 4 품종의바이러스무병묘를생산하기위해열처리와경정배양을통한기내도입과정중신초생존율은 25.0 ~ 41.7% 로낮았음을보고하였다. 따라서신초생존율을높이기위해비교적낮은온도인 35 C 에서열처리하는방법도보고되었다 (Hu et al. 2012). 경정배양을하기전에낮은온도에서처리하는것은바이러스를제거하는방법중의하나로알려져있다 (Paduch-Cichal and Kryczyński 1987). 4 C 에서 2 개월처리한 HSVd 에감염된배의신초생존율이 31.0% 였다는 El-Dougdoug et al. (2010) 의연구결과와달리본실험의한냉처리에서는 2 ~8 주의처리기간모두 100% 의높은생존율을나타내었다. 항바이러스제인 ribavirin 을 20 mg L -1 농도로 2 주및 4 주간처리한그룹에서는 100% 의생존율을보였지만 8 주간처리한그룹에서 Fig. 1 Preparation of plant materials for the elimination test of Apple stem grooving virus (ASGV). (A) RT-PCR products amplified from in vitro Mansoo pear plants using 18S ribosomal RNA and ASGV specific primers. M, 100 bp DNA plus ladder; N, negative control; P, positive control; 1-7, In vitro Mansoo pear plants. (B) In vitro propagation of Mansoo pear infected with ASGV. (C) Results for the detection of ASGV in in vitro propagated plants by RT-PCR

4 394 J Plant Biotechnol (2016) 43: Fig. 2 Comparison of in vitro pear plants treated by thermotherapy, cold therapy, and chemotherapy. A, Two week treated in vitro plants; B, Four week treated in vitro plants; C, Eight week treated in vitro plants Table 2 Shoot survival rate in pear shoots after being subjected to in vitro thermotherapy, cold therapy, and chemotherapy Treatment 2 weeks Shoot survival rate (%) 4 weeks 8 weeks 37 C 33.3 (10/30) a c b 3.3 (1/30) c 0.0 (0/30) d 4 C (30/30) a (30/30) a (30/30) a Ribavirin 20 mg L (30/30) a (30/30) a 30.0 (9/30) b 40 mg L (30/30) a 96.7 (29/30) b 20.0 (6/30) c 37 C + Ribavirin 20 mg L (14/30) b 0.0 (0/30) d 0.0 (0/30) d 40 mg L (11/30) c 0.0 (0/30) d 0.0 (0/30) d 4 C + Ribavirin 20 mg L (30/30) a (30/30) a (30/30) a 40 mg L (30/30) a (30/30) a (30/30) a a The number in parentheses refers to the number of surviving shoots/the number of treated shoots b Different letters within each column indicate significant differences based on Duncan s multiple range test at p < 0.05 는 30.0% 로급격히낮아졌다. 또한 ribavirin 을 40 mg L -1 농도로처리한그룹에서는신초생존율이처리기간에따라 100%, 96.7% 및 20.0% 로점차낮아져항바이러스제처리기간은 4 주까지가적당한것으로판단되었다. 이는 Kim et al. (2015) 의결과와도유사하여 Persimmon viroid 와 Citrus viroid 가감염된감을이용한무병화효율연구에서항바이러스제처리가신초생존율이가장높은것으로보고하였다. 열처리와항바이러스제의복합처리인경우 ribavirin 을 20 mg L -1 농도로 2 주간처리한그룹에서는 46.7%, 40 mg L -1 농도로처리한그룹에서는 36.7% 의낮은생존율을나타냈고, 4 주및 8 주간처리한그룹에서는생존한개체가없었다. 이와달리한냉처리와항바이러스제복합처리에서는처리기간에상관없이모두 100% 의생존율을나타내었다. ASGV 제거효율에있어서는단독처리인경우열처리의바이러스제거율은 2 주및 4 주간처리한그룹에서는 80.0% 와 100% 였지만생존율이매우낮아 4 주간열처리를통하여확보된무병화개체수는 1 개체로다른처리에비해가장적 었다. 열처리에의한바이러스제거효율은감염된식물체의바이러스농도와도관련이있으며바이러스제거가어려운품종도있고, 단독감염보다여러종류의바이러스가복합감염된경우에바이러스제거가더어려운것으로알려져있다 (Knapp et al. 1995; Paprstein et al. 2008). 한냉처리를 2 주간처리한그룹에서는 16.7%, 4 주및 8 주간처리한그룹에서는 66.7% 의 ASGV 제거율을나타내었다 (Table 3). 경정배양전의한냉처리는고온에저항성바이로이드인 Chrysanthemum stunt viroid, Hop latent viroid 등을제거하는효과적인방법으로보고되었다 (El-Dougdoug et al. 2010). Ribavirin 을 20 mg L -1 와 40 mg L -1 으로 2 주간처리하였을때바이러스제거율은각각 80% 와 100% 였고 4 주및 8 주간처리그룹에서는모두 100% 의바이러스제거율을나타내었다. 식물에있어서열처리와달리항바이러스제처리를이용한바이러스제거기작은명확히알려져있지않지만핵산과 RNA polymerase 의합성을저해하여바이러스복제를억제하는것으로보고되었다 (Hansen 1989; Verma et al. 2005). 복합처리의경우

5 J Plant Biotechnol (2016) 43: Table 3 Effect of in vitro treatments on inactivation of Apple stem grooving virus in pear Treatment 2 weeks Apple stem grooving virus inactivation efficiency (%) 4 weeks 8 weeks 37 C 80.0 (8/10) a b b (1/1) a NT c 4 C 16.7 (5/30) d 66.7 (20/30) c 66.7 (20/30) b Ribavirin 37 C + Ribavirin 20 mg L (24/30) b (30/30) a (9/9) a 40 mg L (30/30) a (29/29) a (6/6) a 20 mg L (13/14) a NT NT 40 mg L (11/11) a NT NT 20 mg L (13/30) c 93.3 (28/30) b (30/30) a 4 C + Ribavirin 40 mg L (25/30) b (30/30) a (30/30) a a The number in parentheses refers to the number of virus free shoots/number of surviving shoots b Different letters within each column indicate significant differences based on Duncan s multiple range test at p < 0.05 c NT: Not tested 열처리와 ribavirin 2 주간처리에서는 ribavirin 을 20 mg L -1 농도로처리한그룹에서는 92.9%, 40 mg L -1 에서는 100% 의바이러스제거율을나타내었다. 한냉처리와 ribavirin 복합처리에서는 ribavirin 농도를 20 mg L -1 하여 2 주간처리한그룹에서는바이러스제거율이 43.3%, 4 주및 8 주간처리한그룹에서는 93.3% 와 100% 로처리기간이길수록바이러스제거율이높았고 40 mg L -1 농도로 2 주간처리한그룹에서의바이러스제거율은 83.3% 였다. 이는최종적으로획득한무병화개체가 30 개체중 25 개체로 ribavirin 단독처리에비해바이러스제거율이낮았다. Cieślińska (2002) 는 ACLSV 가감염된배 Pierre Corneille (Pyrus communis L.) 의기내식물체를이용하여열처리 (36 C) 와 ribavirin 처리를통하여바이러스를제거하고자하였다. 항바이러스제처리효과는 ribavirin 의농도에따라달라지는데 100 mg L -1 의고농도에서는 77% 의신초가식물독성을나타내었고고온과함께처리하면대부분의신초가고사되었다. Ribavirin 25 mg L -1 와 50 mg L -1 의농도로처리된신초는 enzyme-linked immunosorbent assay 를통해각신초의 78% 와 88% 에서 ACLSV 가검출되지않은것을확인하였다. 또한열처리와항바이러스제복합처리가항바이러스제단독처리보다더좋은결과를나타내지는않았다고보고하여본실험에서얻은결과와유사하였다. 이와달리 Hu et al. (2012) 은 ACLSV 와 ASGV 가감염된배 Jinshui (Pyrus pyrifolia L.) 의기내식물체에열처리와항바이러스제를복합처리하였을때단독처리보다 ACLSV 와 ASGV 의제거효율이높았다. 특히 36 C 에서 40 일간열처리와 25 mg L -1 농도의 ribavirin 복합처리후생장점배양을통해바이러스가 100% 제거되어가장높은효율을나타내었다. 또한 mg L -1 농도의 ribavirin 처리는유의하게기내배식물체의증식을향상시켰다. 이와같이항바이러스제는바이러스제거에효과적이지만고농도에서는식물체에식물독성과같은약해를줄수있다. 식물독성의증상으로 는식물체의엽록소분해, 선단괴사및재생이저해되는것으로알려져있으나배양후 15 일부터는그영향이없어지는것으로보고되었다 (El-Dougdoug et al. 2010). 본실험에서도 ribavirin 처리배지에서는시간이지날수록신초엽이연한녹색을띄었지만증식배지에옮겨주면엽색이진한녹색으로되는것을관찰할수있었다 ( 자료미제시 ). Knapp et al. (1995) 은 immune tissue-printing 방법을이용하여 ACLSV 가감염된기내사과품종들의 ACLSV 분포를살펴보았는데 ACLSV 의축적은줄기기저부분에서가장많고신초선단으로갈수록감소하는것을확인할수있었다. 바이러스감염정도는줄기횡단면내에서의바이러스의분포뿐만아니라생장점으로바이러스가확산되는것에영향을주었고, 경미하게바이러스에감염된신초의생장점조직에서는바이러스가전혀관찰되지않았다. 바이러스무병화에는열처리등다양한기술이이용되지만단독처리로는감염된바이러스를완전히불활성화시킬수없는것이많기때문에경정배양과함께병행하고있다. 결론적으로본실험에서는경정배양과더불어항바이러스제인 ribavirin 을 20 mg L -1 농도로 4 주간처리하거나 40 mg L -1 농도로 2 주간단독처리만으로도효과적으로배 ASGV 를제거할수있을것으로판단할수있었다. 그러나실험대상바이러스가 ASGV 1 종으로제한적이어서 ACLSV, ASPV 등다른바이러스가단독또는복합감염된식물체를이용하여정밀한추가적인연구가수행되어야할것으로생각한다. 적요 본연구는 Apple stem grooving virus (ASGV) 에감염된배 (Pyrus pyrifolia L.) 만수 의기내배양식물체를이용하여효과적

6 396 J Plant Biotechnol (2016) 43: 인배바이러스무병화기술을알아보고자수행하였다. 식물체의경정조직을잘라열처리 (37 C), 한냉처리 (4 C), 항바이러스제인 ribavirin 을단독또는복합처리하였다. 처리기간은 2, 4, 8 주였으며 ribavirin 농도는 20 과 40 mg L -1 이었다. 바이러스제거율은 Reverse transcription polymerase chain reaction 분석으로확인하였다. 신초생존율은 2 주간한냉처리, 항바이러스제단독처리와한냉처리와항바이러스제가복합처리된그룹에서 100% 로높았고열처리에서 33.3% 로가장낮았다. 단독으로 ribavirin 을처리한그룹은처리기간이길수록신초생존율이감소하는경향이었다. ASGV 제거율은 2 주간 ribavirin 40 mg L -1 농도로처리한그룹과열처리와 ribavirin 을복합처리한그룹에서 100% 로높았다. 한냉처리한그룹의바이러스제거율은 16.7% 로가장낮았으나한냉처리와 ribavirin 을복합처리한그룹에서는 43.3% 로향상되었다. 모든처리에서처리기간이길수록바이러스제거율은증가하였다. 본실험을통해배 ASGV 제거에는경정배양과더불어항바이러스제인 ribavirin 을 20 mg L -1 농도로 4 주간처리하거나 40 mg L -1 농도로 2 주간단독처리만으로도효과적으로무병화가가능할것으로판단되었다. 사사 본논문은농촌진흥청연구사업 ( 세부과제번호 : PJ ) 의지원에의해이루어진것임. References Chellappan P, Vanitharani R, Ogbe F, Fauquet CM (2005) Effect of temperature on geminivirus-induced RNA silencing in plants. Plant Physiol 138: Cho IS, Kim DH, Kim HR, Chung BN, Cho JD, Choi GS (2010) Occurrence of pome fruit viruses on pear trees (Pyrus pyrifolia) in Korea. Res Plant Dis 16: Cieślińska M (2002) Elimination of Apple chlorotic leaf spot virus (ACLSV) from pear by in vitro thermotherapy and chemotherapy. Acta Hortic 596: Cooper VC, Walkey DGA (1978) Thermal inactivation of Cherry leaf roll virus in tissue cultures of Nicotiana rustica raised from seeds and meristem tips. Ann Appl Biol 88: Desvignes JC, Boye R (1989) Different diseases caused by the Chlorotic leaf spot virus on the fruit trees. Acta Hortic 235:31-38 El-Dougdoug KA, Osman ME, Abdelkader HS, Dawoud RA, Elbaz RM (2010) Elimination of Hop stunt viroid (HSVd) from infected peach and pear plants. Aust J Basic Appl Sci 4:54-60 Gambino G, Perrone I, Gribaudo I (2008) A rapid and effective method for RNA extraction from different tissues of grapevine and other woody plants. Phytochem Anal 19: Gella R, Errea P (1998) Application of in vitro therapy for ilarvirus elimination in three Prunus species. J Phytopathol 146: Hansen AJ (1989) Antiviral chemicals for plant disease control. Crit Rev Plant Sci 8:45-88 Hu GJ, Hong N, Wang LP, Hu HJ, Wang GP (2012) Efficacy of virus elimination from in vitro-cultured sand pear (Pyrus pyrifolia) by chemotherapy combined with thermotherapy. Crop Prot 37:20-25 Kim DH, Kim IS, Lee G, Cho IS, Cho KH, Shin IS, Kim SH, Chun JA, Choi IM (2015) Current occurrence of Persimmon viroid and Citrus viroid in persimmon in JellaNam-do and testing for viroid inactivation methods. J Plant Biotechnol 42:43-48 Knapp E, Hanzer V, Weiss H, da Câmara Machado A, Wang Q, Weiss B, Katinger H, Laimer da Câmara Machado M (1995) Distribution of Apple chlorotic leaf spot virus in apple shoots cultivated in vitro. Acta Hortic 386: Lee G, Kim JH, Kim HR, Shin IS, Cho KH, Kim SH, Shin J, Kim DH (2013) Production system of virus-free apple plants using heat treatment and shoot tip culture. Res Plant Dis 19: Maliogka VI, Skiada FG, Eleftheriou EP, Katis NI (2009) Elimination of a new ampelovirus (GLRaV-Pr) and Grapevine rupestris stem pitting associated virus (GRSPaV) from two Vitis vinifera cultivars combining in vitro thermotherapy with shoot tip culture. Sci Hortic 123: Ministry of Agriculture, Food and Rural Affairs (2015) Paduch-Cichal E, Kryczyński S (1987) A low temperature therapy and meristem-tip culture for eliminating four viroids from infected plants. J Phytopathol 118: Paprstein F, Sedlak J, Polak J, Svobodova L, Hassan M, Bryxiova M (2008) Results of in vitro thermotherapy of apple cultivars. Plant Cell Tiss Organ Cult 94: Tan R, Wang L, Hong N, Wang G (2010) Enhanced efficiency of virus eradication following thermotherapy of shoot-tip cultures of pear. Plant Cell Tiss Organ Cult 101: Verma N, Ram R, Zaidi AA (2005) In vitro production of Prunus necrotic ringspot virus-free begonias through chemo-and thermotherapy. Sci Hortic 103: Wang L, Hong N, Wang GP, Xu WX, Michelutti R, Wang AM (2010) Distribution of Apple stem grooving virus and Apple chlorotic leaf spot virus in infected in vitro pear shoots. Crop Prot 29: Wang L, Wang G, Hong N, Tang R, Deng X (2006) Effect of thermotherapy on elimination of Apple stem grooving virus and Apple chlorotic leaf spot virus for in vitro-cultured pear shoot tips. HortScience 41: Wang QC, Cuellar WJ, Rajamäki ML, Hirata Y, Valkonen JPT (2008) Combined thermotherapy and cryotherapy for efficient virus eradication: relation of virus distribution, subcellular changes, cell survival and viral RNA degradation in shoot tips. Mol Plant Pathol 9: Zilka S, Faingersh E, Rotbaum A, Tam Y, Spiegel S, Malca N (2002) In vitro production of virus-free pear plants. Acta Hortic 596:

<30372D28C0CFB9DD29C1B6B0ADC8F15F D E687770>

<30372D28C0CFB9DD29C1B6B0ADC8F15F D E687770> J Plant Biotechnol (2015) 42:43 48 DOI:http://dx.doi.org/10.5010/JPB.2015.42.1.43 ISSN 1598-6365 Research Article 전라남도지역감바이로이드의감염상황및무병화효율연구 김대현 김인수 이건섭 조인숙 조강희 신일섭 김세희 천재안 최인명 Current occurrence of persimmon

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

09-감마선(dh)

09-감마선(dh) Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected

More information

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770> Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

09권오설_ok.hwp

09권오설_ok.hwp (JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina

More information

인문사회과학기술융합학회

인문사회과학기술융합학회 Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement

More information

12.077~081(A12_이종국).fm

12.077~081(A12_이종국).fm J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 77-81 y w» e wx Á w œw Fabrication of Ceramic Batch Composition for Porcelain by Using Recycled Waste Ceramic Powder Hyun Guen Han, and

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4) THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method

More information

연구목표 재료및방법 년도시험연구보고서

연구목표 재료및방법 년도시험연구보고서 ABSTRACT This study was conducted to determine the optimum concentration of cactus standard nutrient solution for hydroponic culture in potted succulents, Echeveria derenbergii, Sedeveria Letizia and Cotyledon

More information

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung

More information

03-2ƯÁý -14š

03-2ƯÁý	-14š Management on hazardous chemicals for production of safe produce Namjun Cho, Sumyeong Hong, Wonil Kim, Byungjun Park Chemical Safety Division, National Academy of Agricultural Science, RDA * Correspondence

More information

09È«¼®¿µ 5~152s

09È«¼®¿µ5~152s Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,

More information

04조남훈

04조남훈 Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache

More information

(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016) ISSN 228

(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016)   ISSN 228 (JBE Vol. 1, No. 1, January 016) (Regular Paper) 1 1, 016 1 (JBE Vol. 1, No. 1, January 016) http://dx.doi.org/10.5909/jbe.016.1.1.60 ISSN 87-9137 (Online) ISSN 16-7953 (Print) a), a) An Efficient Method

More information

歯1.PDF

歯1.PDF 200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)

More information

<32382DC3BBB0A2C0E5BED6C0DA2E687770>

<32382DC3BBB0A2C0E5BED6C0DA2E687770> 논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학

More information

<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>

<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770> J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2

More information

14.531~539(08-037).fm

14.531~539(08-037).fm G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked

More information

Development of culture technic for practical cultivation under structure in Gastrodia elate Blume

Development of culture technic for practical cultivation under structure in Gastrodia elate Blume Development of culture technic for practical cultivation under structure in Gastrodia elate Blume 1996. : 1. 8 2. 1 1998. 12. : : ( ) : . 1998. 12 : : : : : : : : : : - 1 - .. 1.... 2.. 3.... 1..,,.,,

More information

유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012

유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 11-1480523-001163-01 유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 목 차 ⅰ ⅲ ⅳ Abstract ⅵ Ⅰ Ⅱ Ⅲ i 목 차 Ⅳ ii 목 차 iii 목 차 iv 목 차 v Abstract vi Abstract σ ε vii Abstract viii Ⅰ. 서론 Ⅰ. 1 Ⅰ. 서론.

More information

( )Kju269.hwp

( )Kju269.hwp 만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University

More information

학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici

학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici 학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and

More information

기관고유연구사업결과보고

기관고유연구사업결과보고 기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106

More information

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,

More information

08김현휘_ok.hwp

08김현휘_ok.hwp (Regular Paper) 21 3, 2016 5 (JBE Vol. 21, No. 3, May 2016) http://dx.doi.org/10.5909/jbe.2016.21.3.369 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a), a) An Audio Coding Technique Employing the Inter-channel

More information

(조인숙)-o.fm

(조인숙)-o.fm 식물병연구 Res. Plant Dis. 19(4) : 326 330 (2013) http://dx.doi.org/10.5423/rpd.2013.19.4.326 Note Open Access Research in Plant Disease The Korean Society of Plant Pathology 국내양앵두나무에서발생한 Cherry green ring

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 901 무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 (A Effective Sinkhole Attack Detection Mechanism for LQI based Routing in WSN) 최병구 조응준 (Byung

More information

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770> 대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실

More information

(01) hwp

(01) hwp Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 논문 10-35-03-03 한국통신학회논문지 '10-03 Vol. 35 No. 3 원활한 채널 변경을 지원하는 효율적인 IPTV 채널 관리 알고리즘 준회원 주 현 철*, 정회원 송 황 준* Effective IPTV Channel Control Algorithm Supporting Smooth Channel Zapping HyunChul Joo* Associate

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

α α α α α

α α α α α α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)

More information

Æ÷Àå½Ã¼³94š

Æ÷Àå½Ã¼³94š Cho, Mun Jin (E-mail: mjcho@ex.co.kr) ABSTRACT PURPOSES : The performance of tack coat, commonly used for layer interface bonding, is affected by application rate and curing time. In this study, bonding

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words

More information

04_이근원_21~27.hwp

04_이근원_21~27.hwp 1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일

More information

2 : (JEM) QTBT (Yong-Uk Yoon et al.: A Fast Decision Method of Quadtree plus Binary Tree (QTBT) Depth in JEM) (Special Paper) 22 5, (JBE Vol. 2

2 : (JEM) QTBT (Yong-Uk Yoon et al.: A Fast Decision Method of Quadtree plus Binary Tree (QTBT) Depth in JEM) (Special Paper) 22 5, (JBE Vol. 2 (Special Paper) 22 5, 2017 9 (JBE Vol. 22, No. 5, Sepember 2017) https://doi.org/10.5909/jbe.2017.22.5.541 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) (JEM) a), a), a) A Fast Decision Method of Quadtree

More information

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있 대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준

More information

<313430333033C6AFC1FD28C3E0B1B8292E687770>

<313430333033C6AFC1FD28C3E0B1B8292E687770> 스포츠와 물리학: 구기운동 안티-싸커 와 간접-축구 DOI: 10.3938/PhiT.23.005 이 인 호 Anti-soccer and Indirect Soccer 편성은 없다고 장담한다. 벨기에(FIFA 랭킹 11위), 러시아 (FIFA 랭킹 22위), 알제리(FIFA 랭킹 26위), 그리고 한국(FIFA 랭킹 61위)으로 이어지는 H조 편성 결과이다. 이

More information

main.hwp

main.hwp 열화상 측정기를 이용한 안마의자의 인체 영향 평가 박세진, 구준모, 이현자 한국표준과학연구원 생활계측그룹 Evaluation of Massage Chair Effect on Human Body using Infrared Imaging/Radiometric Camera Se Jin Park, Jun Mo Koo, Hyun Ja Lee Human L ife Measurement

More information

(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re

(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re EMF Health Effect 2003 10 20 21-29 2-10 - - ( ) area spot measurement - - 1 (Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern

More information

디지털포렌식학회 논문양식

디지털포렌식학회 논문양식 ISSN : 1976-5304 http://www.kdfs.or.kr Virtual Online Game(VOG) 환경에서의 디지털 증거수집 방법 연구 이 흥 복, 정 관 모, 김 선 영 * 대전지방경찰청 Evidence Collection Process According to the Way VOG Configuration Heung-Bok Lee, Kwan-Mo

More information

06_ÀÌÀçÈÆ¿Ü0926

06_ÀÌÀçÈÆ¿Ü0926 182 183 184 / 1) IT 2) 3) IT Video Cassette Recorder VCR Personal Video Recorder PVR VCR 4) 185 5) 6) 7) Cloud Computing 8) 186 VCR P P Torrent 9) avi wmv 10) VCR 187 VCR 11) 12) VCR 13) 14) 188 VTR %

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jun.; 27(6),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jun.; 27(6), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Jun.; 27(6), 495 503. http://dx.doi.org/10.5515/kjkiees.2016.27.6.495 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Design

More information

:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( )

:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( ) :,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α=.83.91.,.,,..,,,.,. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ..,.,.,. Bandura(1997),.,,,,., (,,, 2009), (,,,, 2014).?.,,,.. Bandura (1995) (Resiliency

More information

한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26

한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26 2015 한국전지학회 춘계학술대회 2일차 한국전지학회 춘계 학술대회(신소재 및 시장동향 관련 주제 발표) 시간 제목 비고 세션 1 차세대 이차전지용 in-situ 분석기술 좌장 : 윤성훈 09:00~09:30 Real-time & Quantitative Analysis of Li-air Battery Materials by In-situ DEMS 김동욱(한국화학연구원)

More information

232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특

232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특 한국도시행정학회 도시행정학보 제25집 제4호 2012. 12 : pp.231~251 생활지향형 요소의 근린주거공간 분포특성 연구: 경기도 시 군을 중심으로* Spatial Distribution of Daily Life-Oriented Features in the Neighborhood: Focused on Municipalities of Gyeonggi Province

More information

( )Jkstro011.hwp

( )Jkstro011.hwp 비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy

More information

(2)-02(최경자).fm

(2)-02(최경자).fm Res. Plant Dis. 16(2) : 148-152 (2010) Research in Plant Disease The Korean Society of Plant Pathology z w t w sƒ Á½ Á Á yá * w yw yw l Development of Effective Screening Method and Evaluation of Radish

More information

°í¼®ÁÖ Ãâ·Â

°í¼®ÁÖ Ãâ·Â Performance Optimization of SCTP in Wireless Internet Environments The existing works on Stream Control Transmission Protocol (SCTP) was focused on the fixed network environment. However, the number of

More information

12È«±â¼±¿Ü339~370

12È«±â¼±¿Ü339~370 http://www.kbc.go.kr/ k Si 2 i= 1 Abstract A Study on Establishment of Fair Trade Order in Terrestrial Broadcasting Ki - Sun Hong (Professor, Dept. of Journalism & Mass Communication,

More information

PJTROHMPCJPS.hwp

PJTROHMPCJPS.hwp 제 출 문 농림수산식품부장관 귀하 본 보고서를 트위스트 휠 방식 폐비닐 수거기 개발 과제의 최종보고서로 제출 합니다. 2008년 4월 24일 주관연구기관명: 경 북 대 학 교 총괄연구책임자: 김 태 욱 연 구 원: 조 창 래 연 구 원: 배 석 경 연 구 원: 김 승 현 연 구 원: 신 동 호 연 구 원: 유 기 형 위탁연구기관명: 삼 생 공 업 위탁연구책임자:

More information

저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할

저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할 저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,

More information

γ

γ 경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical

More information

2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, )

2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, ) Abstract Kim Dal-Rae, Kim Sun-Hyung* Dept. of Sasang Constitutional Medicine, College of Oriental Medicine, Kyung-Hee Univ. *Dept. of Sasang Constitutional Medicine, East-West Neo Medical Center, Kyung-Hee

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con

Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI:   (NCS) Method of Con Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency

More information

Statistical Data of Dementia.

Statistical Data of Dementia. Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.

More information

Æ÷Àå82š

Æ÷Àå82š Lee, Kyungbae (E-mail : kblee6078@ex.co.kr) Lee, Jaehoon (E-mail : ranian74@ex.co.kr) Sohn, Duecksu (E-mail : mgsds@ex.co.kr) Kwon, Soonmin (E-mail : soonmini2@ex.co.kr) ABSTRACT PURPOSES : The purpose

More information

3 Development of Long-term Storage Method in Fruit Nursery Stock

3 Development of Long-term Storage Method in Fruit Nursery Stock 3 Development of Long-term Storage Method in Fruit Nursery Stock . 1997. 12. 29 : : : . (Development of Long-term Storage Method in Fruit Nursery Stock). 1. O O O (5 8 ) 2.,. 1,. 3-4 (5-8 ) - 1 - , 1.,..

More information

K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis

More information

저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할

저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할 저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,

More information

<C7D1B9CEC1B7BEEEB9AEC7D03631C1FD28C3D6C1BE292E687770>

<C7D1B9CEC1B7BEEEB9AEC7D03631C1FD28C3D6C1BE292E687770> 설화에 나타난 사회구조와 그 의미 23) 박유미 * 차례 Ⅰ. 문제제기 Ⅱ. 서사 내부의 사회구조 Ⅲ. 사회문제의 해결방식과 그 의미 Ⅳ. 설화와 후대전승과의 상관관계 Ⅴ. 결론 국문초록 삼국유사 의 조에는 왕거인 이야기와 거타지 이야기가 하나의 설화에 묶여 전하고 있는데, 두 이야기는 해결구조에서 차이를

More information

212 Research in Plant Disease Vol. 20 No. 3., 7 (Kim, 2004). Colletotrichum (Park Kim, 1992),.. (Agrios, 2008)... 1,202, 256 92, 147, 11 (RDA, 2014).

212 Research in Plant Disease Vol. 20 No. 3., 7 (Kim, 2004). Colletotrichum (Park Kim, 1992),.. (Agrios, 2008)... 1,202, 256 92, 147, 11 (RDA, 2014). 식물병연구 Research Article Open Access Res. Plant Dis. 20(3) : 211-215(2014) http://dx.doi.org/10.5423/rpd.2014.20.3.211 Protective Activity of the Mixtures of Pine Oil and Copper Hydroxide against Bacterial

More information

저작자표시 - 동일조건변경허락 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 이차적저작물을작성할수있습니다. 이저작물을영리목적으로이용할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원

저작자표시 - 동일조건변경허락 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 이차적저작물을작성할수있습니다. 이저작물을영리목적으로이용할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원 저작자표시 - 동일조건변경허락 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 이차적저작물을작성할수있습니다. 이저작물을영리목적으로이용할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 동일조건변경허락. 귀하가이저작물을개작, 변형또는가공했을경우에는, 이저작물과동일한이용허락조건하에서만배포할수있습니다.

More information

°Ç°�°úÁúº´6-2È£

°Ç°�°úÁúº´6-2È£ K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine

More information

Microsoft Word - KSR2012A172.doc

Microsoft Word - KSR2012A172.doc YWXY º º t rzyywxyhx^y v s k v A Study on the Development of Traction Jig for Bimodal Tram ã äø Ñ ã ä ãã Hee-Taek Yoon *, Young-Kon Park *, Se-Hyun Cho ** ) Abstract The bimodal tram ahead of practical

More information

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( : 27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,

More information

Cloning

Cloning Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군

More information

[ 화학 ] 과학고 R&E 결과보고서 나노입자의표면증강을이용한 태양전지의효율증가 연구기간 : ~ 연구책임자 : 김주래 ( 서울과학고물리화학과 ) 지도교사 : 참여학생 : 원승환 ( 서울과학고 2학년 ) 이윤재 ( 서울과학고 2학년 ) 임종

[ 화학 ] 과학고 R&E 결과보고서 나노입자의표면증강을이용한 태양전지의효율증가 연구기간 : ~ 연구책임자 : 김주래 ( 서울과학고물리화학과 ) 지도교사 : 참여학생 : 원승환 ( 서울과학고 2학년 ) 이윤재 ( 서울과학고 2학년 ) 임종 [ 화학 ] 과학고 R&E 결과보고서 나노입자의표면증강을이용한 태양전지의효율증가 연구기간 : 2013. 3 ~ 2013. 12 연구책임자 : 김주래 ( 서울과학고물리화학과 ) 지도교사 : 참여학생 : 원승환 ( 서울과학고 2학년 ) 이윤재 ( 서울과학고 2학년 ) 임종찬 ( 서울과학고 2학년 ) 소재원 ( 서울과학고 2학년 ) 1,.,.,.... surface

More information

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF. 1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 27(2), 2007, 96-121 S ij k i POP j a i SEXR j i AGER j i BEDDAT j ij i j S ij S ij POP j SEXR j AGER j BEDDAT j k i a i i i L ij = S ij - S ij ---------- S ij S ij = k i POP j a i SEXR j i AGER j i BEDDAT

More information

- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -

More information

<313630313032C6AFC1FD28B1C7C7F5C1DF292E687770>

<313630313032C6AFC1FD28B1C7C7F5C1DF292E687770> 양성자가속기연구센터 양성자가속기 개발 및 운영현황 DOI: 10.3938/PhiT.25.001 권혁중 김한성 Development and Operational Status of the Proton Linear Accelerator at the KOMAC Hyeok-Jung KWON and Han-Sung KIM A 100-MeV proton linear accelerator

More information

歯5-2-13(전미희외).PDF

歯5-2-13(전미희외).PDF The Korean Journal of Counseling 2004, Vol. 5, No. 2, 423-434,. 4 5 18 9, 9.,,,,,.,,, t-.. :,,, (,, 1996),.,,. (, 2001),... 88 98 2000, 88 12.5%(250 )98 35.6%(712 )2.8 (,,, 2001) (Corresponding Author)

More information

ÀÇÇа�ÁÂc00Ì»óÀÏ˘

ÀÇÇа�ÁÂc00Ì»óÀÏ˘ Common Allergic Diseases in Children Sang - Il Lee, M.D. Department of pediatrics Sungkyunkwan University School of Medicine, Samsung Medical Center E - mail : silee@smc.samsung.co.kr Abstract Allergy

More information

384 Research in Plant Disease Vol. 23 No. 4,, 1. (INSV),,, (vein clearing), (Tomato spotted wilt virus, TSWV),.,,,,,, (Brisco-McCann Hausbeck, 2016; S

384 Research in Plant Disease Vol. 23 No. 4,, 1. (INSV),,, (vein clearing), (Tomato spotted wilt virus, TSWV),.,,,,,, (Brisco-McCann Hausbeck, 2016; S 식물병연구 Note Open Access Res. Plant Dis. 23(4) : 383-387 (2017) https://doi.org/10.5423/rpd.2017.23.4.383 First Report of Impatiens necrotic spot virus in Hoya carnosa in Korea 1 2 1 1 1 3 1 * 1, 2, 3 *Corresponding

More information

Crt114( ).hwp

Crt114( ).hwp cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Feb.; 29(2), 93 98. http://dx.doi.org/10.5515/kjkiees.2018.29.2.93 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) UHF-HF

More information

01-15(3)-12(최장경).fm

01-15(3)-12(최장경).fm Res. Plant Dis. 15(3) : 165-169 (2009) Research in Plant Disease The Korean Society of Plant Pathology GM s ü š w Cucumber mosaic virus v y 1 Á y Á»x 1 Á * w w, 1 w y w Comparative Analysis of Coat Protein

More information

A 617

A 617 Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R

More information

2 / 26

2 / 26 1 / 26 2 / 26 3 / 26 4 / 26 5 / 26 6 / 26 7 / 26 8 / 26 9 / 26 10 / 26 11 / 26 12 / 26 13 / 26 14 / 26 o o o 15 / 26 o 16 / 26 17 / 26 18 / 26 Comparison of RAID levels RAID level Minimum number of drives

More information

서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소

서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소 2012 년도기초과학연구소 대학중점연구소심포지엄 마이크로파센서를이용한 혈당측정연구 일시 : 2012 년 3 월 20 일 ( 화 ) 14:00~17:30 장소 : 서강대학교과학관 1010 호 주최 : 서강대학교기초과학연구소 Contents Program of Symposium 2 Non-invasive in vitro sensing of D-glucose in

More information

김범수

김범수 Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis

More information

Microsoft Word - Genolution RNAi Manual.doc

Microsoft Word - Genolution RNAi Manual.doc 1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000

More information

농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 : ~ ) 과제의최종보고서로제출합니다 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 (

농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 : ~ ) 과제의최종보고서로제출합니다 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 ( 농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 :2014. 7. 29 ~ 2016. 7. 28.) 과제의최종보고서로제출합니다. 2016. 7. 28. 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 ( 인 ) 협동연구기관명 : 목원대학교산학협력단 ( 대표자 ) 고대식 ( 인 ) 협동연구기관명

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상

제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상 6차 산업 수익모델 시범사업 농산물가공품개발 연구용역 최 종 보 고 서 영남대학교 식품공학과 연구책임자 : 한 기 동 제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:21~34 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/19, Published: 2016/12/30 [ABSTRACT] With the development of the Internet,

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Sep.; 30(9), 712 717. http://dx.doi.org/10.5515/kjkiees.2019.30.9.712 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) MOS

More information