00-목차(42-1).hwp

Transcription

1 Volume 42 Number 1 March 31, 2015 Vol. 42 No. 1 March

2 Volume 42 Number 1 March 31, 2015 Vol. 42 No. 1 March

3 한국식물생명공학회지 Journal of Plant Biotechnology ISSN Volume 42, Number 1 March 31, 2015 편집위원회 Editorial Board 편집위원장강권규 ( 한경대학교 ) kykang@hknu.ac.kr 편집간사박영훈 ( 부산대학교 ) ypark@pusan.ac.kr < 오믹스및분자마커 > 책임편집위원 조용구 ( 충북대학교 ) ygcho@cbnu.ac.kr 편집위원 김선태 ( 부산대학교 ) stkim5505@gmail.com 김성길 ( 전남대학교 ) dronion@jnu.ac.kr 류호진 ( 충북대학교 ) hjryu96@chungbuk.ac.kr 염인화 ( 안동대학교 ) iyeam@andong.ac.kr 유수철 ( 한경대학교 ) scyoo@hknu.ac.kr < 형질전환및대사공학 > 책임편집위원 정우식 ( 경상대학교 ) chungws@gnu.ac.kr 편집위원 이병현 ( 경상대학교 ) hyun@gnu.ac.kr 이행순 ( 한국생명공학연구원 ) hslee@kribb.re.kr 정재철 ( 한국생명공학연구원 ) jcjeong@kribb.re.kr 최동욱 ( 전남대학교 ) dwchoi63@jnu.ac.kr 최영림 ( 국립산림과학원 ) yichoi99@forest.go.kr < 조직배양및 2 차대사 > 책임편집위원 김창길 ( 경북대학교 ) ckkim@knu.ac.kr 편집위원 김종보 ( 건국대학교 ) jbhee@hanmail.net 박소영 ( 충북대학교 ) soypark7@chungbuk.ac.kr 안영옥 ( 동부한농 ) yoahn@dongbu.com 정유진 ( 한경대학교 ) yuyu1216@hknu.ac.kr Editor-in-Chief Kang, Kwon-Kyoo HanKyong National University Associate Editor Park, Young-Hun Pusan National University Managing Eiditors Cho, Yong-Gu Chungbuk National University Chung, Woo-Sik Gyeongsang National University Kim, Chang-Kil Kyungpook National University Editors Ahn, Young-Ock DongBu Farm Hannong Choi, Dong-Woog Chonnam National University Choi, Young-Lim Korea Forest Research Institute Jeong, Jae-Cheol Korea Research Institute of Bioscience and Biotechnology Jung, Yu-Jin HanKyong National University Kim, Jong-Bo Konkuk University Kim, Seong-Gil Chonnam National University Kim, Sun-Tae Pusan National University Lee, Bung-Hyun Gyeongsang National University Lee, Haeng-Soon Korea Research Institute of Bioscience and Biotechnology Park, So-Young Chungbuk National University Ryu, Ho-Jin Chungbuk National University Yeam, In-Hwa Andong National University Yoo, Soo-Cheul HanKyong National University Aims and Scope Journal of Plant Biotechnology (JPB) is an international open access journal published four issues of a yearly volume on March 31, June 30, September 30, and December 31 by The Korean Society for Plant Biotechnology (KSPBT) founded in JPB publishes original, peer-reviewed articles dealing with advanced scientific aspects of plant biotechnology, which includes molecular biology, genetics, genomics, proteomics, and metabolomics. JPB does not exclude studies on lower plants including algae and cyanobacteria if studies are carried out within the aspects described above. Electronic Edition Journal of Plant Biotechnology allows open access to all published articles. Membership of The Korean Society for Plant Biotechnology (KSPBT) is required to access the electronic free full-text PDF format, available at and Subscription Information Abbreviated title is J. Plant Biotechnol. ISSN print edition: Digital objet identifier(doi): Editorial Office The Korean Society of Plant Biotechnology, 2017 Hongin Tower Officetel, 28 Daehak-ro, Yuseong-gu, Daejeon , Korea. Tel: , Fax: , kspbt@kspbt.or.kr Society Website: Printing Company CIR / Yejang-dong, Jung-gu, Seoul , Republic of Korea Tel: , Fax: , circom@chol.com Copyright c 2015 by the Korean Society for Plant Biotechnology This journal was supported by the Korean Federation of Science and Technology Societies Grant funded by the Korean Government. Printed on Mar 26, 2015 and published on Mar 31, 2015 한국식물생명공학회 The Korean Society for Plant Biotechnology

4 Journal of Plant Biotechnology Vol. 42 No. 1 March 31, 2015 CONTENTS Review 식물의생장및발달과정에서 Glycogen synthase kinase 3 (GSK3) 유전자의역할류호진 1 The functional roles of plant glycogen synthase kinase 3 (GSK3) in plant growth and development Hojin Ryu 약용작물의기원판별에관한분자생물학적기술개발현황한은희 김윤희 이신우 6 Development of molecular biological techniques for the differentiation of medicinal plant species Eun-Heui Han Yun-Hee Kim Shin-Woo Lee Research Articles Absence of AVP1 transcripts in wild type watermelon scions grafted onto transgenic bottle gourd rootstocks Byung Oh Kim Jeung-Sul Han Kyung il Park Su Min Jeon Chang Kil Kim 13 CodA 고발현형질전환고구마의산화및건조스트레스내성증가박성철 김명덕 김선하 김윤희 정재철 이행순 곽상수 19 Enhanced drought and oxidative stress tolerance in transgenic sweetpotato expressing a coda gene Sung-Chul Park Myoung Duck Kim Sun Ha Kim Yun-Hee Kim Jae Cheol Jeong Haeng-Soon Lee Sang-Soo Kwak 배검은별무늬병 (Venturia nashicola) 고도저항성 유래 PR-10 유전자의특성천재안 김세희 조강희 김대현 최인명 신일섭 25 Characterization of PR-10 gene derived from highly resistant pear inoculated with scab (Venturia nashicola) Jae An Chun Se Hee Kim Kang Hee Cho Dae Hyun Kim In Myong Choi Il Sheob Shin 생물반응기를이용한적하수오부정근의바이오매스와생리활성물질대량생산이경주 박영기 김자영 정택규 윤경섭 백기엽 박소영 34 Production of biomass and bioactive compounds from adventitious root cultures of Polygonum multiflorum using air-lift bioreactors Kyung-Ju Lee Youngki Park Ja-Young Kim Taek-Kyu Jeong Kyung-Seop Yun Kee-Yoeup Paek So-Young Park 전라남도지역감바이로이드의감염상황및무병화효율연구김대현 김인수 이건섭 조인숙 조강희 신일섭 김세희 천재안 최인명 43 Current occurrence of persimmon viroid and citrus viroid in persimmon in JellaNam-do and testing for viroid inactivation methods Dae Hyun Kim In-Soo Kim Gunsup Lee In-Sook Cho Kang Hee Cho Il Sheob Shin Se Hee Kim Jae An Chun In-Myung Choi ON THE COVER: Adventitious root culture of P. multiflorum. A. Mother plants in greenhouse, B. In vitro grown plantlets. C. Adventitious root culture on petri-dish, D. Adventitious root culture in 300 ml flask, E. Harvested root from liquid culture, F. Adventitious root culture in 3 L air-lift bioreactor after 4 weeks of culture (p. 41)

5 양앵두왜성대목 Gisela 5 의기내번식을위한정단배양조건의최적화쉬쥔핑 강인규 김창길 한증술 최철 49 Optimization of apical tip culture condition for In Vitro propagation of Gisela 5 dwarf cherry rootstock Junping Xu In-Kyu Kang Chang Kil Kim Jeung-Sul Han Cheol Choi 울릉도자생식물삼나물 (Aruncusdioicus) 의항산화활성검증김동희 문용선 손준호 55 Verification of anti-oxidative activity of Aruncus dioicus, a native plant of Ulleungdo Dong-Hee Kim Yong-Sun Moon Jun-Ho Son 적외선분광스펙트럼및기체크로마토그라피분석데이터의다변량통계분석을이용한대두종자지방산함량예측안명숙 지은이 송승엽 안준우 정원중 민성란 김석원 60 Simultaneous estimation of fatty acids contents from soybean seeds using fourier transform infrared spectroscopy and gas chromatography by multivariate analysis Myung Suk Ahn Eun Yee Ji Seung Yeob Song Joon Woo Ahn Won Joong Jeong Sung Ran Min Suk Weon Kim

6 J Plant Biotechnol (2015) 42:1 5 DOI: ISSN Review 식물의생장및발달과정에서 Glycogen synthase kinase 3 (GSK3) 유전자의역할 류호진 The functional roles of plant glycogen synthase kinase 3 (GSK3) in plant growth and development Hojin Ryu Received: 15 March 2015 / Revised: 24 March 2015 / Accepted: 24 March 2015 c Korean Society for Plant Biotechnology Abstract The biological roles of glycogen synthase kinase 3 (GSK3) proteins have long been extensively explored in eukaryotic organisms including fungi, animals and plants. This gene family has evolutionary well conserved kinase domain and shares similar phosphorylation properties to their substrate proteins. However, their specific biological roles are surprisingly distinct in different organisms. GSK3s play key role in key regulating the cytoskeleton and metabolic processes in animal systems, but plant GSKs are involved in quite different processes, such as flower development, brassinosteroid signaling, abiotic stresses, and organogenesis. In particular, recent studies have reported the critical multiple functions of BIN2 and its related paralogues plant GSK3s during organogenesis via connecting hormonal or developmental programs. In this review, we outline the recent understanding in the versatile functions related in physiological and biochemical relevance, which are mediated by plant GSK3s in various cellular signaling. 서언 진핵생물에서발견되는 Glycogen synthase kinase 3 (GSK3) 단백질은동물의인슐린에의해조절되는 Glycogen 합성의최종단계에관여하는중요단백질에인산화를유도하는특성을지니는인산화효소를코딩하는유전자로처음발견되었다 (Saidi et al. 2012). 현재까지많은연구그룹에 H. J. Ryu ( ) 충북대학교자연과학대학생물학과 (Department of Biology, Chungbuk National University, Cheongju, , Korea) hjryu96@chungbuk.ac.kr 의해 GSK3 유전자들의기능이연구되어오고있으며, 그중요성이최근부각되고있는유전자중에하나이다. 특히세포의운명결정인자, 세포사멸, wnt 신호전달에서의주요조절인자로서그중요성이동물에서많이알려져왔다 (Saidi et al. 2012). 동물의 wnt signaling 은매우다양한동물의발달및발생에관여하는것으로알려져있으며, GSK3β 에의해전사인자 β-catenin 의인산화를통한활성도조절기작이잘알려져있다. 이러한중요성과함께 GSK3 은알츠하이머, 암과같은주요질병과도매우밀접하게연결되어있다는사실들이최근지속적으로보고되고있다. 현재까지두개의유전자 (GSK3α/β) 에의해동물의 GSK3 단백질이코딩되어지고있으며, 동물에서는약 80 여종류의주요단백질들이 GSK3 인산화효소에의해인산화가일어난다는사실이잘알려져왔다 (Sutherland 2011). 모델식물애기장대의게놈정보가알려진이후동물의 GSK3 단백질과유사성이존재하는 10 개의 GSK3-like 유전자들이애기장대의게놈에존재하고있음이알려져왔다 (Jonak and Hirt 2002; Saidi et al. 2012). 식물에서 GSK3 유전자에대한연구가본격적으로이뤄진것은식물호르몬브라시노스테로이드에대한반응성이나타나지않는난쟁이표현형을보이는 brassinosteroid-insensitive 2 (bin2) /dwarf12 돌연변이가발견되고, 그원인이되는유전자 BIN2 의기능학적연구가진행되면서부터이다 (Choe et al. 2002; He et al. 2002; Li and Nam 2002). 브라시노스테로이드신호전달체계에서 BIN2 는주요전사인자 BES1/BZR1 의인산화를통해브라시노스테로이드신호전달을억제하게되는기작이잘알려져있다 (Ryu et al. 2007). 또한 Tang, Ryu 등은식물 GSK3 인산화효소 BIN2 에의해인산화가일어나는 BES1 (BRI1-EMS-SUPPRESSOR 1), BZR1 (BRASSINAZOLE-RESISTANT 1) 의 Ser/Thr 인산화좌를동

7 2 J Plant Biotechnol (2015) 42:1 5 정하였다 (Ryu et al. 2010; Ryu et al. 2007; Tang et al. 2008). 애기장대에서발견된 10 개의 GSK3 유전자들은단백질을구성하는아미노산서열을중심으로총 4 개의그룹으로구분되어지며 (Jonak and Hirt 2002; Saidi et al. 2012), 최근까지 BIN2 가포함되어져있는그룹 Ⅱ (BIN2, BIL1 (BIN2-LIKE 1), BIL2 (BIN2-LIKE 2)) 유전자들의기능학적연구가브라시노스테로이드신호전달을중심으로이뤄져왔다 (Yin et al. 2005). 하지만최근연구들은 BIN2/GSK3 유전자가브라시노스테로이드이외에도다양한호르몬신호전달뿐만아니라다양한식물의생장및발달에관여한다는증거가보고되고있다. 이러한증거들은동물에서와마찬가지로식물에서도 GSK3 에의해유도되는인산화과정들이발달과생장에매우중요하게작용하고있음을예상하게해준다. 본리뷰에서는최근에발견된 GSK3 유전자의새로운기능들이어떻게식물의발달과생장에관여하고있는지를서술하고자한다. 또한향후이들중요성이부각되고있는 GSK3 유전자의기능연구를통해어떠한생명공학적발전을이룰수있는지를제시하고자한다. Brassinosteroids ( 브라시노스테로이드 ) 식물호르몬은식물의발달및생장에매우중요한역할을담당하고있는생리물질이다. 식물의 GSK3 가식물호르몬신호전달에직접적으로관여되는사실이알려진것은 BIN2 유전자에의해브라시노스테로이드신호전달이억제되는것이알려지면서부터이다 (Kutschera and Wang 2012). 식물에서브라시노스테로이드신호전달은모델식물애기장대를통해많은연구가진행되어졌으며, 대부분의주요신호전달인자들이동정되어왔다. 브라시노스테로이드는생체막에존재하는수용체 BRI1 (BRASSIN- OSTEROID-INSENSITIVE 1) 에의해인식이되어신호개시가이뤄지게된다. 이들신호는최종적으로두전사인자 BES1 과 BZR1 의활성화를통해다양한브라시스토스테로이드효과를나타내게된다. 두전사인자 BES1 과 BZR1 의활성은인산화상태에따라달라지게되는데, Ryu 등에의해발견된기작은 BIN2 에의한인산화가전사인자들의핵으로부터세포질로의이동을통해전사인자들의비활성화를유도함을보여주고있다 (Ryu et al. 2010; Ryu et al. 2007). BES1/BZR1 전사인자에 BIN2 에의해인산화가일어나는아미노산의위치는 LC/MS/MS 기법과전기영동을통한 gel-shift 기법을통해어느정도알려져있으며, 특히 단백질과의결합을통해핵과세포질의위치가결정되는데매우중요한역할을하는것으로알려졌다 (Ryu et al. 2010; Ryu et al. 2007). BIN2 이외에가장유사한아미노산서열을보유하고있는그룹 Ⅱ (BIN2, BIL1 (BIN2-LIKE), BIL2) 유전자들의기능학적연구가브라시노스테로이드신호전달에서매 우유사한기능을하고있음이보고되었다 (Charrier et al. 2002). BIN2 유전자의 T-DNA knock-out 돌연변이체가야생형식물체와큰차이를보이지않는것에비해, bin2 bil1 bil2 triple knock-out 돌연변이체는브라시노스테로이드신호전달이강하게활성화되는표현형이나타났다 (Vert and Chory 2006). 이러한결과는그룹 Ⅱ GSK3 유전자의기능이브라시노스테로이드신호전달에상호협력적으로작용하고있음을보여주고있다. 이외에도최근연구에의하면그룹 Ⅲ 에속하는 AtGSK31 유전자또한브라시노스테로이드신호전달에음성적으로작용함이알려졌다 (Zhang et al. 2013). AtGSK31 유전자는 BES1/BZR1 단백질에인산화를유도하였으며, 이들유전자가과발현된애기장대에서브라시노스테로이드가약해졌을때나타나는난쟁이표현형이보고되었다 (Zhang et al. 2013). 이러한결과는그룹 Ⅱ 에서특이적으로브라시노스테로이드신호전달에관여될것으로여겨졌으나, 다른식물의 GSK3 도식물의발달과정중에다양하게브라시노스테로이드신호전달에관여할수있는가능성을보여주고있다. Auxin ( 옥신 ) 과기관형성 식물의발달과정에서 morphogen 으로알려진옥신은식물의전생애과정에서필요로하는다양한발달과생장프로그램에매우밀접하게관여하고있는호르몬이다. 옥신은수용체 TIR1 (TRANSPORT INHIBITOR RESPONSE 1) 에의해인식이되면서신호전달의개시가된다 (Lau et al. 2008). 옥신에의해활성화되는 TIR1 은옥신신호의음성적조절자 AUX/IAA 단백질의분해과정을촉진하여전사인자 ARF 들의활성을유도하게된다 (Lau et al. 2008). 애기장대의게놈에는 23 개의 ARF 유전자들이존재하는것으로알려져있으며이들의기능은흥미롭게도일부는옥신신호의활성인자, 일부 ARF (AUXIN RESPONSE FACTOR) 유전자들은억제인자로서의역할을수행하는것으로알려져있다 (Guilfoyle 2007; Guilfoyle and Hagen 2007). Vert et al. (2008) 은옥신신호의억제인자로작용하는 ARF2 ( 가 BIN2 에의해인산화를직접적으로일으키며, ARF2 (AUXIN RESPONSE FACTOR 2) 의 DNA 결합력과전사인자능력을상쇄시킴으로써기능을억제한다는사실을규명하였다 (Vert et al. 2008). 이러한결과를바탕으로 BIN2 에의한 ARF2 의억제효과가최종적으로는브라시노스테로이드와옥신신호전달과의상호보완적인연관성에대한의문이어느정도풀리게되었다. 하지만브라시노스테로이드신호전달에서 BIN2 의음성적조절효과와옥신신호전달에서의양성적조절인자효과에대한상보적인결과는논란으로이어지고있다. Cho et al. (2014) 은식물의곁뿌리형성과정에서 BIN2 에의한 ARF7 과 ARF19 의활성화기작을보고하였다 (Cho

8 J Plant Biotechnol (2015) 42:1 5 3 et al. 2014). BIN2 에의한 ARF7 의 S698/S707 아미노산의직접적인인산화를확인하였고, 인산화는 AUX/IAA 와의결합력을현저하게낮춰주면서옥신신호전달의전사인자로서의기능을높이는기작을보고하였다. 또한 BIN2 의조절기작이브라시노스테로이드신호전달과는별개로 TDIF/TDR (TDIF RECEPTOR) 경로를통해이뤄짐이확인되었다 (Cho et al. 2014). 현재까지 BIN2 의인산화효소기능이조절되는기작은브라시노스테로이드에의한조절이유일했지만, TDIF/TDR 경로가곁뿌리의발달에긴밀하게작용하고있음이확인되었다. ABA 와스트레스반응 초기식물에서의 GSK3 의기능연구들은스트레스내성과긴밀한관계가존재하고있을가능성을제기하고있다 (Jonak et al. 1995; Jonak and Hirt 2002). 특히염스트레스에의해식물의 GSK3 유전자들 (AtSK13, AtSK31, AtSK42) 의발현이강하게증가됨이보고되었다 (Charrier et al. 2002). 최근연구는 AtSK11 에의한 G6PD 단백질의인산화가직접적으로염스트레스에의해조절되는세포내산화과정을조절하는주요기작이라는연구결과가발표되었다 (Dal Santo et al. 2012). 식물의 GSK3 가스트레스반응성및 ABA 신호전달에관련되어있다는사실은 BIN2 의 gain-of-function 돌연변이 bin2-1 에서더욱분명하게발견되었다. bin2-1 에서 ABA 에대한반응성이매우강하게나타난다는사실이보고되었으며 (Li and Nam 2002), bin2-3 bil1 bil2 triple knock-out 돌연변이체에서는 ABA 에대한반응성이매우낮게나타남이보고되었다 (Cai et al. 2014; Ryu et al. 2014). 즉 BIN2 인산화효소의기능이 ABA 신호전달에양성적으로관여하고있음을의미하고있다. 이러한원인에대한분자기전이최근연구에의해보고되었다. Cai et al. (2014) 은 BIN2 에의해 ABA 신호전달에관여하는인산화효소 SnRK2.2 (SNF1-RELATED PROTEIN KINASE 2.2) 와 SnRK2.3 (SNF1- RELATED PROTEIN KINASE 2.3) 이인산화가이뤄지며, 이러한인산화는 ABA 신호전달의활성화에직접적인작용을하고있음이보고되었다 (Cai et al. 2014). 특히 SnRK2.3 의인산화좌는 S172, S176, S177 과 T180 으로규명되었고, 이러한인산화좌는다른 SnRK2 의유전자에도진화적으로보존되어져있다는사실이알려졌다. 이러한결과는 BIN2 또는다른식물 GSK3 에의해 SnRK 단백질의인산화가더이뤄질수있음을의미하며, 다양한신호전달과매우밀접하게관련되어져있을가능성을보여주고있다. 물기관이다. 생체막에존재하는수용체단백질 ERECTA 의활성화에의해개시되는기공발달은 YODA 에의해활성화되는 MAPK (MITOGEN-ACTIVATED PROTEIN KINASE KINASE KINASE) 신호전달이매우중요하게관여하고있는것으로잘알려져있다 (Bergmann and Sack 2007; Lampard and Bergmann 2007). 최근연구들은식물의 GSK3 에의해유도되는인산화과정이기공발달에매우긴밀하게작용하고있음을보여주고있다. Kim et al. (2012) 과 Khan et al. (2013) 은 BIN2 에의한직접적인 YODA 와하위 MAPKK4/5 의인산화를규명하였다 (Khan et al. 2013; Kim et al. 2012). 이러한주요기공발달신호전달단백질들의인산화는기공발달을촉진시키는것으로규명되었다 (Kim et al. 2012). 이러한 BIN2 의기공발달활성화기작은브라시노스테로이드에의해식물의잎에서음성적으로조절된다는것이보고되었다. 하지만 Gudesblat et al. (2012) 이러한결과와는상반된연구결과를발표하였다 (Gudesblat et al. 2012). 브라시노스테로이드합성돌연변이의하배축에서기공의발달이현저히감소되어있다는것이발견되고, 이러한원인은 BIN2 에의한기공발달신호전달의주요전사인자 SPCH 의인산화임이알려졌다 (Gudesblat et al. 2012). 이러한상반된결과는식물의발달과정에서서로다른신호전달경로를통해매우중요한조절이이뤄질수있음을의미한다. 향후좀더자세한연구를통해다양한식물의발달프로그램과 GSK3 가어떠한상호작용을일으키는지에대한해답을제시해야할것이다. 결론 본논문을통해식물의발달및호르몬신호전달과정에서 GSK3 에의해유도되는다양한유전자들의인산화를조사하였다. 주요발달프로그램및호르몬신호전달에서다양한단백질이 GSK3 의타겟이되고있으며, 인산화에의한유전자들의기능이매우견고하게조절되고있음을확인할수있었다 (Fig. 1). 하지만현재까지의연구 GSK3 와기공발달 식물의기공은광합성을의해필요로하는 CO 2 의흡수뿐만아니라수분조절등에매우중요하게작용하고있는식 Fig. 1 Plant GSK3 mediated signaling network reviewed in this work

9 4 J Plant Biotechnol (2015) 42:1 5 는대부분이 BIN2 및그룹 Ⅱ 에속하는 BIL1, BIL2 에의한인산화과정이주대상이되어왔다. 하지만모델식물애기장대에는총 10 개의 GSK3 유전자가존재하며, 대부분의식물에서도많은수의 GSK3 유전자를지니고있음이최근알려지고있다. 즉현재까지알려진 BIN2 에의해조절되는다양한신호전달경로이외에도다양한 GSK3 에의해정교하게조절되는발달프로그램이매우다양하게존재하고있음을의미한다. 본논문을통해확인할수있듯이주요유전자들의인산화는식물의생장및발달에매우중요한역할을담당하고있다. 특히동물에서는 2 개의 GSK3 가암, 발달, 생식, 세포분열등매우중요한역할을담당하고있다는사실은매우고무적인것이다. 식물의경우에는좀더많은수의 GSK3 들이존재하면서, 아마도식물발달및생장을체계적으로조절할것으로예상된다. 좀더심층적이고체계적인연구를통한 GSK3 유전자의기능연구는식물을통한생명현상의이해뿐만아니라다양한생명공학적인접근을통한작물개량에매우중요한정보를제공해줄수있으리라판단된다. 사사 본연구는 2014 학년도충북대학교학술연구지원사업의연구비지원과정부 ( 미래창조과학부 ) 신진연구지원사업 (NRF-2013R1A1A ) 지원에의해연구되었음. References Bergmann DC, Sack FD (2007) Stomatal development. Annu Rev Plant Biol 58 : Cai Z, Liu J, Wang H, Yang C, Chen Y, Li Y, Pan S, Dong R, Tang G, Barajas-Lopez Jde D, Fujii H, Wang X (2014) GSK3-like kinases positively modulate abscisic acid signaling through phosphorylating subgroup III SnRK2s in Arabidopsis. Proc Natl Acad Sci USA 111 : Charrier B, Champion A, Henry Y, Kreis M (2002) Expression profiling of the whole Arabidopsis shaggy-like kinase multigene family by real-time reverse transcriptase-polymerase chain reaction. Plant Physiol 130 : Cho H, Ryu H, Rho S, Hill K, Smith S, Audenaert D, Park J, Han S, Beeckman T, Bennett MJ, Hwang D, De Smet I, Hwang I (2014) A secreted peptide acts on BIN2-mediated phosphorylation of ARFs to potentiate auxin response during lateral root development. Nat Cell Biol 16 : Choe S, Schmitz RJ, Fujioka S, Takatsuto S, Lee MO, Yoshida S, Feldmann KA, Tax FE (2002) Arabidopsis brassinosteroidinsensitive dwarf12 mutants are semidominant and defective in a glycogen synthase kinase 3beta-like kinase. Plant Physiol 130 : Dal Santo S, Stampfl H, Krasensky J, Kempa S, Gibon Y, Petutschnig E, Rozhon W, Heuck A, Clausen T, Jonak C (2012) Stress-induced GSK3 regulates the redox stress response by phosphorylating glucose-6-phosphate dehydrogenase in Arabidopsis. Plant Cell 24 : Gudesblat GE, Betti C, Russinova E (2012) Brassinosteroids tailor stomatal production to different environments. Trends Plant Sci 17 : Gudesblat GE, Schneider-Pizon J, Betti C, Mayerhofer J, Vanhoutte I, van Dongen W, Boeren S, Zhiponova M, de Vries S, Jonak C, Russinova E (2012) SPEECHLESS integrates brassinosteroid and stomata signalling pathways. Nat Cell Biol 14 : Guilfoyle T (2007) Plant biology: sticking with auxin. Nature 446 : Guilfoyle TJ, Hagen G (2007) Auxin response factors. Curr Opi Plant Biol 10 : He JX, Gendron JM, Yang Y, Li J, Wang ZY (2002) The GSK3-like kinase BIN2 phosphorylates and destabilizes BZR1, a positive regulator of the brassinosteroid signaling pathway in Arabidopsis. Proc Natl Acad Sci USA 99 : Jonak C, Heberle-Bors E, Hirt H (1995) Inflorescence-specific expression of AtK-1, a novel Arabidopsis thaliana homologue of shaggy/glycogen synthase kinase-3. Plant Mol Biol 27 : Jonak C, Hirt H (2002) Glycogen synthase kinase 3/SHAGGY-like kinases in plants: an emerging family with novel functions. Trends Plant Sci 7 : Khan M, Rozhon W, Bigeard J, Pflieger D, Husar S, Pitzschke A, Teige M, Jonak C, Hirt H, Poppenberger B (2013) Brassinosteroid-regulated GSK3/Shaggy-like kinases phosphorylate mitogen-activated protein (MAP) kinase kinases, which control stomata development in Arabidopsis thaliana. J Biol Chem 288 : Kim TW, Michniewicz M, Bergmann DC, Wang ZY (2012) Brassinosteroid regulates stomatal development by GSK3-mediated inhibition of a MAPK pathway. Nature 482 : Kutschera U, Wang ZY (2012) Brassinosteroid action in flowering plants: a Darwinian perspective. J Exp Bot 63 : Lampard GR, Bergmann DC (2007) A Shout-Out to Stomatal Development: How the bhlh Proteins SPEECHLESS, MUTE and FAMA Regulate Cell Division and Cell Fate. Plant signaling & behavior 2 : Lau S, Jurgens G, De Smet I (2008) The evolving complexity of the auxin pathway. The Plant cell 20 : Li J, Nam KH (2002) Regulation of brassinosteroid signaling by a GSK3/SHAGGY-like kinase. Science 295 : Ryu H, Cho H, Bae W, Hwang I (2014) Control of early seedling development by BES1/TPL/HDA19-mediated epigenetic regulation of ABI3. Nature Commun 5 : 4138 Ryu H, Cho H, Kim K, Hwang I (2010) Phosphorylation dependent nucleocytoplasmic shuttling of BES1 is a key regulatory event in brassinosteroid signaling. Mol Cells 29 : Ryu H, Kim K, Cho H, Park J, Choe S, Hwang I (2007) Nucleocytoplasmic shuttling of BZR1 mediated by phospho-

10 J Plant Biotechnol (2015) 42:1 5 5 rylation is essential in Arabidopsis brassinosteroid signaling. Plant Cell 19 : Saidi Y, Hearn TJ, Coates JC (2012) Function and evolution of 'green' GSK3/Shaggy-like kinases. Trends Plant Sci 17 : Sutherland C (2011) What Are the bona fide GSK3 Substrates? Inter J Alzheimer's Disease 2011 : Tang W, Deng Z, Oses-Prieto JA, Suzuki N, Zhu S, Zhang X, Burlingame AL, Wang ZY (2008) Proteomics studies of brassinosteroid signal transduction using prefractionation and two-dimensional DIGE. Mol Cell Proteom : MCP 7 : Vert G, Walcher CL, Chory J, Nemhauser JL (2008) Integration of auxin and brassinosteroid pathways by Auxin Response Factor 2. Proc Natl Acad Sci USA 105 : Yin Y, Vafeados D, Tao Y, Yoshida S, Asami T, Chory J (2005) A new class of transcription factors mediates brassinosteroidregulated gene expression in Arabidopsis. Cell 120 : Zhang D, Chen ZG, Liu SH, Dong ZQ, Dalin M, Bao SS, Hu YW, Wei FC (2013) Galectin-3 gene silencing inhibits migration and invasion of human tongue cancer cells in vitro via downregulating beta-catenin. Acta Pharm Sinica 34 :

11 J Plant Biotechnol (2015) 42:6 12 DOI: ISSN Review 약용작물의기원판별에관한분자생물학적기술개발현황 한은희 김윤희 이신우 Development of molecular biological techniques for the differentiation of medicinal plant species Eun-Heui Han Yun-Hee Kim Shin-Woo Lee Received: 5 March 2015 / Revised: 15 March 2015 / Accepted: 15 March 2015 c Korean Society for Plant Biotechnology Abstract Medicinal plants resources are becoming important assets since their usages have been expanded to the development of functional foods for human health, more attractive cosmetics, and pharmaceutical industries. However, their phylogenetic origins and names are different from each country and quite often they are mixed each other resulting in the confusion for consumers. In particular, when they are very similar based on their morphological characteristics and distributed as dried roots, it is extremely difficult to differentiate their origins even by specialists. Recently, DNA barcodes have been extensively applied to identify their origin of medicinal plant species. In this review, we tried to overview the current research achievements for the development of suitable DNA barcodes regarding to the differentiation of medicinal plant species. Furthermore, more advanced techniques including amplification refractory mutation system (ARMS)-PCR, multiplex single base extension (MSBE), high-resolution melting (HRM) curve analyses are also discussed for their practical applications in the authentification of particular medicinal plant species. E.-H. Han S.-W. Lee ( ) 경남과학기술대학교, 생명과학대학, 농학ㆍ한약자원학부 (Dept. of Agronomy & Medicinal Plant Resources, Gyeongnam National University of Science & Technology, JinJu, Korea) shinwlee@gntech.ac.kr Y.-H. Kim 경상대학교, 사범대학, 생물교육과 ( 농업생명과학연구원 ) (Dept. of Biology Education, College of Education, IALS, Gyeongsang National University, Jinju, Korea) 서론 최근약용작물은기존에이용되던한약재뿐만아니라기능성식품, 화장품, 의약품등의원료로그용도가점차확대됨으로서수요가기하급수적으로늘어나고있는실정이며가격또한상승하고있는실정이다. 그러나우리나라는수입에의존도가높아이러한한약재의수급불균형이발생할가능성이높다. 또한한약재의경우유통과정에서그기원이부정확하거나명칭이유사하여혼 오용되는사례가많다. 특히국가별로한약재를약으로사용하면서약용식물의기원을다르게규정하고있어우리나라는한약재의정확한기원을모르고위품이시장에유통되는경우가많아유통질서가제대로확립되지않아향후중국과일본등 3 국간에분쟁우려가많이발생할것으로우려되고있다. 기존의관능검사, 형태학적, 이화학적, 세포생화학적검사법등에의존하기보다는보다과학적인진보된기술의도입이시급한실정이다. 이러한문제점을해결하기위하여 Restriction Fragment Length Polymorphism (RFLP), Random Amplified Polymorphic DNA (RAPD), Amplified Fragment Length Polymorphism (AFLP), Sequence Characterized Amplified regions (SCARs), Cleaved Amplified Polymorphic Sequence (CAPS), Amplificon Length Polymorphism (ALP), Sequence Tagged Site-Restriction fragment Length Polymorphism (STS-RFLP) 등의분자생물학적기술을적용하기위하여지난수년간많은연구자들에의하여수행되어왔으나아직까지반복성과신뢰도등의문제점으로인하여실제한약재의위품을구분하기에유용한기술의개발은아직미진한실정이다. 따라서최근에는단일염기다형성 (single nucleotide polymorphism, SNP) 을보이는부분을이용하는 DNA barcodes 의개발에관한연구에많은관심을갖게되었다. DNA barcodes

12 J Plant Biotechnol (2015) 42: 라는용어는 Arnot et al. (1993) 에의하여처음사용되었으며, 그후 Hebert et al. (2003) 에의하여 cytochrome C oxidase 유전자단편을이용한동물의 barcoding 에관한논문의발표와함께전성기를맞이하였다. 이후 Consortium for the Barcode of Life (CBOL, 가조직되어국제적인 DNA barcoding 연구가활성화되기시작하였다. 그러나아직까지도동물의 barcode 는미토콘드리아 cytochrome C oxidase I (COI) 유전자에해당하는 658bp 가가장유효한것으로결정될수있었으나식물의경우에는논란이많고 COI 처럼대표할수있는 barcode 가없는실정이다. 최근에는 Next Generation DNA Sequencing (NGS) 기술의급속한발전과함께생물다양성의유지보존과관련된자연생태계에서채취한샘플중에서단일종의판별, 다양한가공기술에의하여개발된가공식품에포함된단일종의판별, GMO 의혼재여부판별등다양한분야에응용될수있는기술의개발에관한연구가활발하게보고되고있다 (Valentini et al. 2008). 따라서본리뷰논문에서는최근까지보고된주요약용작물특히향후중국, 일본등과국가간분쟁의우려가높은것으로사료되는하수오, 당귀등의주요약용작물을중심으로그기원을판별하기위하여사용된분자생물학적기술 (DNA barcoding 등 ) 에관하여기술의원리, 성과, 실용화가능성그리고향후문제점등을정리하여보았다. 식물의분류에이용되는 Barcodes 개발현황 DNA barcoding 에있어서 3 가지주요원칙은표준화 (standardization), 최소화 (minimalism), 응용범위 (scalability) 이라고기술된바있다 (Hollingsworth et al. 2011). 동물의경우에는 COI DNA barcode 가이원칙에아주적절한것으로확인되었다 (Hebert et al, 2003). 그러나식물의경우에는엽록체의게놈에존재하는 rpoc1, rpob, matk, trnh-psba, rbcl, atpf-h, psbki 유전자등에관한많은연구결과가발표되었으나, 현재까지의연구결과에의하면한가지만으로는충분하지않으며이들중여러개를복합적으로비교분석한결과어느정도만족할만한결과를얻었다고하였다. 예를들면 rpoc1+rpob+matk 또는 rpoc1+matk+ trnh-psba (Chase et al, 2007); rbcl+trnh-psba (Kress and Erickson, 2007) 등의조합에의하여어느정도분류가가능하였다고하였다. 또한 CBOL 의 Plant working group 의검토결과에의하면 rbcl 과 matk 를조합한경우에가장좋은결과를얻을수있었으며이조합을 core barcode 로정한바있다 (CBOL, 2009). matk 와 rbcl barcode 는모두애기장대 (Arabidopsis thaliana) 의엽록체게놈의염기서열로부터프라이머를디자인하여전장의유전자단편을 polymerase chain reaction (PCR) 로증폭하여얻은단편을염기서열로확인한것이다. 식물 체의 matk 유전자는진화속도가가장빠른것으로알려져있어동물의 COI barcode 와가장유사한것이다. 그러나불행하게도애기장대에서디자인한프라이머가모든식물의 matk 유전자를증폭시킬수있는광역프라이머로사용될수없다는게단점이다. 따라서 clade-specific primer 또는 phylogenic tree 상에서보다가까운그룹에서디자인한프라이머세트를다시개발하여사용하여야한다 (Wickie et al. 2009; Dunning et al. 2010; Kuo et al. 2011). 반면에 rbcl 프라이머는비교적넓은범위의식물종을대상으로 PCR 증폭이가능하나그만큼상동성이높아다형성 (polymorphism) 을많이나타내지않는것이단점이라고알려져있다. 한편 rbcl+matk core barcode 에이어그다음으로많이연구되어온엽록체 barcodes 는 trnh-psba 의유전자간 DNA (IGS, intergenic spacer) 영역이다. 이 barcodes 를사용하여 Ficus (Roy et al. 2010), Alnus (Ren et al. 2010), Quercus (Piredda, 2010) and Salix (von Cräutlein et al. 2011) 속의종간구분에는오히려 rbcl+matk core barcode 보다좋은결과를보였다고하였다. 또한 trnl intron 지역그리고 trnl 과 trnf 사이의 IGS 영역역시많은연구대상이되어왔다. 특히 trnl intron 에는작은 stem-loop 구조를하고있어이지역주변의잘보존되어있는양쪽에서디자인한프라이머세트로증폭하여이영역을 minibarcode 화하여아주유용하게사용될수있을것이라고주장된바도있다 (Valentini et al. 2009). 약용작물의분류및위품판별을위한 barcodes 개발현황 이미전술한바와같이약용작물의경우에는국가별로명칭이다르고서로혼재하여사용되는경우가많으며, 모양이나형태가유사한것을위품으로유통되는경우가많다. 특히건조된뿌리나약간의 1 차가공과정만하여도전문가가아닌일반인은구분을할수없어서시중에유통되는이들위품을판별하기위한 barcodes 를개발한다면그응용성은무한할것으로사료된다. 따라서약용작물의구분을위한 barcodes 의개발은핵내라이보좀구성 RNA 를암호하는 (nuclear ribosomal) DNA 의 internal transcribed spacer region (ITS1 과 ITS2) 과염록체게놈의여러가지 DNA 단편을이용하여연구되어왔다. 먼저 ITS 를이용한연구현황을 Table 1 에요약하였다. 감초등이속하여있는콩과 (Fabaceae) 에해당하는약용작물들의 ITS2 영역을 PCR 로증폭하여염기서열분석결과를비교하여종내에는평균 1.7% 의변이를보이고전체적으로는 0 에서 14.4% 까지변이를보였다고하였다. 종간에는 0 에서 63% 까지의변이를보여평균 8.6% 의변이를보였다고하였다. 따라서시중에유통되는위품들의판별에도유용하게사용될수있었다고보고된바있다

13 8 J Plant Biotechnol (2015) 42:6 12 Table 1 List of medicinal plant species that have been differentiated by using internal transcribed spacer (ITS) of nuclear ribosomal DNA as a barcode Family/genus/species References Comments Fabaceae (Leguminosae) 753 genera 4,800 species Gao et al Chen et al (Licorice) Glycyrrhiza uralensis polymorphism (92.7%) 50,790 plants 12,221 animals Yao et al Angelica species He et al Breeae & Cirsii herba Moon et al Angelica species Kim et al Schizonepta spike Baigalmaa et al Hyung-Gae Fallopia multiflora Sun et al Cnidii Rhizoma Song et al Fallopia multiflora Zheng et al Ligusticum chuanxiong hort vs Cnidium officinale Makino Liu et al primer design for differentiation by PCR Chinese Chuanxiong vs Japan Chuanxiong (Gao et al. 2010). Chen 등 (2010) 은 753 속 4,800 종에해당하는방대한시료에대하여 ITS2 영역의염기서열을분석한결과 92.7% 에해당하는종의구분이가능하여약용식물의종간구분을위한범용바코드로지정하자고제의를하였다. 또한 Yao et al. (2010) 도 50,790 종의식물과 12,221 종의동물에대하여 ITS2 영역의염기서열을비교분석한결과 67 ~ 91% 까지종의구분이가능하였으며여기에다가 ITS2 영역의 secondary structure 를이용하면범용으로사용될수있는식물용 barcode 로의사용가능성을제시하였다. 또한 He 등 (2011) 도당귀속에속하는다양한종에대하여 ITS 지역의염기서열을비교하여 phylogenic tree 를제작하여유연관계를분석할수있었다고하였다. 특히중국의시중에서말린뿌리상태로유통되어구분이어려운당귀시료들을시중에서수집하여조사한결과일부위품의판별이가능하였다고하였다. Kim 등 (2012) 도 ITS 지역을이용하여분석한결과토당귀와일당귀가중국당귀보다유연관계가가까운것으로조사되었으며, 한 중 일 3 국에서각기다른기원종으로규정하고있는당귀 ( 當歸 ) 류의구별을위해시중에서유통중인당귀 ( 當歸 ) 를종별로 3 점씩, 총 9 점을구입하여미각패턴과 ITS DNA 의염기서열을비교한결과일치하는결과를얻었다고보고하였다 (Kim et al. 2012). 천궁역시 ITS1 과 ITS2 유전자단편의염기서열을비교 Table 2 Chloroplast barcodes for the differentiation of medicinal plant species Family/Genus/Species Chloroplast barcodes References Polygonaceae rbcl, trnh-psba, ndhj, rpob, rpoc, accd Song et al Cnidium officinale, trnk Ligusticum chuanxiong Zhu et al Breeae, Cirsii herba matk, rbcl Moon et al 2013 Pinellia species matk, rbcl Lee et al Fallopia multiflora (Thumb) Harald matk, rbcl, psba-trnh Sun et al Fagopyrum species trnk, matk Ohsako & Ohnishi,2001 Cnidium officinale, matk Ligusticum chuanxiong Liu et al Fallopia multiflora (Thumb) Harald matk Yan et al Liriope platyphylla Wang et Tang, Phiopogon japonicus Ker-Gwaler rpoc1 Park et al 분석한결과토천궁과일천궁, 중국천궁은모두천궁속 (Cnidium) 보다는고본속 (Ligusticum) 과같은분계조를형성하고있는것으로나타났으며, 또한한국산천궁과중국산천궁의두집단간에식별이가능한 SNPs (Single nucleotide polymorphisms) 를확보하여서로간에구분이가능하였다고함 (Song et al. 2009). Baigalmaa et al. (2009) 은 26 계통의형개 (Schizonepeta spike) 로알려진한약재시료를채취하여 ITS 영역의염기서열을분석하여비교한결과 Schizonepeta tenuifolia plants 로표기된 9 종은모두진품으로판명할수있었다고보고하였다. 또한 Song et al. (2009) 은일천궁, 토천궁, 중국천궁을수집하여 ITS 영역의염기서열을분석한결과이들을구분할수있는 SNP 들을확인할수있었다고하였다. 이외에도 6 계통의 Fallopia multiflora 에속하는시료를대상으로 ITS 영역의 SNP 를구분할수있는 primer 를디자인하여위품으로부터종을판별하는데성공하였다고보고한바있다 (Zheng et al. 2009). 또한중국의 Liu 등도이미 2002 년도에일본천궁 (Cnidium officinale Makino) 과중국천궁 (Ligusticum chuanxiong Hort) 의 ITS 영역의염기서열을조사한결과단한개의염기치환이있었다고보고하였다 (Liu et al. 2002). 다음으로엽록체 barcodes 의개발을위한연구를 Table 2 에요약하였다. 이들을검토하여보면적하수오등이속한붉은조롱과 (Polygonaceae) 약용작물을위품으로부터판별하기위하여 18 종에속하는 38 계통에대하여 6 가지의엽록체 barcodes 와핵내존재하는 ITS 등을 PCR 로증폭한다음염기서열을분석하여조사한결과 trnh-psba 가가장

14 J Plant Biotechnol (2015) 42: 높은다양성을보였고 (20.05%), 위품에해당되는유사약용작물들을쉽게판별할수가있었다고보고하였다 (Song et al. 2009). 대계 ( 大薊 ) 와소계 ( 小薊 ) 의기원종을구분하기위하여 rdna-its, matk 및 rbcl 부위 DNA 바코드분석을수행한결과 ITS 가가장많은다형성을보여이들의구분은물론위품인 Carduus 속의지느러미엉겅퀴를종단위에서감별할수있었다고보고하였다 (Moon et al. 2013). 반하 ( 半夏 ) 의기원식물을구분하기위하여 Pinellia ternata, Pinellia pedatisecta, Pinellia tripartita, Typhonium flagelliforme 에속하는 19 계통을채취하여 matk 와 rbcl 두유전자영역의염기서열을비교한결과, matk 유전자영역에서 rbcl 유전자보다반하류의종감별에유용한 SNP 를다수포함하고있어 matk 유전자가 rbcl 유전자보다반하류의종감별에더유용한 DNA 바코드로이용될수있을것으로사료된다고보고하였다 (Lee et al. 2013) 또한 Sun et al. (2013) 은 Fallopia multiflora 종에속하는계통들을중국의 17 성에서서식또는재배되고있는야생종과재배종으로부터 105 계통을수집하여 matk, rbcl, psba-trnh 그리고 ITS barcodes 들을사용하여분석한결과 psba-trnh 가가장양호한결과를보였으며이들 4 가지 barcodes 를조합하여보다판별효율을증진시킬수있었다고하였다. 또한 trnk 와 matk 영역을이용하여 Polygonaceae 과의메밀속 (Fagopyrum) 에속하는 F. leptopodum 종으로알려진 10 계통과과 F. statice 종으로알려진 5 계통을대상으로분석한결과상호간에 9 개의염기치환이있었음을확인하고구분이가능하였다고하였다 (Ohsako & Ohnishi 2001). 이외에도중국천궁과일본천궁의 matk 영역을비교분석한결과단하나의염기치환을확인하였다고하였으며 (Liu et al. 2002), 중국에서만서식하는것으로알려진중국토종인 Fallopia multiflora (Thumb) Harald 의 matk 영역의염기서열을이용하여위품을구분할수있는 SNP 를확인할수있었다고하였다 (Yan et al. 2008). 뿐만아니라국내외에서수집된 26 계통의맥문동에대하여 rpoc1 유전자의염기서열을비교분석하여 SNP 를확인하고이들을판별할수있는프라이머까지개발하여국내특허를획득한것으로알려졌다 (Park et al. 2014). DNA barcodes 를이용한진보된기술의개발현황 전술한바와같이 DNA barcodes 는 SNPs 를찾아내어상호간에구분을하는기술로고도로전문화된전문가가필요하다. 따라서보다단순화되고효율적으로반복이가능하고저렴한가격에수행할수있는기술들을개발하여현장에서실용화가가능하여야한다. 이러한관점에서가장쉬운방법은 SNP 를포함하는프라이머를제작하여 PCR 에의하여증폭되는단편을전기영동하여밴드의유무로판단하는것일것이다. 그러나대부분의경우 Table 3 Advanced techniques for the identification of medicinal plant species Techniques Target regions Family/Genus /Species ARMS-PCR Chs Panax ginseng MSBE HRM trnk ITS, trnl-f, rpl36-ps8 matk ITS2 Chloroplast IGS(62) Cnidium officinale Ligusticum chuanxiong Berry species Hellevorous niger Veratrum niger Sideritis species References Yang et al KR Patent Zhu et al Jaakola et al Mader et al Kalivao et al Panax species Kim et al 2013 에단하나또는두개의염기서열의차이가나는프라이머를제작하여 PCR 을수행하였을경우에도동일한 PCR 산물을생산하기때문에보다정밀한기술이필요하다. 현재까지이러한진보된기술을이용하여약용작물에적용한사례들을요약하여보면 Table 3 과같다. Amplification refractory mutation system (ARMS) 일반적으로 PCR 은 3 - 말단의염기가주형과완전히일치할때에가장확실하게이용될수있는기술이다. 그러나실제로는 3 - 말단의염기가하나혹은두개틀려도 PCR 로증폭이가능하기때문에판별이어려운경우가대부분이다. 따라서 ARMS-PCR 은이러한문제점을극복하기위하여 SNP 에가장가깝게인접한 2, 3 번째염기서열을변경하여 SNP 프라이머의특이성을높이고자하는기술이다. 실제로인삼의경우금품종과청선종에만유일하게나타나는 SNP 를포함하는프라이머를제작하여 ARMS-PCR 을수행한결과다른인삼품종과구분이가능한특정밴드를생산할수있었다. 이때프라이머는 SNP 가 3 - 말단에위치하게하고그로부터 5 - 쪽으로 3 번째의염기서열을변이가일어나도록디자인하여금품종과청선종은한개의염기서열이차이가있으나다른품종들은두개의염기서열이차이가나게하여 PCR 을수행하였을경우보다확실하게밴드의유무를확인할수있는결과를얻어이기술을특허로등록하였다 (Yang et al. 2012). ARMS 기술은 Newton et al.(1989) 에의하여처음보고된기술로서, 기본적으로는 allele-specific (AS)-PCR 기술이다. 그러나예를들어 G 가 C 로점돌연변이 (point mutation) 가일어난경우에 ARMS primer 의 3 - 말단은 G 가되어야치

15 10 J Plant Biotechnol (2015) 42:6 12 Table 4 The strength of mismatch pairings (Little, 1994) Strength Maximum Strong Medium Weak None Mismatch types G-A, C-T, T-T C-C A-A, G-G, C-A, G-T A-T, G-C 환된 C 와결합이될것이다. 하지만이프라이머는정상적인유전자단편과도 G-G mismatch 결합이가능하며이는약한 mismatch 이어서 primer 의 extension 을효율적으로저해하지못하여 PCR 반응에의하여증폭된동일한크기의밴드를형성한다. 다만강한 mismatch 에해당하는 C-C, G-A, A-A 의경우에만 100% 또는 95% 까지염기서열의합성을저해할수있다. 따라서 3'- 말단의 SNP 위치에서 2, 3, 4 번째에 C-C, G-A, A-A mismatch 염기를도입하여제작한프라이머를사용하여 PCR 증폭을 100% 저해할수있도록고안한기술이다. 일반적으로 3'- 말단의 SNP 가약하면두번째 mismatch 는강한것으로디자인한다. 그리고두번째것을디자인하여결과를보고세번째염기를변경하도록디자인것을시도한다. Litte(1994) 는 mismatch 결합의강약을 Table 4 와같이보고하였으며이들조합을적당하게사용하여프라이머를제작하여몇번의시도를거쳐가장적당한조건을설정하는것이중요하다고하였다. Multiplex Single base Extension (MSBE) 분석기술 이기술은일종의 mini-sequencing 기술로분석하고자하는 SNP 를포함하는부위를증폭한다음 dntp 와프라이머를제거한후 SNP 바로앞부분까지를포함하는프라이머 (extension primer) 를넣고형광색소로표지된 ddntp 를이용하여하나의염기만신장시킨다. 이렇게하면서로다른형광색을나타내는 ddntp 중하나만신장하고반응은종결되며이를자동염기서열분석장치를이용하여분석하는기술이다. 따라서이기술은여러종의 SNP 를포함하는부위를이용하여길이가서로다른여러개의 extension primer 를사용하면 2 종이상의시료가혼재되어있을경우에이들을구분하기에용이한기술이다. 약용작물에이용된사례로는천궁즉 Cnidium officinale ( 일본에서사용되는천궁학명 ) 과 Ligusticum chuanxiong ( 중국에서사용되는천궁학명 ) 을확실하게구분이가능하였다고하였다. 보다자세하게살펴보면이들의속간구분을위하여엽록체유전자인 trnk 유전자의염기서열을비교분석하여상류 (upstream) 에서각각 767, 924, 964 번째염기서열에해당하는위치에서나타나는 SNP 를확인하 고, 이위치에서각각 14mer, 23mer, 30mer 길이로디자인된프라이머를사용하여 multiplex single base extension (MSBE) 을수행하여두종을쉽게구분할수있었다고하였다 (Zhu et al. 2007). 또한이기술로 Dongxiong 이라고불리는중국의또다른지역에서재배되고있는천궁은그기원이 Cnidium officinale 인것으로판명할수있었다. 중국에서는천궁을 Chuanxiong 이라고부르며일본식발음으로는 Senkyu, 한국에서는천궁이라고부른다. 이들의외부형태학적인모양은유사하나그식물기원은서로다르다. 그러나 rbcl 유전자와 18S rrna 유전자의염기서열을조사한결과상호간에 100% 일치하여구분이불가능하였다고하였다 (Fushimi et al. 1997). High-resolution melting (HRM) curve 분석기술 post-pcr melting curve 분석기술은 SNP 를포함하는유전자단편을증폭시킨다음초당 0.5 ~ 1.0 C 씩온도를증가시키면서 melting curve 를조사하여그차이를이용하여종을판별하는기술이다. 주로 SYBR Green 이라는형광염색화합물을사용하는데이는이중나선 (dsdna) 을한 DNA 의 minor groove 에삽입되면서강한발색을나타낸다. PCR 로이중나선 DNA 를많이증폭하게되면그만큼상대적으로발색이강하여진다. 따라서 SYBR Green dye 를포함하는반응용액에서 PCR 로증폭시킨이중나선 DNA 를초당 0.5 ~ 1.0 C 씩온도를올리면서 melting curve 를보면초기에많은양의이중나선 DNA 가존재하기때문에강한발색에서온도를서서히상승하면서단일가닥으로 melting 되면서발색정도가서서히약하여진다. 이러한 melting curve 의굴곡의차이를갖고 data 를분석하거나또는시간별온도에대한음의형광값 (-df/dt) 으로계산하여얻은 melting peak 를갖고분석을한다. 그러나이기술로는아주적은수 ( 하나또는두개 ) 의 SNP 를구분할수없다는단점이있다. 따라서보다정밀하고효율이띄어난것으로알려진 High Resolution Melting (HRM) Curve analysis 기술이보고되었다. 이기술의기본원리는 post-pcr melting curve analysis 기술과동일하다. 그러나고농도에서도 DNA 중합효소의기능을저해하지않는형광색소인 LC Green PLUS, Eva Green, SYT09, ResoLight 등을사용하여모든증폭된 DNA 의전체길이에형광색소가삽입이될수있도록하고, 아주미세한단위즉초당 0.01 ~ 0.2 C 로온도상승조절이가능한특수기계 (High Resolution Melting Master, Roche Diagnostics GmbH, Mannheim, Germany 또는 SsofatTM EvaGreen supermix, BioRad Laboratories Inc., Hercules, CA, USA, Light Cycler R 480) 를사용한다. 이렇게하면하나의 SNP 차이도구분이가능하다. 따라서이기술은극도로민감하여해바라기, 땅콩, 옥수수, 참깨, 쌀등에서추출한기름에적

16 J Plant Biotechnol (2015) 42: 용하여상호간에구분이가능하다고보고하였다 (Vietina et al. 2013). 이러한연구결과는향후 HRM 기술의응용범위는각종한약재의가공품뿐만아니라한약재를이용한탕재등에적용하는등그응용범위가크게늘어갈것으로전망된다. ITS 영역또는엽록체 DNA 에해당하는 trnl-f, rpl36-ps8 영역을증폭하여얻은단편을대상으로 HRM 분석기술을적용한결과시중에유통되는야생형은물론다양한베리 (berry) 종들의판별이가능하였다고하였다. 특히불과 4 시간내에 DNA 시료를채취하여 HRM 분석까지마칠수있었다고하였다. 또한가공제품의원료로사용되는혼합시료로부터손쉽게특정종의존재여부를판별할수있었다고보고하며, 향후유통과정에서위품들을판별할수있는기술로크게이용될것이라고예견하였다 (Jaakola et al. 2010). 또한크리스마스장미라고불리는 Helleborus niger 와영국에서 Black Hellebore 로불리는 Veratrum niger 와시중에쉽게혼재하여유통되므로이들을구분하기위한 barcode 로 matk 영역을선택하여 HRM 기술을적용한결과 1 : 1,000 비율로모르는시료에혼재되어있거나 1 : 200,000 비율로 Veratrum niger 가혼재한경우에도판별이가능할정도로민감하였다고보고하였다 (Mader et al. 2011). 또한최근에는그리스의고산지대에서군락을이루고있는 Sidertis 종은약용식물로항균, 소염, 진정제로효과가띄어나차로애용되고있는식물인데다양한종류의종이자라며일부는약효가아주띄어나고일부는독성도있는것으로알려져이들을정확하게판별할수있는기술이필요하였다. 따라서 ITS2 영역에대한 HRM 분석기술을적용하여특별한처리과정이필요없고짧은시간에아주효율적으로서로간에구분이가능하였다고보고된바있다 (Kalivas et al. 2014). 또한인삼의엽록체게놈의모든유전자간 DNA 의염기서열을분석하고이들에대한 HRM 분석기술을적용하여본결과 62 개의 IGS 영역에서다형성을확인하였으며이중에서특히 trne-trnt, trnt-psbd, ndhfrpl32, rpl14-rpl16 spaces 가인삼종간에가장다양성이높게나타났으며, 분자시계 (molecular clocks) 를계산한결과 130 만년전에 P. notoginseng 이다른 Panax 종으로부터분지되었을것이라고추정하였다 (Kim et al. 2013). 사사 본연구는농림축산식품부농생명산업기술개발사업 ( 과제번호 : SB050) 에의해이루어진결과입니다. References Arnot DE, Roper C, Bayoumi RA (1993) Digital codes from hypervariable tandemly repeated DNA sequences in the Plasmodium falciparum circumsporozoite gene can genetically barcode isolates. Mol Biochem Parasitol 61:15-24 Baigalmaa J, Kim MK, Noh JH, Hua S, Yang DC (2009) Phylogenetic analysis of Schizonepeta Spike on the basis of DNA sequences. K J Med Crop Sci 17:46-53 CBOL Plant Working Group (2009) A DNA barcode for land plants. Proc Natl Acad Sci 106: Chase MW, Cowan RS, Hollingsworth PM, van den Berg C, Madriñán S, Petersen G, Seberg O, Jørgsensen T, Cameron KM, Carine M, Pedersen N, Hedderson TAJ, Conrad F, Salazar GA, Richardson JE, Hollingsworth ML, Barraclough TG, Kelly L, Wilkinson M (2007) A proposal for a standardised protocol to barcode all land plants. Taxon 56: Chen S, Yao H, Han J, Liu C, Song J, Shi L, Zhu Y, Ma X, Gao T, Pang X, Luo K, Li Y, Li X, Jia X, Lin Y, Leon C (2010) Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PLoS One 5:1-8, e8613 Dunning LT, Savolainen V (2010) Broad-scale amplification of matk for DNA barcoding plants, a technical note. Botanical J of the Linnean Society 164:1-9 Fushimi H, Komatsu K, Isobe M, Namba T (1997) A new approach for the identification of a Chinese traditional medicine, Chuanxiong by 18S ribosomal RNA gene sequences. Phytomedicin 3: Gao T, Yao H, Song J, Liu C, Zhu Y, Ma X, Pang X, Xu H, Chen S (2010) Identification of medicinal plants in the family Fabaceae using a potential DNA barcode ITS 2. J Ethnopharmacology 130: He Y, Hou P, Fan G, Song Z, Liu H, Li Y, Zhang Y (2011) Internal transcribed spacers (ITS) identification of Angelica anomala Lallem Chuanbaizhi (in Chinese) cultivars collected in Sichuan and their molecular phylogenetic analysis with other Angelica L. species. J Med Plants Res 5: Hebert PDN, Cywinska A, Ball SL, de Waard JR (2003) Biological identifications through DNA barcodes. Proc Royal Soc London, series B 270: Hebert PDN, Ratnasingham S, de Waard JR. (2003) Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proc Biol Sci 270:S96-99 Hollingsworth PM, Graham SW, Little DP (2011) Choosing and using a plant DNA barcode. PLoS One 6:e19254 Jaakola L, Suokas M, Haggman (2010) Novel approaches based on DNA barcoding and high-resolution melting of amplicons for authenticity analyses of berry species. Food Chem 123: Kalivas A, Ganopoulos I, Xanthopoulou A, Chatzopoulou P, Tsaftaris A, Madesis P (2014) DNA barcode ITS2 coupled with high resolution melting (HRM) analysis for taxonomic identification of Sideritis species growing in Greece. Mol Biol Rep 41: Kim JH, Jung JY, Choi HI, Kim NH, Park JY, Lee Y, Yang TJ (2013) Diversity and evolution of major Panax species revealed

17 12 J Plant Biotechnol (2015) 42:6 12 by scanning the entire chloroplast intergenic spacer sequences. Genet Resour Crop Evol 60: Kim YH, Choi G, Lee HW, Lee GH, Chae SW, Kim YH, Lee MY (2012) Comparison of Angelica species roots using taste sensor and DNA sequencing analysis. Kor J Herbology 27:37-42 Kress WJ, Erickson DL (2007) A two-locus global DNA barcode for land plants: The coding rbcl gene complements the non-coding trnh-psba spacer region. PLoS ONE 2: e508. Kuo LY, Li FW, Chiou WL, Wang CN (2011) First insights into fern matk phylogeny. Mol Phylo Evol 59: Lee YM, Moon BC, Ji Y, Kim WJ, Kim HK (2013) Molecular Authentication of Pinelliae Tuber from its adulterants by the analysis of DNA barcodes, matk and rbcl genes. Kor. J. Herbology 2013;28(6):53-58 Little S (1994) Amplification-refractory mutation system (ARMS) analysis of point mutations. In. current protocols in human molecular genetics. (Eds. Nicholas C Dracopoli et al.) Jhon Wiley & Sons, IOOnc. New York, pp Liu YP, Cao H, Han GR, Fushimi H, Komatsu K (2002) MatK ITS nucleotide sequencing of crude drug chuanxiong and phylogenetic relationship between their species from China and Japan. Yao Xue Xue Bao 37:63-68 Mader E, Ruzicka J, Schmiderer C, Novak J (2011) Quantitative high-resolution melting analysis for detecting adulterations. Anal Biochem 409: Moon BC, Lee YM, Ji Y, Choi G, Chun JM, Kim HK (2013) Molecular authentication and phylogenetic analysis of plant species for Breeae and Cirsii Herba based on DNA barcodes. Kor J Herbology 28:75-84 Newton CR, Graham A, Heptinstall LE (1989) Analysis of any point mutation in DNA. The amplification refractory mutation system(arms). Nucl Acids Res 17: Ohsako T, Ohnishi O (2001) Nucleotide sequence variation of the chloroplast trnk/matk region in two wild Fagopyrum (Polygonaceae) species, F. leptopodum and F. statice. Genes Genet Syst 76:39-46 Park YJ, Kwon SO, Park JW (2014) Identification method of Liriope species and identification probe thereof. Korea patent Piredda R, Simeone MC, Attimonelli M, Bellarosa R, Schirone B (2010) Prospects of barcoding the Italian wild dendroflora: oaks reveal severe limitations to tracking species identity. Mol Eco Ress 11:72-73 Ren BQ, Xiang XG, Chen ZD (2010) Species identification of Alnus (Betulaceae) using nrdna and cpdna genetic markers. Mol Eco Res 10: Roy S, Tyagi A, Shukla V, Kumar A, Singh UM, et al. (2010) Universal plant DNA barcode loci may not work in complex groups: A case study with Indian Berberis species. PLoS ONE 5: e13674 Song IG, An BR, Seo BI, Park SJ (2009) Molecular marker to identify and origin of Cnidii Rhizoma from Korea and China. Kor J Herbology 24:1-8 Sun XQ, Bai MM, Yao H, Gao JI, Li MM, Hang YY (2013) DNA barcoding of populations of Fallopia multiflora, an indigenous herb in China. Genet Mol Res 12: Valentini A, Pompanon F, Taberlet P (2008) DNA barcoding for ecologists. Trends Ecol Evol 24: Valentini A, Miquel C, Nawaz MA, Bellemain EVA, Coissac E, Pompanon F, Gielly L, Ruaud C, Nascetti G, Wincker P, Swenson JE, Taberlet P (2009) New perspectives in diet analysis based on DNA barcoding and parallel pyrosequencing: the trnl approach. Mol Ecol Res 9:51-60 Vietina M, Agrimonti C, Marmiroli N (2013) Detection of plant oil DNA using high resolution melting (HRM) post PCR analysis: A tool for disclosure of olive oil adulteration. Food Chem 141: von Cräutlein M, Korpelainen H, Pietiläinen M, Rikkinen J (2011) DNA barcoding: a tool for improved taxon identification and detection of species diversity. Biodiversity and Conservation 20: Wicke S, Quandt D (2009) Universal primers for amplification of the trnk/matk region in land plants. Anales del Jardín Botánico de Madrid 66: Yan P, Pang QH, Jiao XW, Zhao X, Shen YJ, Zhao SJ (2008) Genetic variation and identification of cultivated Fallopia multiflora and its wild relatives by using chloroplast matk and 18S rrna gene sequences. Planta Med 74: Yang DC, Wang HD (2012) SNP primers for Gumpoong and Chungsun selection of Korean ginseng (Panax ginseng C.A. Meyer) and method for Gumpoong and Chungsun distinciton using the same. KR patent Yao H, Song J, Liu C, Luo K, Han J, Li Y, Pang X, Xu H, Zhu Y, Xiao P, Chen S (2010) Use of ITS2 region as the universal DNA barcode for plants and animals. PLoS ONE 5:e13102 Zheng CJ, Zhao SJ, Zhao ZH, Guo J (2009) Molecular authentification of the traditional medicinal plant Fallopia multiflora. Planta Med 75: Zhu S, Fushimi H, Han G, Tsuchida T, Uno T, Takano A, Komatsu K, (2007) Molecular identification of Chuanxiong by nucleotide sequence and multiplex single base extension analysis on chloroplast trnk gene. Biol Pharm Bull 30:

18 J Plant Biotechnol (2015) 42:13 18 DOI: ISSN Research Article Absence of AVP1 transcripts in wild type watermelon scions grafted onto transgenic bottle gourd rootstocks Byung Oh Kim Jeung-Sul Han Kyung il Park Su Min Jeon Chang Kil Kim Received: 6 March 2015 / Revised: 15 March 2015 / Accepted: 15 March 2015 c Korean Society for Plant Biotechnology Abstract In this study we confirmed the stable integration of Arabidopsis AVP1 in the genomes of bottle gourd T 3 homozygous lines and its transcription, and additionally evaluated possibility of translocation of the AVP1 mrna from transgenic bottle gourd rootstocks to wild type watermelon scions. Each AVP1 gene in two bottle gourd T3 lines is abundantly expressed under a field condition. Given the grafting between wild type watermelon scions and AVP1- expressing bottle gourd rootstocks, no translocation of the AVP1 mrna was detected in leaves, both sexual flowers, and fruits of the scions. Keywords Bottle ground, Gene modified, Graft, RT-PCR, Watermelon Introduction Grafting is now a popular technique for the cultivation of the horticultural crops including cucurbitaceae fruit vegetables, which has been developed not only to control growth and development of the scion but also to enhance tolerance against soil-borne diseases and/or abiotic stresses, such as salinity, low temperature and drought (Jang et al. 2012; Kubota et al. 2008; Lee 1994). In some special regions, where land utility is B. O. Kim School of Food science & Biotechnology, Kyungpook National University, Daegu , Korea J.-S. Han Department of Ecological Environment, Kyungpook National University, Sangju , Korea K. I. Park Department of Horticulture & Life Science, Yeungnam University, Gyeongsan , Korea S. M. Jeon C. K. Kim ( ) Department of Horticultural Science, Kyungpook National University, Daegu , Korea ckkim@knu.ac.kr extremely limited, the allied crops are repeatedly cultivated all the year round (Kubota et al. 2008; Lee 1994), which increases specific pathogens and salinity of the rhizosphere. To overcome the disadvantages of the intensive cultivation, improvement of rootstocks by using genetic engineering is being attempted as a solution (Han et al. 2009; Smolka et al. 2010; Wang et al. 2012). Control of abiotic stresses is an important element to increase total yields in modern agriculture. Plants respond to various abiotic stresses by altering their turgor pressure in vacuoles in order to accomplish selective permeation of solutes through proton pumps (Gaxiola et al. 2001; McNeil et al. 1999). A vacuolar H + -pyrophosphatase encoded by the AVP1 gene is one of the proton pumps in Arabidopsis (Sarafian, et al. 1992) and generates an H + electrochemical gradient across the tonoplast (Zhen et al. 1997). Several transgenic plants overexpressing AVP1 have been shown to be more tolerant to salt- and drought-stress than their counterparts (Gaxiola et al. 2001; Jeong et al. 2013; Park et al. 2012; Pasapula et al. 2011). Bottle gourd (Lagenaria siceraria Standl.) that gives host-specific resistance against a Fusarium spp. is one of the most popular rootstocks for watermelon, although acute disorders such as sudden wilt caused by complicated abiotic stresses appear occasionally under cultivation conditions in year round production systems (Edelstein et al. 1999; Kubota et al. 2008; Lee 1994; Park et al. 2005b). Therefore, transgenic bottle gourd with modified abiotic stress-related traits is being considered as a rootstock of watermelon production (Han et al. 2009). However, the utilization of a transgenic rootstock might bring both sides of the coin owing to feasible long-distance transport of molecules derived from the transgene: to indirectly improve horticultural traits of the scion and to provoke controversy about social acceptance or rejection (Harada 2010; Kim et al. 2001). Here we focused on ascertaining transgene RNA transmission from rootstock to scion, which is one of the most important factors together with protein movement evaluating

19 14 J Plant Biotechnol (2015) 42:13 18 the substantial equivalence (Millstone et al. 1999). Two bottle gourd lines expressing Arabidopsis AVP1 were used as rootstocks for watermelon. Molecular characteristics of the AVP1 and its transcript were analyzed in the two transgenic lines, and the translocation of the transcripts of AVP1 and Bar (a selection marker gene) was tested in each part of watermelon scion. Materials and Methods Plant materials and transformation Bottle gourd (Lagenaria siceraria G5 ) transformation was performed by means of the Agrobacterium-mediated transformation method using cotyledon explants as described (Han et al. 2004; 2005; 2009). A. tumefaciens strain LBA4404, with the prg521 plasmid that was generated by replacing the selectable marker cassette of prg395 plasmid (Park et al. 2005a) with the Nos-pro/Bar/Nos-ter of pcb302 plamid (Xiang et al. 1999), was used for this study. Collectively, the T-DNA region of prg521 plasmid was consisted of LB/tandem 35S-pro/AVP1/Poly A/Nos-pro/Bar/Nos-ter/RB. The T 3 lines, BGAVP05, was developed through phosphinothricin (Duchefa Biochemie, the Netherlands) at 2 mg/l supplementation for selecting T 0 plants in vitro, and herbicide Basta TM (Kyungnoog, Korea) at 0.3%(v/v) treatment and polymerase chain reaction (PCR) analysis for succeeding generations. Final T 3 generation of the BGAVP05 lines and wild type bottle gourd were sown in plastic trays filled with commercial organic soil. After 3 weeks, young plants were transplanted into plastic pots (30 35 cm) and then further grown in a greenhouse at Kyungpook National University located in Daegu, Korea. These plants were then subjected to nucleic acids analyses. Meanwhile, 1 week delayed seedlings of two commercial watermelons (Citrullus vulgaris prince and speed ) were grafted onto the two transgenic and wild type bottle gourd lines. After graft unions were stabilized, grafted plants were also transplanted and grown under the same conditions indicated above for non-grafted bottle gourd lines (Fig. 1). PCR and Reverse transcription polymerase chain reaction (RT-PCR) analyses DNAs for PCR analysis and total RNAs for RT-PCR were extracted by using the HiYield TM Genomic DNA Mini Kit (Real Biotech Corporation, Taiwan) and the RNeasy R Plant Mini Kit (Qiagen, Germany), respectively. Up to 0.1 g of young leaves of bottle gourd plants for DNA extraction and up to 0.3 g each of samples from bottle gourds (young leaves and stems, and male and female flowers) and watermelons (young leaves, male and female flowers, and flesh of fruits) for RNA Fig. 1 Growth and development of watermelon plants grafted onto bottle gourd rootstocks expressing AVP1. (A) Acclimatization of grafted watermelon young plants. (B) Formation of graft union between wild type watermelon scion (arrow head) and AVP1-expressing bottle gourd rootstock (arrow). (C) The potted plants of grafted watermelon plants growing in a glasshouse. Female flowers of watermelon, cultivars Speed (D1) and Prince (D2). Fruits of watermelon cultivars Speed (E1) and Prince (E2)

20 J Plant Biotechnol (2015) 42: extraction were pulverized after being frozen in liquid nitrogen and then subjected to extraction using the kits according to the manufacturer s instructions. Each DNA (100 ng) was used as a template for PCR amplification. The first strand of cdna was synthesized from 1 μg of total RNA by using the High Capacity cdna Reverse Transcription Kit (Applied Biosystems, USA) according to the manufacturer s instructions. Amplification of a 668 bp AVP1 cdna fragment and the Bar gene were conducted on the Veriti TM Thermal Cycler (Applied Biosystems) using the Solg TM 2 Taq PCR Pre-Mix Kit (SolGent, Korea) with the following primer sets: AVP1-PF1 (forward primer: 5`-ATGGTGGCGCCTGCTTTGTT-3`), AVP1-PR1 (reverse primer: 5`-TCATCTCCGTAATAGATCTTGAA-3`), Bar-PF1 (forward primer: 5`-TCAAATCTCGGTGACGGGCA-3`) and Bar-PR2 (reverse primer: 5`-GGTCTGCACCATCGT- CAACC-3`). Amounts of AVP1 transcripts were normalized in comparison with those of an internal control gene, Actin, of which PCR primers, CuAc-PF1 (forward primer: 5`-GTA- TCGTGCTGGATTCTGGT-3`) and CuAc-PR3 (reverse primer: 5`-CCGATGAGAGATGGCTGGAA-3`) were obtained from coding sequences of several Cucurbitaceae plants. Expression level was estimated semi-quantitatively by altering the cycles of PCR amplification. PCR was conducted under the following conditions: initial denaturation for 2 min at 95 C, followed by 35 cycles of 95 C for 20 sec, 60 C for 40 sec, and 72 C for 1 min, and then a final extension for 5 min at 72 C. PCR products were separated and visualized on 2% agarose gel. batch according to the same procedure. To confirm copy numbers of AVP1 in the T 0 plants, DNA gel blot analysis was conducted. As the recombinant construct for transformation has four multi-cloning sites for total seventeen kinds of restriction enzymes, very limited enzymes were used for the analysis. Among selected four enzymes (Bam HI, Pst I, Spe I, Xba I), the T 0 plants showed distinguishable hybridization patterns with single copy each of AVP1 in only Xba I and Spe I digestions, respectively: a 3.4 kbp fragment by Xba I in Southern blot analysis For Southern blot analysis, preparation of DNAs was performed as described previously (Park et al., 2004). DNAs (10 µg) were digested by the restriction enzymes Spe I and Xba I (Takara, Japan) according to the manufacturer s procedures. Digested DNAs were separated on 1% agarose gel, and then transferred to a nylon membrane and fixed by using a UV-crosslinker (BLX-313, France). The AVP1 regions were analyzed by using a probe amplified from the primer set mentioned above. Labeling and detection were conducted by using the DNA Labeling and Detection Starter Kit II (Roche, Germany) according to the manufacturer s procedures. Fig. 2 Herbicide treatment and polymerase chain reaction (PCR) analysis for bottle gourd T 1 plants. (A) Herbicide bioassay for the selectable marker gene Bar. Basta TM (Kyungnoog, Korea) was treated at 0.3% (v/v). (B) PCR analysis of the AVP1. PCR products were run on 2% agarose gel and stained with ethidium bromide. WT (G5) and P indicate a non-transgenic wild type plant (negative control) and plasmid possessing full-length AVP1 (positive control), respectively Results Nucleic acids analyses of bottle gourd rootstock lines expressing Arabidopsis AVP1 We obtained T 0 plants, BGAVP05, from different transformation Fig. 3 RT-PCR analysis for bottle gourd T 3 lines, BGAVP05. Genes analyzed are indicated on the left side of the gel photos. The Actin (see materials and methods) was used as an internal control for normalizing levels of AVP1 transcripts. N and P indicate respectively the absence and presence of reverse transcriptase during first strand cdna synthesis step as using RNAs extracted from leaves of mother T 0 plants. Males and females indicate each unisexual flower

21 16 J Plant Biotechnol (2015) 42:13 18 BGAVP18 and a 2.2 kbp fragment by Spe I in BGAVP20 were revealed (data not shown). The independent transgenic plants were self-pollinated to obtain each progeny, after which T 1 and T 2 populations were treated with Basta TM and analyzed by PCR to generate non-segregating homozygous lines (Fig. 2). To confirm transcription of the AVP1, semi-quantitative RT-PCR analysis was also conducted in the T 3 progenies. As expected, the target gene was abundantly and uniformly expressed in all tested organs, including leaf, stem, and male and female flowers of both transgenic lines (Fig. 3). Detection of AVP1 and Bar transcripts in watermelon scions grafted onto transgenic bottle gourd rootstocks We further performed a grafting experiment to verify whether or not transcripts of the transgenes introduced in bottle gourd rootstocks are translocated to scions. Two kinds of commercial watermelon cultivars, Speed and Prince, were grafted on T 3 progenies of transgenic bottle gourd lines (Fig. 1), after which AVP1 transcripts were detected by RT-PCR in the organs of watermelon scions (Fig. 1, 4). Although the AVP1 was sufficiently transcribed in the two transgenic rootstock lines (Fig. 3), the transcripts were not detected in the organs of watermelon scions, such as leaves and both flowers (Fig. 4). Moreover, the transcripts of AVP1 and Bar were not detected in the fleshes of watermelon that are edible parts (Fig. 4), which indicating that transcripts of the transgenes introduced in bottle gourd rootstocks were not translocated to the organs of watermelon scion. genetically engineered bottle gourd rootstock that possess Arabidopsis Ca 2+ /H + exchanger CAX2B, also allowed more robust growth of their watermelon and melon scions than wild type bottle gourd (Han et al. 2009). These rootstocks with modified tolerance can be potential substitutes for wild type one. Transgrafting is grafting between genetically engineered rootstocks and non-transgenic scions or vice versa, and it will strengthen the application of grafting by enabling introducing new functional characteristics expressed by the transgene(s). Once a graft union is established, many factors allowing normal plant growth, such as water, hormones, nutrients, biochemicals, RNAs, peptides, and proteins, are capable of long-distance trafficking across the vascular connection between the rootstock and scion (Haroldsen et al. 2012; Koepke and Dhingra 2013). Crosstalks are significantly involved in Discussion As rootstocks often help to overcome soil-borne pests and pathogens, many economically important crop species in Solanaceae and Cucurbitaceae are grafted before being transplanted to open fields or greenhouses in order to promote vigorous growth and enhanced yields of scions (Kubota et al. 2008). Genetic improvement of rootstocks is another important issue in modern crop breeding, as useful horticultural traits are being introduced by transgenic approach (Han et al. 2009; Smolka et al. 2010; Wang et al. 2012). Bottle gourd has long history as a rootstock in watermelon production (Lee 1994). We obtained, in this study, two transgenic bottle gourd lines expressing a Arabidopsis vacuolar H + -pyrophosphatase (AVP1), which had conferred enhanced tolerance to drought- and salt-stress in several crops(gaxiola et al. 2001; Jeong et al. 2013; Park et al. 2012; Pasapula et al. 2011). The another Fig. 4 RT-PCR analyses for transcripts of AVP1 and Bar in wild type watermelon scions grafted onto T 3 bottle gourd rootstocks. Transcripts of the AVP1 and Bar genes were detected in watermelon scions by RT-PCR. Actin as an internal control was the same as in Fig. 3. (-) RT and (+) RT indicate respectively the absence and presence of reverse transcriptase during first strand cdna synthesis step as using RNAs extracted from leaves of T 3 bottle gourd plant

22 J Plant Biotechnol (2015) 42: morphological and physiological processes indispensable for plant survival, including flowering, apical meristem growth, senescence, and branching, etc. (Harada 2010; Haroldsen et al. 2012; Koepke and Dhingra 2013). In the case of transgrafted plants, translocation of transgene products can bring about undesirable effects in wild type counterparts, which can limit their application. However, if approved, their use can be economically beneficial in the crop industry (Haroldsen et al. 2012). In this respect, we focused on whether transcripts of transgenes are delivered from genetically engineered rootstocks to wild type scions. Translocation of transgene products from rootstocks to scions has been observed, but the results are still problematic. Several endogenous plant RNAs involved in long distance transport seem to be translocated from transgenic rootstocks to wild type scions, and they are expressed under ectopic conditions as well (Harada 2010; Haroldsen et al. 2012; Kim et al. 2001). Small non-coding RNAs such micrornas (mirnas) are also an internal component found in phloem sieve tubes, and they have been shown to mediate systemic RNA silencing through graft unions (Yoo et al. 2004), suggesting that mirnas play important roles in regulation of gene expression via long distance transport. However, two small RNAs derived from hairpin constructions of genes encoding β-glucuronidase and anthocyanin synthase were shown to not induce systemic silencing in apple transgenic lines grown under greenhouse conditions (Flachowsky et al. 2012). A similar result was also found in a soil bacterium gene, rooting locus B, in which mrna was not detectable in wild type apple scions (Smolka et al. 2010). In this study, the potential translocation of transgene mrnas was analyzed in scion organs by using RT-PCR. Transcripts of the target gene AVP1 were not detected in all organs of wild type watermelon scion tested (Fig. 4). Especially, the RT-PCR products were not detected in young reproductive organs and fruits in the harvest, and the product of selectable marker gene Bar also was not detected in fruits (Fig. 1, 4). The results suggest that transgene mrnas in this study might be not transmitted to wild type scion parts. One possible explanation for this discordance among studies is that long distance transport might be a core system programmed by the plant itself as a survival strategy. As such, it might require some components that form complexes for delivery of target molecules to sink portions, as well as short-term transportation such as cell to cell communication. The system includes genes related to transcriptional regulators, cell fate or cycle controlling elements, hormonal factors, metabolic components, and mrna-binding proteins (Haroldsen et al. 2012). However, if transgenes are not involved in these systems, then no proteins target or bind to the transgene mrnas which then could not be translocated to sieve tube cells for systemic transport. This suggests that delivery systems are very limited systems permitted in some special cases, and need proteins related to the movement. Viral infection systems can support this notion, as viruses are not targeted by plant delivery systems. However, once inoculated mechanically, they spread out into all plant parts by virus-encoded nonstructural movement proteins (Citovsky and Zambryski 2000). Here, we would like to elucidate one of the important factors for the potential use of genetically engineered plants as rootstocks. Our study showed that transgene transcripts are not translocated from rootstocks to scions by using vegetable grafting unions. Acknowledgements This study was supported by a grant from the Rural Development Administration in Korea. This research was supported by Kyungpook National University Research Fund, References Citovsky V, Zambryski P (2000) Systemic transport of RNA in plants. Trends Plant Sci 5:52-54 Edelstein M, Cohen R, Burger Y, Shriber S (1999) Integrated management of sudden wilt in melons, caused by Monosporascus cannonballus, using grafting and reduced rates of methyl bromide. Plant Dis 83: Flachowsky H, Tränkner C, Szankowski I, Waidmann S, Hanke M, Treutter D, Fischer TC (2012) RNA-mediated gene silencing signals are not graft transmissible from the rootstock to the scion in greenhouse-grown apple plants Malus sp. Int J Mol Sci 13: Gaxiola RA, Li J, Undurraga S, Dang LM, Allen GJ, Alper SL, Fink GR (2001) Drought- and salt-tolerant plants result from overexpression of the AVP1 H + -pump. Proc Natl Acad Sci USA. 98: Han JS, Kim CK, Park SH, Hirschi KD, Mok IG (2005) Agrobacterium-mediated transformation of bottle gourd (Lagenaria siceraria Standl.). Plant Cell Rep 23: Han, JS, Oh DG, Mok IG, Park HG, Kim CK (2004) Efficient plant regeneration from cotyledon explants of bottle gourd (Lagenaria siceraria Standl.). Plant Cell Rep 23: Han JS, Park SH, Shigaki T, Hirschi KD, Kim CK (2009) Improved watermelon quality using bottle gourd rootstock expressing a Ca 2+ /H + antiporter. Mol Breed 24: Harada T (2010) Grafting and RNA transport via phloem tissue in horticultural plants. Sci Hortic 125: Haroldsen VM, Chi-Ham CL, Bennett AB (2010) Transgene mobilization and regulatory uncertainty for non-ge fruit

23 18 J Plant Biotechnol (2015) 42:13 18 products of transgenic rootstocks. J Biotechnol 161: Haroldsen, V.M., M.W. Szczerba, H. Aktas, J. Lopez-Baltazar, M.J. Odias, C.L. Chi-Ham, J.M. Labavitch, A.B. Bennett, and A.L.T. Powell Mobility of transgenic nucleic acids and proteins within grafted rootstocks for agricultural improvement. Front. Plant Sci.3:39. Jang YA, Park DK, Huh YC, Lee JG, Yeo KH, Lee SG (2012) Incidence of Monosporascus wilt and fruit quality of melons influenced by grafting using melon as a rootstock. Kor J Hort Sci Technol. 30 (Suppl. II): 55 (Abstr.) Jeong M, Kang IK, Kim CK, Choi C, Park KI, Han JS (2013) Physiological responses to drought stress of transgenic Chinese cabbage expressing Arabidopsis H + -pyrophosphatase. J Plant Biotechnol 40: Kim M, Canio W, Kessler S, Sinha N (2001) Developmental changes due to long-distance movement of a homeobox fusion transcript in tomato. Science 293: Koepke T, Dhingra A (2013) Rootstock scion somatogenetic interactions in perennial composite plants. Plant Cell Rep 32: Kubota C, McDlure MA, Kokalis-Burelle N, Bausher MG, Rosskopf EN (2008) Vegetable grafting: history, use and current technology status in North America. HortScience 43: Lee JM (1994) Cultivation of grafted vegetables I. current status, grafting methods, and benefits. HortScience 29: McNeil SD, Nuccio ML, Hanson AD (1999) Betaines and related osmoprotectants. Targets for metabolic engineering of stress resistance. Plant Physiol 120: Millstone E, Brunner E, Mayer S (1999) Beyond substantial equivalence. Nature 401: Park KI, Choi JD, Hoshino A, Morita Y, Iida S (2004) An intragenic tandem duplication in a transcriptional regulatory gene for anthocyanin biosynthesis confers pale-colored flowers and seeds with fine spots in Ipomoea tricolor. Plant J 38: Park M, Won HY, Kim CK, Han JS (2012) Increased biomass and enhanced tolerance to salt stress in Chinese cabbage overexpressing Arabidopsis H + -PPase (AVP1). J Plant Biotechnol 39: Park S, Li J, Pittman JK, Berkowitz GA, Yang H, Undurraga S, Morris J, Hirschi KD, Gaxiola RA (2005a) Up-regulation of a H + -pyrophosphatase (H + -PPase) as a strategy to engineer drought-resistant crop plants. Proc Natl Acad Sci USA 102: Park SM, Lee JS, Jegal S, Jeon BY, Jung M, Park YS, Han SL, Shin YS, Her NH, Lee JH, Lee MY, Ryu KH, Yang SG, Harn CH (2005b) Transgenic watermelon rootstock resistant to CGMMV (cucumber green mottle mosaic virus) infection. Plant Cell Rep 24: Pasapula V, Shen G, Kuppu S, Paez-Valencia J, Mendoza M, Hou P, Chen J, Qiu X, Zhu L, Zhang X, Auld D, Blumwald E, Zhang H, Gaxiola R, Payton P (2011) Expression of an Arabidopsis vacuolar H + -pyrophosphatase gene (AVP1) in cotton improves drought- and salt tolerance and increases fibre yield in the field conditions. Plant Biotechnol J 9:88-99 Sarafian V, Kim Y, Poole RJ, Rea PA (1992) Molecular cloning and sequence of cdna encoding the pyrophosphate-energized vacuolar membrane proton pump of Arabidopsis thaliana. Proc Natl Acad Sci USA 89: Smolka A, Li XY, Heikelt C, Weiander M, Zhu LH (2010) Effects of transgenic rootstocks on growth and development of non-transgenic scion cultivars in apple. Transgenic Res 19: Yoo BC, Kragler F, Varkonyi-Gasic E, Haywood V, ArcheEvans S, Lee YM, Lough TJ, Lucas WJ (2004) A systemic small RNA signaling system in plants. Plant Cell 16: Wang L, Yang M, Akinnagbe A, Liang H, Wang J, Ewald D (2012) Bacillus thuringiensis protein transfer between rootstock and scion of grafted poplar. Plant Biol 14: Xiang C, Han P, Lutziger I, Wang K, Oliver DJ (1999) A mini binary vector series for plant transformation. Plant Mol Biol 40: Zhen RG, Kim EJ, Rea PA (1997) The molecular and biochemical basis of pyrophosphate-energized proton translocation at the vacuolar membrane. Adv Bot Res 25:

24 J Plant Biotechnol (2015) 42:19 24 DOI: ISSN Research Article CodA 고발현형질전환고구마의산화및건조스트레스내성증가 박성철 김명덕 김선하 김윤희 정재철 이행순 곽상수 Enhanced drought and oxidative stress tolerance in transgenic sweetpotato expressing a coda gene Sung-Chul Park Myoung Duck Kim Sun Ha Kim Yun-Hee Kim Jae Cheol Jeong Haeng-Soon Lee Sang-Soo Kwak Received: 9 March 2015 / Revised: 20 March 2015 / Accepted: 20 March 2015 c Korean Society for Plant Biotechnology Abstract Glycine betaine (GB) is one of the compatible solutes that accumulate in the chloroplasts of certain halotolerant plants under salt or cold stress. The coda gene for choline oxidase, the enzyme that converts choline into GB, has been cloned from a soil bacterium Arthrobacter globiformis. We generated transgenic sweetpotato plants [Ipomoea batatas (L.) Lam] expressing coda gene in chloroplasts under the control of the SWPA2 promoter (referred to as SC plants) and evaluated SC plants under oxidative and drought stresses. SC plants showed enhanced tolerance to methyl viologen (MV)-mediated oxidative stress and drought stress due to induced expression of coda. At 5 μm of MV treatment, all SC plants showed enhanced tolerance to MV-mediated oxidative stress through maintaining low ion leakage and increased GB levels compared to wild type plants. When plants were subjected to drought conditions, SC plants showed enhanced tolerance to drought stress through maintaining high relative water contents and increased coda expression compared to These authors contributed equally to this work. S.-C. Park S. H. Kim J. C. Jeong H.-S. Lee S.-S. Kwak ( ) 한국생명공학연구원식물시스템공학연구센터 (Plant Systems Engineering Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), Daejeon , Korea) sskwak@kribb.re.kr M. D. Kim 국립한경대학교유전공학연구소 (Institute of Genetic Engineering, Hankyong National University (HNU), Anseong , Korea) Y.-H. Kim 국립경상대학교사범대학생물교육과 (Department of Biology Education, College of Education, Gyeongsang National University, Jinju , Korea) wild type plants. These results suggest that the SC plants generated in this study will be useful for enhanced biomass production on global marginal lands. Keywords Sweetpotato, Glycine betaine, coda gene, Oxidative stress, Drought stress 서론 가뭄, 고염분, 저온, 고온과같은환경스트레스는식물의생장과발달을저해하여생산성저하에큰영향을미친다 (Bray 1997; Wang et al. 2003). 특히사막화면적은지나친방목, 삼림훼손, 부적절한물과토양관리등이원인으로전세계에매년약 1200 만 ha 씩확산되고있다. 현재 100 개국이상의 15 억인구가사막화의직접적인영향을받고있으며지표면적의 41% 정도가사막화의피해를받고있다 (Reynolds et al. 2007). 또한, 농약과화학비료의과다한사용과잘못된경작관리등으로세계적으로토양의염류화가급속하게진전되고있다. 국제연합식량농업기구 (FAO) 의집계에의하면전세계의염류화토양면적은매년 100 ~ 150 만 ha 씩증가하고있고현재염류화된토지의전체면적은 9.55 억 ha 로집계되고있다 (Sun et al. 2014). FAO 는 2050 년세계인구가 91 억명이될것이며지금추세로동물성단백질을소비하면 2050 년에는지금의 1.7 배의식량이필요할것으로전망했다. 따라서사막화지역, 염류화지역등글로벌조건불리지역에적합한농작물개발이시급하다. 이러한요구에의해형질전환기술과유전체정보를이용하여다양한환경스트레스조건에서도생장이가능한형질전환재해내성작물이개발되고있다.

25 20 J Plant Biotechnol (2015) 42:19 24 식물이과도한스트레스를받게되면생체내산소가 superoxide anion radical, hydrogen peroxide, hydroxyl radical 등의반응성이높은독성의활성산소종 (reactive oxygen species, ROS) 으로변하게되고 (Allen 1995), ROS 의과다발생은식물의생산성을감소시키는주요요인이되고있다 (Inze and Van Montagu 1995). 그러나이러한 ROS 는 superoxide dismutase (SOD), peroxidase (POD) 등의항산화효소와 ascorbic acid, glutathione 등의저분자항산화물질등에의해효율적으로제거된다 (Allen 1995). 또한건조와고염분과같은환경조건에대해저항성을가지는식물은세포질내용질의농도를증가시키는삼투조절기작이잘발달되어있다. 잘알려진세포질성삼투조절물질로는 proline, trehalose, soluble sugar, glycine betaine (GB) 등이있다 (Sakamoto and Murata 2002). 이들중 GB 는아미노산 glycine 의유도체이며, 양쪽성이온으로 choline 의산화에의하여합성된다. GB 합성은일반적인식물과대장균에서는 choline monooxygenase (CMO) 에의해 choline 이 betaine aldehyde 로전환된이후 betaine aldehyde dehydrogenase (BADH) 에의해 GB 가생성된다 (Ahmad et al. 2013). 하지만박테리아 Arthrobacter globiformis, A. pascens 의경우 choline oxidase (COD/COX) 라는하나의효소에의해 choline 으로부터 GB 가합성된다 (Hayashi et al. 1997; Ahmad et al. 2013). BADH 혹은 cod/cox 유전자의고발현은많은식물체에서 GB 함량을증가시켰으며, 이로인해 GB 가증가된식물체는건조, 고염, 저온등의환경스트레스에저항성을획득한것으로보고되어있다 (Ashraf and Foolad 2007). 일반적으로 GB 는밀, 사탕무, 시금치등의소수작물에서는합성되는반면, 벼, 감자, 토마토등의작물들에서는합성되지않아분자육종을통하여 GB 함량을증가시켜여러환경스트레스에저항성을가지는작물을만드는연구가필요하다. GB 함량이높은형질전환식물체가산화스트레스에대한내성이증가됨이저자들의선행연구에서규명된바있다 (Ahmad et al. 2008; Li et al. 2014). 고구마 [Ipomoea batatas (L.) Lam] 는메꽃과 (Convolvulaceae) 의식량작물로전세계약 100 여개의나라에서재배되며밀, 벼, 옥수수, 감자, 보리, 카사바에이어세계 7 번째주식작물로서매년 1 억톤이상생산되고있다. 고구마는재배가비교적용이하며넓은범위의기후에적응이가능하고생산량이높은작물로조건불리지역에적합한작물로평가된다 년미국농무부 (USDA) 는대표적인전분작물인옥수수, 카사바, 고구마, 감자등을미국북부지역과남부지역에재배한결과고구마가단위면적당가장많은탄수화물을생산하며특히조건불리지역에가장적합한바이오에탄올작물로평가하였다 (Ziska et al. 2009). 그러나건조, 고염분, 저온, 해충및바이러스등과같은스트레스들은고구마의생산량을저해하는요인으로알려져있다. 그러므로여러환경스트 레스에서내성을가지는새로운고구마품종의개발이필요하다. 본연구에서는건조, 고염등스트레스에내성이증가된고구마를개발하기위하여산화스트레스유도성 SWPA2 프로모터조절하에박테리아 (A. globiformis) 유래의 choline oxidase (coda) 유전자를엽록체에고발현시킨형질전환고구마를제작하고형질전환식물체의 GB 함량변화와환경스트레스에대한반응을분자생화학적방법을통하여분석하였다. 재료및방법 식물재료 실험에사용한고구마 [Ipomoea batatas (L.) Lam.] 는국립식량과학원바이오에너지작물연구소에서분양받은품종인율미 (cv. Yulmi) 를사용하였다. 형질전환을위한배발생캘러스를유도하기위하여어린식물체의정아및측아부분을 70% 에탄올에서 1 분간세척후 2% NaClO 용액에서 5 분간소독하였다. 소독이끝난정아와측아는멸균된증류수를이용하여 5 회반복세척하였다. 세척된정아와측아에서생장점을분리하여 1 mg/l 의 2,4-dichlorophenoxyacetic acid (2,4-D) 와 3 g/l 의 gelite 가포함된 MS 배지 (Murashige and Skoog 1962) 에 3 달간배양하여얻어진배발생캘러스를형질전환실험에사용하였다. 발현벡터및형질전환 본실험에사용된유전자발현벡터는산화스트레스유도성 SWPA2 프로모터조절하에고구마엽록체에박테리아유래 coda 유전자가발현되도록제작된것을사용하였다 (Hayashi et al. 1997; Kim et al. 2003; Ahmad et al. 2008; Li et al 20014). 고구마형질전환실험은 Lim 등 (2004) 의실험방법을참고하여진행하였다. 배발생캘러스와배양된아그로박테리움 (EHA 105) 을 3 일간공동배양한후, MS 기본배지로세척하여선발배지 (MS salt, 1 mg/l 2,4-D, 400 mg/l cefotaxime, 100 mg/l kanamycin) 에서배양하고 3 주간격으로새로운선발배지로계대배양하였다. 선발배지에서살아남은배발생캘러스는 400 mg/l cefotaxime 과 100 mg/l kanamycin 을포함한 MS 배지로옮겨지상부와뿌리를유도하여소식물체로재분화시켰다. Genomic DNA 분석및유전자발현분석 Genomic DNA 는 CTAB 추출방법을이용하여고구마잎에서분리하였다 (Kim and Hamada 2008). 분리된 genomic

26 J Plant Biotechnol (2015) 42: DNA 를 coda 유전자특이적프라이머 (Forward: GCTGC- TGGAATCGGGCTA, Reverse: TGGGCTTATCGCGGAAGT) 를사용하여 genomic PCR 을수행하였다. 유전자발현분석을위해 total RNA 는 TRIzol reagent (Invitrogen, USA) 를이용하여분리하였고, cdna 합성은 TOPscript RT DryMIX (Enzynomics, Korea) 를사용하여합성하였다. 합성된 cdna 를주형으로 coda 유전자특이적프라이머 (Forward: CACA- ACTCCTGCATCGCCTT, Reverse: GTTGGTTTCCAGCCG- CTTGTA) 를제작하여 real-time PCR 을수행하였다. 시료의 cdna 양을보정하기위한내부대조유전자로고구마의 ADP-ribosylation factor (Forward: CTTTGCCAGAAG- GAGATGC, Reverse: TCTTGTCCTGACCACCAACA) 를사용하였다 (Park et al. 2012). Real-time PCR 실험과분석은 CFX real-time PCR system 과 software 를사용하였다 (Bio-Rad, USA). Methyl viologen 처리및이온전도도분석 Methyl viologen (MV) 처리를위해상토에삽식하여 5 주된고구마의 3 번째잎을사용하였다. 8 개의잎절편 ( 직경 : 8 mm) 을 5 μm MV 가포함된 0.4% (w/v) 의 sorbitol 용액에띄워 12 시간동안 25 C 암상태로배양한후 25 C 광조건 (150 μmol m -2 s -1 ) 에서지속적으로배양시켰다. 세포의이온소실은 ion conductivity meter 를이용하여 0 ~48 시간동안 12 시간단위로측정하고 48 시간이후시료를 80 C 에서 2 시간동안처리하여세포를완전파괴시킨이온의소실값을 100% 로하여환산하였다. 무게를말한다. MDA 의측정은 spectrophotometer 를이용하여 Li 등 (2014) 의방법을사용하여측정하였다. 통계분석 실험의모든결과는 Statistical Package for the Social Sciences (SPSS12) 를이용한일원분산분석방법을사용하여통계분석을시행하였다. 데이터비교는 least significant difference (LSD) 를이용하였으며통계적유의성은 *P <0.05 및 **P <0.01 로설정하였다. 결과및고찰 CodA 유전자도입형질전환고구마제작 환경스트레스에저항성을가지는고구마식물체를만들기위하여 A. globiformis 에서분리한 choline oxidase 를암호화하는 coda 유전자를고구마유래의산화스트레스유도성 SWPA2 프로모터의조절하에율미품종에도입한형질전환식물체 (SC 식물체 ) 를개발하였다 (Fig. 1A, B). SC 식물체에사용한벡터는 kanamycin 선발마커가있는 pcambia 2300 을사용하였으며, coda 단백질을엽록체로위치하게하는 transit peptide (TP) 를 coda 유전자앞부분에삽입하였다. Kanamycin 함유배지에서선발된총 70 개의소식물체중생장이빠른 18 개의소식물체를선발하여 genomic PCR 을수행하여 coda 유전자가안정적으 Glycine betaine 함량측정 Glycine betaine (GB) 의함량을측정하기위하여 5 μm 농도의 MV 를분무처리한잎 0.1 g 에 0.5 ml 의 methanol: chloroform: water (60:25:15) 을이용하여추출한후 AG-1-X8 anion exchange resin (Bio-Rad, USA) 을이용하여 GB 를정제하였다 (Park et al. 2004). 정제한 GB 는 spectrophotometer 를이용하여 Li 등 (2014) 의방법을사용하여측정하였다. 건조스트레스처리 상토에삽주하여 5 주된고구마식물체에건조처리를하였다. 배양실조건 (25 C, 100 μmol photons m -2 s -1, 30% 습도 ) 에서 14 일간관수하지않고식물을배양하였다. 상대수분함량 (RWC) 과 malondialdehyde (MDA) 분석을통하여건조스트레스의정도를측정하였다. 상대수분함량 (relative water content, RWC) 은 [RWC (%) = ( 생중량 - 건조중량 ) / ( 팽압 - 건조중량 ) x100] 수식으로구하였다. 여기서팽압무게는신선한잎을 4 C 암상태에서 12 시간배양한후 Fig. 1 Development of transgenic sweetpotato plants expressing the coda gene. (A) Schematic representation of the T-DNA regions of vector used for sweetpotato transformation. SWPA2 Pro, sweetpotato peroxidase anionic 2 promoter; TP, transit peptide from the sequence of the small subunit of Rubisco (tobacco); coda, choline oxidase cdna; NOS-ter, termination sequence from the nopaline synthase gene. (B) Agrobacterium-mediated transformation of embryogenic calli of sweetpotato. (C) Genomic DNA PCR analysis of the coda gene from transgenic plants. M, size markers; WT, wild-type plant; PC, positive control; Numbers (1-18), independent putative transgenic lines

27 22 J Plant Biotechnol (2015) 42:19 24 로도입된 13 개라인을선발하였다 (Fig. 1C). 선발된재분화식물체는 2 주간의순화과정을거쳐상토로옮겨이후실험을수행하였다. SC 식물체의표현형 CodA 유전자의발현및 GB 함량의증가가식물의표현형에미치는영향을관찰하기위해, 정상생육조건에서형질전환식물체의표현형을관찰하였다. 형질전환식물체잎의모양을비교했을때, SC6 식물체는비형질전환식물체 ( 대조구 ) 와비슷한잎의모양을보였으며, SC2, SC7, SC11 식물체는잎의크기가작으면서길쭉한모양을나타내었다. 그리고나머지 9 개의 SC 식물체들은거치가발달된잎의모양을나타내었다 (Fig. 2A). 5 μm MV 를식물체에처리한후 real-time PCR 을이용하여 coda 유전자의발현을확인하였을때, 13 개의선별된형질전환체중 SC12, SC17 식물체유전자의발현이가장높았으며두형질전환체는대조구에비하여잎의거치가발달되어있었다 (Fig. 2B). 최근 Li 등 (2014) 에따르면 SWPA2 프로모터의조절하에 coda 유전자가과발현시 auxin 관련유전자의과발현이유도되어형질전환알팔파의성장이대조구보다증가되었다. 본연구의 SC 식물체의경우식물의성장증가는관찰되지않았지만잎의거치가증가하는표현형이많이관찰되었다. 잎의거치발달은 auxin 호르몬이아닌 cytokinin 과 gibberellin 호르몬의상호조절에의해서결정되는것으로알려져있다 (Blein et al. 2013). 이후연 구에서 coda 유전자혹은 GB 의함량이식물호르몬을조절하는지에대한연구가더필요할것으로사료된다. SC 식물체의산화스트레스내성 Choline oxidase 를암호화하는 coda 유전자는식물에과발현시 GB 를고축적하여염분, 건조, 저온스트레스등과같은다양한비생물학적스트레스에대한저항성을부여하는것으로알려져있다. 산화스트레스조건에서형질전환식물체의반응을보기위하여잎절편에 5 μm 농도의 MV 를처리하였다 (Fig. 3A). 이온전도도분석결과 MV 처리후 24 시간이후부터대조구가 SC12, SC17 번식물체보다세포내이온의소실이약 10% 더증가하였다 (Fig. 3B). SC 식물체의산화스트레스내성이 GB 함량과관련이있는것을확인하기위하여 GB 함량을측정하였다. MV 처리시대조구의 GB 함량은 0.48 µmol g/fw 이었고, SC12, SC17 식물체는각각 0.58, 0.60 µmol g/fw 로대조구보다더많은 GB 를합성하였다 (Fig. 3C). 따라서증가된 GB 함량으로인해 SC 식물체들이산화스트레스에대한내성을획득한것으로판단된다. SC 식물체의건조내성 GB 함량의증가가건조스트레스에미치는영향을평가하기위하여, SC 식물체의건조내성실험을진행하였다. Fig. 2 Characterization of SC sweetpotato plants expressing the coda gene. (A) Phenotype of SC Plants. WT, wild-type plant; SC2~SC18, transgenic SC plant lines. (B) Quantitative real-time RT-PCR analysis of 12 lines expressing stable coda gene integration in transgenic plants following MV treatment Fig. 3 Effect of methyl viologen (MV)-mediated oxidative stress on the ion leakage of wild-type (WT) and transgenic (SC) plants at 0 to 48 h after 5 μm MV treatment. (A) Differential visible damage of leaf discs. (B) Relative ion leakage. (C) Glycine betaine (GB) contents of WT and SC plants before and after MV treatment. Data are expressed as the mean ± SD of three replicates. Asterisks indicate a significant difference between WT and SC plants at **p < 0.01 by LSD test

28 J Plant Biotechnol (2015) 42: 상토에삽주한대조구와 SC 식물체를건조처리하여대조구의잎이위조 (wilting) 되는 9 일째잎의 coda 유전자의발현과상대수분함량 (RWC) 을조사하였다. 건조처리 14 일이후 SC 식물체는대조구에비해잎의고사의정도가확연하게드러났다 (Fig. 4A). 대조구에서는 coda 유전자가발현하지않았으며 SC12 및 SC17 식물체에서는건조처리전에비해건조 9 일처리후 coda 유전자의발현이 3 배이상증가하였다 (Fig. 2B). RWC 는 SC 식물체가대조구에비해약 15% 높아건조에저항성을가지는것을확인하였다 (Fig. 4C). 또한, 9 일째식물체의세포지질의과산화도를 MDA 함량분석으로측정하였을때, 대조구가 SC 식물체보다높은 MDA 활성을가지고있어세포내지질의과산화가더많이진행되었음을알수있었다 (Fig. 4D). 따라서 coda 유전자의과발현이 GB 함량을증가시켜 SC 식물체가대조구식물체에비해건조저항성을획득한것으로간주된다. 최근동일한 coda 과발현벡터를도입한감자및알팔파의경우공통적으로 GB 함량의증가에따라산화, 건조, 고염등의환경스트레스에서저항성을보였으며알팔파의경우또다른삼투조절물질인 proline 의함량역시증가하였다 (Ahmad et al. 2008; Li et al. 2014). 시금치 의 BADH 를 CaMV 35S 프로모터의조절하에과발현한형질전환고구마의논문에의하면 GB 의증가는 proline 의증가뿐아니라 SOD, APX 등의항산화효소유전자발현을증가시킨다고보고되어있다 (Fan et al. 2012). 따라서본연구의 SC 식물체의 MV 에의해유도된산화스트레스및건조스트레스에대한내성증가는 GB, proline 그리고항산화효소의상호작용에의한결과로예측된다. 이들의보다정확한상호기작을규명하기위해 SC 식물체의전사체분석등을수행할필요가있다. GB 함량을증가시킨형질전환목화, 벼, 토마토등에서도건조및염스트레스조건에서생산량증가가보고되었다 (Ahmad et al. 2013). 특히밀의경우고염스트레스에서형질전환체의생산량이대조구에비해 51 ~ 90% 까지상승하였다 (He et al. 2010). Fan 등 (2012) 의연구에따르면고염조건에서 GB 함량이증가된고구마의괴근형성이대조구에비해증가하여고염을포함한환경스트레스조건에서고구마의저장뿌리생산량증가의가능성을시사하였다. 본연구의 SC 식물체는산화및건조스트레스에서저항성을보임으로환경스트레스조건및일반재배조건에서고구마괴근생산량증가가기대된다. 적요 Fig. 4 Drought stress analysis of WT and SC plants. (A) Plant growth before drought stress (upper panel) and after water withholding for 14 days (lower panel). (B) Quantitative real-time RT-PCR analysis of coda expression before drought stress and after water withholding for 9 days. (C) Relative water content of WT and SC plants before drought stress and after water withholding for 9 days. (D) Malondialdehyde (MDA) contents in leaves before drought stress and after water withholding for 9 days treatment. Data are expressed as the mean ± SD of three replicates. Asterisks indicate a significant difference between WT and SC plants at **p < 0.01 by LSD test 식물은여러환경스트레스에적응하기위해스트레스내성유전자의발현혹은 proline, trehalose, glycine betaine (GB) 등과같이삼투압을조절하는 compatible solute 를생성하면서진화해왔다. GB 는고염, 저온등환경스트레스조건에서식물의엽록체에서축적되는물질중하나이다. 토양박테리아 Arthrobacter globiformis 에서분리한 choline oxidase (coda) 유전자는 choline 을 GB 로전환하는기능을한다. 본연구에서는산화스트레스유도성 SWPA2 프로모터의발현조절하에 coda 유전자를엽록체에과발현시킨형질전환고구마식물체 (SC 식물체 ) 를제작하여다양한환경스트레스조건에서의특성을분석하였다. SC 식물체는 methyl viologen (MV) 에의한산화스트레스와건조처리조건에서내성증가를보였다. 5 μm MV 처리시형질전환식물체는 GB 의함량이증가하였고낮은수준의이온전도도를보였다. 건조스트레스조건에서형질전환식물체는 coda 유전자의발현이증가하였으며, 대조구보다높은상대수분함량을유지하였다. 따라서본연구결과의 SC 식물체는고염, 건조토양등조건불리지역에재배하면바이오매스를증가시킬수있을것으로예상된다.

29 24 J Plant Biotechnol (2015) 42:19 24 사사 본연구는 2015 년도한국생명공학연구원주요사업 (KRIBB Initiative Program) 과농촌진흥청차세대바이오그린 21 사업 ( 시스템합성농생명공학사업단과제번호 : PJ ) 의지원으로수행되었다. Reference Ahmad R, Kim M, Back KH, Kim HS, Lee HS, Kwon SY, Murata N, Chung WI, Kwak SS (2008) Stress-induced expression of choline oxidase in potato plant chloroplasts confers enhanced tolerance to oxidative, salt, and drought stresses. Plant Cell Rep 27: Ahmad R, Lim C, Kwon SY (2013) Glycine betaine: a versatile compound with great potential for gene pyramiding to improve crop plant performance against environmental stresses. Plant Biotechnol Rep 7:49-57 Allen RD (1995) Dissection of oxidative stress tolerance using transgneic plants. Plant Physiol 107: Ashraf M, Foolad M. R (2007) Roles of glycine betaine and proline in improving plant abiotic stress resistance. Environ Exp Bot 59: Blein T, Pautot V, Laufs P (2013) Combinations of mutations sufficient to alter Arabidopsis leaf dissection. Plants 2: Bray E A (1997) Plant responses to water deficit. Trends Plant Sci 2:48-54 Fan W, Zhang M, Zhang H, Zhang P (2012) Improved tolerance to various abiotic stresses in transgenic sweet potato (Ipomoea batatas) expressing spinach betaine aldehyde dehydrogenase. PLoS One 7:e37344 Hayashi H, Alia, Mustardy L, Deshnium P, Ida M, Murata N (1997) Transformation of Arabidopsis thaliana with the coda gene for choline oxidase; accumulation of glycinebetaine and enhanced tolerance to salt and cold stress. Plant J 12: He C, Yang A, Zhang W, Gao Q, Zhang J (2010) Improved salt tolerance of transgenic wheat by introducing beta gene for glycine betaine synthesis. Plant Cell Tiss Org 101:65-78 Inze D, Van Montagu (1995) Oxidative stress in plants. Curr Opin Biotechnol 6: Kim KY, Kwon SY, Lee HS, Hur Y, Bang JW, Kwak SS (2003) A novel oxidative stress-inducible peroxidase promoter from sweetpotato: molecular cloning and characterization in transgenic tobacco plants and cultured cells. Plant Mol Biol 51: Kim SH, Hamada T (2005) Rapid and reliable method of extracting DNA and RNA from sweetpotato, Ipomoea batatas (L). Lam. Biotechnol Lett 27: Li H, Wang Z, Ke Q, Ji CY, Jeong JC, Lee HS, Lim YP, Xu B, Deng XP, Kwak SS (2014) Overexpression of coda gene confers enhanced tolerance to abiotic stresses in alfalfa. Plant Physiol Biochem 85:31-40 Lim S, Yang KS, Kwon SY, Paek KH, Kwak SS, Lee HS (2004) Agrobacterium-mediated genetic transformation and plant regeneration of sweetpotato (Ipomoea batatas). J Plant Biotechnol 31: Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue culture. Physiol Plant 15: Park EJ, Jeknić Z, Sakamoto A, DeNoma J, Yuwansiri R, Murata N, Chen THH (2004) Genetic engineering of glycinebetaine synthesis in tomato protects seeds, plants, and flowers from chilling damage. Plant J 40: Park SC, Kim YH, Ji CY, Park S, Jeong JC, Lee HS, Kwak SS (2012) Stable internal reference genes for the normalization of real-time PCR in different sweetpotato cultivars subjected to abiotic stress conditions. PLoS One 7:e51502 Reynolds JF, Smith DM, Lambin EF, Turner BL, Mortimore M, Batterbury SP, Downing TE, Dowlatabadi H, Fernández RJ, Herrick JE, Huber-Sannwald E, Jiang H, Leemans R, Lynam T, Maestre FT, Ayarza M, Walker B (2007) Global Desertification: Building a Science for Dryland Development. Science 316: Sakamoto A, Murata N (2002) The role of glycine betaine in the protection of plants from stress: clues from transgenic plants. Plant Cell Environ 25: Sun YF, Niu LC, Song FQ (2014) Progress on salinization soil restoration method. Int J Ecol 3:30-36 Wang W, Vinocur B, Altman A (2003) Plant responses to drought, salinity and extreme temperatures: towards genetic engineering for stress tolerance. Planta 218:1-14 Ziska LH, Runion GB, Tomecek M, Prior SA, Torbet HA, Sicher R (2009) An evaluation of cassava, sweet potato and field corn as potential carbohydrate sources for bioethanol production in Alabama and Maryland. Biomass Bioenergy 33:

30 J Plant Biotechnol (2015) 42:25 33 DOI: ISSN Research Article 배검은별무늬병 (Venturia nashicola) 고도저항성 유래 PR-10 유전자의특성 천재안 김세희 조강희 김대현 최인명 신일섭 Characterization of PR-10 gene derived from highly resistant pear inoculated with scab (Venturia nashicola) Jae An Chun Se Hee Kim Kang Hee Cho Dae Hyun Kim In Myong Choi Il Sheob Shin Received: 18 March 2015 / Revised: 18 March 2015 / Accepted: 18 March 2015 c Korean Society for Plant Biotechnology Abstract A PyrcpPR-10 gene with differentially expressed was isolated by using the suppression subtractive hybridization assay between (highly resistant against scab caused by Venturia nashicola) and Sweat Skin (highly susceptible) and analyzed the expression pattern according to organs and cultivars. The full length of PyrcpPR-10 was cloned as 743bp with 480bp s ORP, and was determined to encode a protein of 159 amino acid residues. On analyzing PyrcpPR-10 gene sequence compared with resistant and susceptible cultivars, Hwangsilri (resistant), Gamcheonbae (moderately resistant), Wonhwang (moderately susceptible), Niitaka (highly susceptible), and Sweat Skin (highly susceptible) had identical gene sequence but Bartlett (highly resistant) showed partly different sequences. The deduced amino acid sequence showed 64 ~ 98% homology and had the GXGGXG motif to known amino acid of other plants PR-10 by the BLAST X analysis. Among several organs or tissues, petal was showed highest expression level of PyrcpPR-10 gene followed by leaf, floral axis, bud, and bark. The expression level of PyrcpPR-10 gene was dramatically increased at 24 hr after inoculation in all cultivars and also up-regulated in accordance with resistant degree of cultivars. While resistant J. A. Chun S. H. Kim K. H. Cho D. H. Kim I. M. Choi 농촌진흥청국립원예특작과학원과수과 (Fruit Research Division, National Institute of Horticultural & Herbal Science, RDA, Suwon , Korea) I. S. Shin ( ) 농촌진흥청국립원예특작과학원배연구소 (Pear Research Station, National Institute of Horticultural & Herbal Science, RDA, Naju, , Korea) shinis3@korea.kr cultivars ( Bartlett, , and Hwangsilri ) induced relatively high expression level of PyrcpPR-10 gene, susceptible cultivars ( Niitaka, and Sweat Skin ) showed low expression level. PyrcpPR-10 gene is assumed that it is directly connected with defense mechanisms to pear scab. Keywords Pear Scab 서론 PyrcpPR-10, Gene expression, Resistant degree, 식물은곰팡이, 박테리아, 바이러스와같은다양한병원체에끊임없이노출되며방어반응에관련된단백질의발현을유도한다. 이러한단백질중 pathogenesis-related (PR) 단백질은병원체와환경스트레스의해유도되는것으로알려져있으며 (Van Loon and Van Strien. 1999) 단백질의구조와생화학적활성에기초하여 17 개의 family 로분류되어있다 (Sels et al. 2008). 미나리배양세포에서곰팡이전구체처리를통해최초로분리된 (Somssich et al. 1986) PR-10 단백질은병원체에대한방어뿐만아니라식물의발달에도관여하며 (Sikorski et al. 1999) 대부분의 PR 단백질은세포외에존재하는반면 PR-10 단백질은일반적으로세포내에존재하며 16 ~ 19 kda 의작은크기의산성단백질이다 (Liu and Ekramoddoullah. 2006). 또한 PR-10 단백질은 ribonuclease-like 활성부위에따라 100 개이상의다른단백질이분리되었으나생물학적기능은아직명확하게밝혀져있지않다 (Wen et al. 1997). 하지만 Moiseyev et al. (1994) 은인삼에서분리한 ribonuclease 의아미노산서열과 PR-10 단백질이높은상동성을가지며발현양상이

31 26 J Plant Biotechnol (2015) 42:25 33 유사하여 PR-10 단백질이가지는 RNase 활성이방어반응과관련된다고하였다. 이러한 RNase 활성은병원체감염부위의세포자살 (programmed cell death) 또는병원체에대해직접적으로작용함으로써식물체를보호하는것으로생각되며 in vitro 실험을통하여 Bet v 1 (Bufe et al. 1996), LaPR-10 (Bantignies et al. 2000), GaPR-10 (Zhou et al. 2002), CaPR-10 (Park et al. 2004), ZmPR-10, ZmPR-10.1 (Xie et al. 2010) 등일부 PR-10 단백질이 RNase 활성을가지는것이확인되었다. 또한 Fujimoto et al. (1998) 은 PR-10 단백질의사이토키닌특이적결합활성을보여주었으며 Srivastava et al. (2004) 은 Brassica napus 에서분리한 PR-10 유전자의구성적발현을통해내염성이증가된다고하였다. 이들결과로보아일부 PR-10 단백질은병원체에대한방어반응뿐만아니라내생사이토키닌의수준을조절함으로써식물의생장과발달에도관여하는것으로생각된다. Venturia nashicola 에의해발생하는배검은별무늬병은남방형동양배 (Pyrus pyrifolia) 와북방형동양배 (P. ussuriensis, P. bretschneideri) 에많은피해를주며 (Park et al. 2000), 특히우리나라주품종인 신고 는본병에고도감수성으로농가에많은경제적부담을주고있어고도저항성유럽배 (Pyrus communis L.) 의유전자를동양배에도입하기위한분자생물학적기작을이해하기위해저항성품종과감수성품종간의특이적으로발현되는유전자에대한연구가진행되고있다 (Faize et al. 2004; Shin et al. 2012; Zheng and Ishii. 2009). 본연구에서는 SSH 분석을통하여검은별무늬병고도저항성 에서차등적으로발현하는 PyrcpPR-10 유전자를선발하여염기서열을분석하고분자적특성에대하여조사하였다. 또한 Real-time PCR 를통하여저항성품종특이적발현과기관특이적발현을분석함으로써유전자의기능을규명하고자하였다. 재료및방법 실험재료 SSH 분석을위해 V. nashicola 에고도저항성 과고도감수성 스위트스킨 을시험재료로사용하였으며접종후전엽 20 일미만의유엽을사용하였다. 시험수는원예작물을위한상업적배지 ( 서울바이오, 순천, 한국 ) 로채워져있는 7.6 L 플라스틱포트에재식된 P. pyrifolia 대목에접목하여병처리까지주야온도가 30 C/12 C 로유지되는유리온실에보존하였다. 차등발현유전자의발현은 V. nashicola 에대하여저항성정도가다른 Bartlett ( 고도저항성 ), ( 고도저항성 ), 황실리 ( 저항성 ), 감천배 ( 중도저항성 ), 원황 ( 감수성 ), 신고 ( 고도감수성 ), 스위트스킨 ( 고도감수성 ) 간비교하였다. 분생포자인공접종및시료채취 전남나주에소재한국립원예특작과학원배연구소에서검은별무늬병이발병된 신고 잎에서분생포자를채취하였고멸균수로현탁하여 -80 C 에냉동보관하였고이것을약 20 C 에서녹인후 0.1% sucrose 와 Tween 80 을첨가하여접종원으로사용하였다. 접종원을 분생포자 /ml 농도로 10 개내외의잎이완전히전개된 1 년생접목묘 (6 주이상 / 품종 ) 의수관전체에분무접종하였으며대조구식물체는 0.1% sucrose 와 0.005% Tween 80 을포함하는멸균수를분무하였다. 접종후각접목묘를 20 C, 상대습도 100% 습실내에서 48 시간을유지한후 50% 정도차광된온실에두었다. 최초접종후 0, 24, 48, 72, 96, 120 및 144 시간간격으로잎을채취하였으며액체질소에담근후 -80 C 의냉동고에보관하였다 (IlShinBioBase, Dong DuCheon, Kyenggi-do, Korea). 기관특이성분석을위하여잎, 꽃잎, 꽃대, 수피, 눈은 11 년생나무로부터채취하였다. RNA 분리및 cdna 합성 RNA 을추출은변형된 cetyltrimethylammonium bromide (CTAB) 방법과 lithium chloride (LiCl) 침전방법을사용하였다 (Iandolino et al. 2004). 액체질소상태에서마쇄된잎은 CTAB buffer [2% CTAB, 2% polyvinlypyrrolidone, 100 mm Tris-HCl (ph 8.0), 25 mm EDTA, 2M NaCl] 를첨가한후 65 C 에서 30 분간반응하였다. 두번의 chloroform/isoamyl alcohol 를처리하여상징액을추출하였으며 3M LiCl 를첨가한후 4 C 에서 overnight 처리하고 4 C, rpm, 30 min 간원심분리하여 pellet 을형성시켰으며상징액을제거한후 SSTE buffer [1M NaCl, 0.5% SDS, 10 mm Tris-HCl (ph 8.0), and 1 mm EDTA (ph 8.0)] 를넣어 65 C 에서완전히용해하였다. 동량의 Chloroform:IAA (24:1) 를첨가한후 4 C, rpm, 30 min 간원심분리하여상징액을추출하였으며 100% 에탄올 2(v/v) 을첨가한후 -20 C 에서 30 분간반응시켜 RNA 를농축하였다. 전기영동을이용하여분리된 RNA 의분해정도를확인하였으며 spectrophotometer 260/280nm 에서정량하고 SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogene, Waltham. Messachusetts, USA) 을사용하여 1 μg의 RNA 로부터 cdna 를합성하였다 SSH 라이브러리제작및 Mirror Orientation Selection (MOS) PCR select cdna subtraction kit (Clontech, Mountain View, CA, USA) 를사용하여라이브러리를제작하였으며 SMART cdna synthesis kit(clontech) 를사용하여 total RNA 로부터 cdna 를합성하였다. V. nashicola 분생포자를저항성품

32 J Plant Biotechnol (2015) 42: 종에접종후 2 일째의발아율, 부착기 (appressorium) 형성및침투공 (penetration-pore) 형성이이후 7 일까지와유의적인차이가없었으며, 각피하층의균사체 (subcuticular hypha) 형성만접종 3 일까지증가된다는보고 (Park et al. 2000) 에따라 의시간별 (24, 48, 72, 96, 120 및 144 시간 ) 병처리엽에서추출한 cdna 를혼합하여 tester cdna 로사용하였으며 driver cdna 로무처리 스위스트킨 을사용하여라이브러리를제작한후제한효소 RsaI 를처리하였다. 두개의튜브에 tester cdna 를각각넣고한쪽에는 adaptor 1, 다른한쪽에는 adaptor 2R 을넣은후 DNA ligase 를처리하였다. 각각의 tester pool 에 driver cdna 를첨가하여 hybridization 과정을거친후차등발현된염기서열만선택적으로증폭하기위하여 2 번의 PCR 을하였다. SSH 가차등발현된전사체를탐색하기위한강력하고일반적인방법으로사용되고있지만, SSH 유래라이브러리는전형적으로비차등적발현전사체도포함되어있기때문에 background 제거를위하여 MOS 를실시하였다. SSH 의 second nested PCR 로부터얻은 PCR 산물을 phenol/chloroform 을처리하여추출하였으며 MOS 를수행하기위하여에탄올로농축하였다. PCR 추출물은제한효소 XmaI 을처리한후 denaturation 과 5 시간의 hybridization 과정을거친후 NP2Rs primer 를이용하여 PCR 를수행하였으며 NP2R adaptor 를양쪽끝에연결하였다. MOS PCR 산물을 TOPO TA cloning vector 에삽입하여형질전환하였으며 agar, X-gal (Sigma, Missouri, St. Louis, USA), IPTG (Sigma, Missouri, St. Louis, USA) 와 ampicillin (Sigma, Missouri, St. Louis, USA) 100 mg/ml 첨가된 LB plate 에도말하여 37 C 에서 16 시간배양하였다. 각각의흰색 colony 를무작위로선발하였으며 ampicillin 100 mg/ml 첨가된 LB 액체배지에서배양한후분석에사용하였다. 각각의라이브러리 set 은 Macrogen Inc. (Seoul, Korea) 에서염기서열을분석하였다. 였다. 증폭된 cdna 는 pmd20 T-vector (Takara, Otsu, Shiga, Japan) 에클로닝하여분석후전체염기서열을결정하였다. Real-time(RT) PCR 분석 PyrcpPR-10 유전자의발현양상을분석하기위하여 PRIMER3 (Rozen and Skaletsky, 1998) 프로그램을이용하여 forward (5`-TGGCATCTGGCAGTGGTTCC-3`) 및 reverse (5`-GGCCT- TGTCTTTGCCAGCCT-3`) primer 를제작하였다. Endogenous control 로써 housekeeping gene 인배 actin (forward: 5`-GTG- CTGGACTCAGGTGATGG-3`, reverse: 5`-GTTCTTCTCAA- CTGACGAGC-3`) 을사용하였으며 (Kim et al. 2009), standard curve 검정을통해안정적으로발현되는것을확인하였다. PCR 증폭은 SYBR Premix Ex Taq TM (Perfect real-time) kit (Takara, Otsu, Shiga, Japan) 10 μl, forward 및 reverse primer 0.4 μl (0.5 mm), 20x 희석된 first-strand cdna 5 μl, ddh 2 O 4.2 μl를혼합하였다. 증폭반응은 LightCycler 480 II (Roche, Rotkreuz, Zug, Switzerland) 로최초 95 C 에서 15 초간반응시키고, 95 C 5 초, 60 C 45 초과정을 45 회반복하였으며 60 C 에서 95 C 까지 0.5 C 씩온도를상승시켜 melting curve 를분석하였다. 분석은 3 반복으로수행하였다. 결과및고찰 PyrcpPR-10 유전자분리및염기서열분석 SSH 분석을통하여 V. nashicola 접종후고도저항성품 cdna 염기서열분석및 RACE PCR M13 promotor primer 를사용하여 DNA 염기서열을분석하였으며 ABI BigDye(R) Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, Lincoln, CA, USA) 와 DNA Engine Tetrad 2 Peltier Thermal Cycler (Bio-Rad, Hercules, CA, USA) 를사용하여분석하였다. Fluorescent-labeled fragment 은 Applied Biosystems 방법에따라정제되었으며 ABI 3730xl DNA Analyzer (Applied Biosystems, Lincoln, CA, USA) 에서전기영동을실시하였으며염기서열을분석하였다. SSH 로부터얻은 PyrcpPR-10 cdna 의단편염기서열을바탕으로 5`-TGG- GCCTTGTCTTTGCCAGCC-3` (5` 말단 RACE) 과 5`-CGCC- TCAGTCATCCCTCCTGC-3` (3` 말단 RACE) primer 를제작하였으며 CapFishing full-length cdna premix kit (Seegene, Korea) 를사용하여 5` 말단과 3` 말단의 cdna 를증폭하 Fig. 1 Nucleotide and deduced amino acid sequence of PyrcpPR-10 cdna. P-loop motif is underlined

33 28 J Plant Biotechnol (2015) 42:25 33 종 에서차등발현되는유전자의염기서열을분석하였으며사과 (Malus domestica) 의 PR-10 유전자 (CAK ) 와 98% 의상동성을가지는 480 bp 단편크기의 PR-10 유전자를확인하였다. 그러나 SSH 분석을통하여확인한 cdna 는단편염기서열만을가지고있으므로전체염기서열을확인하기위하여 RACE PCR 분석을수행하였다. RACE PCR 결과 501bp 의 5` 말단염기서열과 632bp 의 3` 말단염기서열을확인하였으며전체염기서열을결정한후 PyrcpPR-10 이라명명하였다. PyrcpPR-10 유전자의전체길이는 745bp 였으며 480bp 의 ORF 와 159 개의아미노산을가지는것으로분석되었다 (Fig. 1). 단백질의크기는 KDa 이며등정점은 5.6 으로예측되었다. 고도저항성 Bartlett 과 , 저항성 황실리, 중도저항성 감천배, 감수성 원황, 고도감수성 신고 와 스위트스킨 간의 PyrcpPR-10 유전자의염기서열차이를확인하기위하여 6 개품종에대해 RACE PCR 를수행한결과 , 황실리, 감천배 원황, 신고, 스위트스킨 은동일한염기서열을가지고있었다 ( 자료미제시 ). 하지만 Bartlett 은일부염기서열의차이와 3` 말단 UTR 부분에 36bp 의추가적인염기서열을가지고있었으며 PyrcPR-10 이라명명하였다 (Fig. 2). PyrcpPR-10 단백질은 번아미노산잔기에서인산기결합에관여하는 P-loop 의특징인 GXGGXG motif 를가지고있었는데 (Saraste et al. 1990), 이러한 motif 는 nucleotide 결합단백질과같은단백질인산화효소에서많 Fig. 2 Alignment of nucleotide sequence of PyrcpPR-10 and PyrcPR-10

34 J Plant Biotechnol (2015) 42: 이발견되며 PR-10 단백질의 RNase 활성에관여하는것으로보고되어있다 (Bantignies et al. 2000). PyrcpPR10 의아미노산서열을이용하여 GeneBank 데이터베이스에서유사한아미노산을가지는다른종의 PR-10 과비교한결과공통적으로 GXGGXG motif 가존재하며 Malus domestica (CAK ), Prunus mume (XP_ ), Fragaria vesca subsp. Vesca (XP_ ), Datisca glomerata (CAD ), Ziziphus jujube (AGL ) 와의상동성은각각 98, 83, 79, 63, 64% 였다 (Fig. 3A). 7 개의유전자를이용하여 PyrcpPR-10 의계통수를분석한결과크게 2 개의그룹으로나뉘었으며 Malus domestica (CAK ), Prunus mume (XP_ ), Ziziphus jujube (AGL ) 와같은그룹에속했다 (Fig. 3B). 기관별발현양상 PR-10 유전자는화분 (Breiteneder et al. 1989), 잎 (Park et al. 2004), 줄기 (Liu et al. 2005), 종자 (Wu et al. 2003), 과일 (Atkinson et al. 1996) 등여러기관에서발현되며형질전 환체를이용한 PR-10 유전자의구상적발현은사이토키닌의증가를유도하였다 (Srivastava et al. 2006). 이러한결과는 PR-10 유전자가병원체에대한방어반응과환경스트레스뿐만아니라식물의생장과발달에도중요한역할을하는것으로보여진다. 본연구에서는배의품종과기관및조직별 PR-10 유전자의발현량을조사하기위하여 Bartlett, , 황실리, 감천배, 원황, 신고, 스위트스킨 7 개의품종의꽃잎, 꽃대, 잎, 수피, 눈으로부터 RNA 를분리하여 real-time PCR 분석을실시하였다 (Fig. 4). 그결과꽃잎에서가장높은발현을보였으며, 특히고도저항성 Bartlett 에서가장높았다. 다음으로잎, 꽃대, 눈순이었으며수피는다른기관이나조직에비해현저히낮은발현을보였다. Lotan et al. (1989) 은 PR protein 의발현이개화에관련되어있다고보고하였으며, 특히자작나무에서분리한 PR-10(Betvl) 은꽃가루에서많이발현되었다 (Breiteneder et al. 1989). 그러나알파파에서분리한 PR-10(PPRG2) 은뿌리에서가장높은발현을보였으며줄기잎과비교하여꽃잎에서높은발현을보이지 Fig. 3 Alignment and phylogenetic tree analysis of the predicted amino acid sequence of PyrcpPR-10 with other related plant PR-10 proteins. A, Alignment of the deduced amino acid sequences of PR-10 genes obtained from Malus domestica (CAK ), Prunus mume (XP_ ), Fragaria vesca subsp. vesca (XP_ ), Datisca glomerata (CAD ), Ziziphus jujuba (AGL ) are compared. Conserved domain (GXGGXG) is boxed; B, Phylogenetic tree with other related plant PR-10 proteins. Phylogenetic tree was obtained by using the neighbor-joining tree method in Mega6

35 30 J Plant Biotechnol (2015) 42:25 33 Fig. 4 Quantitative reverse transcription-polymerase chain reaction (RT-PCR) analysis of PyrcpPR-10 was conducted with various organs and tissues. BT, Bartlett ; PS2, ; HG, Hwangsilri ; GC, Gamcheonbae ; WH, Wonhwang ; NI, Niitaka ; SS, Sweat Skin. Bars represent the means with standard errors from three replications. Actin gene was used as an endogenous control and the data were calibrated relative to the transcript levels in cdna from Sweat Skin pear bark 않았다 (Borsics and Lados 2002). 따라서 PyrcpPR-10 유전자는식물에따라기관특이적으로발현되어각각의기관에서서로다른기능을하는것으로보여지며, 특히꽃잎에서높은발현을보임으로써꽃의발달에관여하는것으로추측된다. 그러나검은별무늬병감수성차이에따른품종특이적발현은나타나지않았다. V. nashicola 에의해유도된 PR-10 유전자의발현양상 검은별무늬병저항성품종에서특이적으로발현하는 PyrcpPR-10 유전자의발현양상을조사하기위해고도저항성 Bartlett, , 저항성 황실리, 중도저항성 감천배, 이병성 원황, 고도이병성 신고, 스위트스킨 7 개품종에 V. nashicola 를접종하였으며접종시간 (24, 48, 72, 96, 120, 148 시간 ) 에따라감염된잎조직으로부터 RNA 를추출하여 real-time PCR 분석을실시하였다 (Fig. 5) PyrcpPR10 유전자는모든품종에서 24 시간접종후발현이크게증가하였으며 Bartlett, , 황실리 원황 의경우접종 48 시간처리구에서급격히감소한반면 감천배, 신고, 스위트스킨은급격한감소를보이지않았다 의경우 72 시간후다시발현이증가하였으나나머지품종들은점차적으로감소하였으며 96 시간이후낮은발현을유지하였다. PyrcpPR10 유전자의발현은검은별무늬병저항성에따라차이를보였는데고도저항성 Bartlett 과 , 저항성 황실리 에서가장높은발현을보였으며다음으로중도저항성 감천배 와감수성 원황 이높았고고도감수성 신고 와 스위트스킨 에서는가장낮은발현을보였다. 이러한결과는 PR10 유전자가저항성품종에서특이적으로높게발현되어검은별무늬병에저항성을가지며, 특히접종초기에높은발현을보임으로써병원균의침입을억제하는데중요한역할을하는것으로여겨진다. 다양한 PR10 유전자가바이러스 (Park et al. 2004), 박테리아 (Robert et al. 2001), 곰팡이 (Xie et al. 2010) 등에노출되었을때유전자의발현이증가하였으며 in vitro 실험을통해식물병원성세균의생장이억제되었다는보고와같은결과를보였다 (Flores et al. 2002). 또한 yellow-fruit nightshade (Solanum surattense) 에서분리한재조합 SsPR10 단백질은벼의도열병균 (Pyricularia oryzae) 의생장저해와 RNase 의활성을보여주었는데 (Liu et al. 2006), 이러한 RNase 의활성은많은 PR-10 유전자에서보고되어져있으며 (Swoboda et al. 1996; Srivastava et al. 2006; Yan et al. 2008) 방어반응에관련되어져있는것으로여겨진다. 이상의결과를종합해보면본연구에서분리한 PyrcpPR-10 유전자는병저항성에관여하며또한식물의생장과발달에중요한역할을하는것으로판단된다. 현재까지여러식물에서 PR-10 유전자의발현특성에대해많은연구가진행되어왔으나정확한메커니즘에대한정보는부족한실정이다. 따라서향후 PyrcpPR-10 유전자의단백질

36 J Plant Biotechnol (2015) 42: Fig. 5 Relative expression of PyrcpPR-10 in various pear cultivars having different scab-susceptibilities at 0, 24, 48, 72, 96, 120 and 144 h after inoculation with V. nashicola. BT, Bartlett ; PS2, ; HG, Hwangsilri ; GC, Gamcheonbae ; WH, Wonhwang ; NI, Niitaka ; SS, Sweat Skin. Bars represent the means with standard errors from three replications. Quantitative real-time PCR was performed to measure the relative expression of PyrcpPR-10. Actin gene was used as an endogenous control and the data were calibrated relative to the transcript levels in cdna from uninoculated Sweat Skin pear leaves 특성분석과형질전환체제작을통해기능을밝힘으로써 PyrcpPR-10 유전자의발현조절을통한검은별무늬병저항성품종개발에활용할수있을것으로기대된다. 사사 본연구는농촌진흥청연구사업 ( 과제번호 : PJ ) 의지원에의해이루어진것임. 적요 배검은별무늬병고도저항성 과고도감수성 스위트스킨 간의 suppression subtractive hybridization 분석을통해 에서특이적으로발현되는 pathogenesis-related 10 (PR-10) 유전자를분리하여 PyrcpPR-10 으로명명하고기관및품종별발현양상을분석하였다. 단편염기서열의 rapid amplification of cdna ends PCR 을통해 PyrcpPR-10 유전자는전체길이가 743bp 이고, 480bp 의 ORF 와 159 개의아미노산을가지는것으로확인되었다. PyrcpPR-10 유전자의염기서열은 황실리 ( 저항성 ), 감천배 ( 중도저항성 ), 원황 ( 중도감수성 ), 신고, 스위트스킨 ( 고도감수성 ) 은 동일하였으나 Bartlett ( 고도저항성 ) 은일부염기서열의차이를보였다. BLAST X 를통한다른식물종의 PR-10 아미노산과비교에서 64 ~ 98% 의상동성을보였고공통적으로 GXGGXG motif 를가지고있었다. 기관및조직별 PyrcpPR-10 유전자의발현량은꽃잎이가장높았으며다음으로잎, 꽃대, 눈, 수피순이었다. 저항성과감수성품종에따른 PyrcpPR-10 유전자의발현양상은모든품종에서접종 24 시간후급격히증가였으며, 특히 Bartlett, , 황실리 에서높게발현되었고 감천배, 원황 의경우저항성품종에비해상대적으로낮았으며, 고도감수성 신고, 스위트스킨 은발현이가장낮았다. 배에서분리한 PyrcpPR-10 유전자는검은별무늬병저항성에직접연관되는것으로추정된다. Reference Atkinson RG, Perry J, Matsui T, Ross GS, Macrae EA (1996) A stress-, pathogenesis-, and allergen-related cdna in apple fruit is also ripening-related. NZ J Crop Hort. Sci 24 : Bantignies B, Séguin J, Muzac I, Dédaldéchamp F, Gulick P, Ibrahim R (2000) Direct evidence for ribonucleolytic activity of a PR-10-like protein from white lupin roots. Plant Mol Biol 42 :

37 32 J Plant Biotechnol (2015) 42:25 33 Borsics T and Lados M (2002) Dodder infection induces the expression of a pathogenesis-related gene of the family PR10 in alfalfa. J Exp Bot 53 : Breiteneder H, Pettenburger K, Bito A, Valenta R, Kraft D, Rumpold H, Scheiner O, Breitenbach M (1989) The gene coding for the major birch pollen allergen Betv1, is highly homologous to a pea disease resistance response gene. EMBO J 8 : Bufe A, Spangfort MD, Kahlert H, Schlaak M, Becker W-M (1996) The major birch pollen allergen, Betv1, shows ribonuclease activity. Planta 199 : Faize M, Faize L, Ishizaka M, Ishii H (2004) Expression of potential defense responses of Asian and European pears to infection with Venturia nashicola. Physiol Mol Plant Pathol 64 : Flores T, Alape-Girón A, Flores-Díaz M, Flores HE (2002) Ocatin. A novel tuber storage protein from the andean tuber crop oca with antibacterial and antifungal activities. Plant Physiol 128 : Fujimoto Y, Nagata R, Fukasawa H, Yano K, Azuma M, Iida A, Sugimoto S, Shudo K, Hashimoto Y (1998) Purification and cdna cloning of cytokinin-specific binding protein from mung bean (Vigna radiata). Eur J Biochem 258 : Iandolino A, da Silva FG, Lim H, Choi H, Williams L, Cook D (2004) High-quality RNA, cdna, and derived EST libraries from grapevine (Vitis vinifera L.). Plant Mol Bio Rep 22 : Ishii H, Udagawa H, Nishimoto S, Tsuda T, Nakashima H (1992) Scab resistance in pear species and cultivars. Acta Phytopathol Entomol Hung 27 : Kim SH, Koh GC, Hwang B, Lee HJ and, Hong SW (2009) Identification of Differential Gene Expression in Juvenile vs. Mature Leaves of Pear (Pyrus pyrifolia) by Using Annealing Control Primer. J. Korea. Soc. Appl. Biol. Chem 52 : Liu J-J and Ekramoddoullah AK (2006) The family 10 of plant pathogenesis-related proteins: their structure, regulation, and function in response to biotic and abiotic stresses. Physiol Mol Plant Pathol 68 : 3-13 Liu J-J, Ekramoddoullah AK, Piggott N, Zamani A (2005) Molecular cloning of a pathogen/wound-inducible PR10 promoter from Pinus monticola and characterization in transgenic Arabidopsis plants. Planta 221 : Liu X, Huang B, Lin J, Fei J, Chen Z, Pang Y, Sun X, Tang K (2006) A novel pathogenesis-related protein (SsPR10) from Solanum surattense with ribonucleolytic and antimicrobial activity is stress-and pathogen-inducible. J Plant Physiol 163 : Lotan T, Ori N, Fluhr R (1989) Pathogenesis-related proteins are developmentally regulated in tobacco flowers. Plant Cell 1 : Moiseyev GP, Beintema JJ, Fedoreyeva LI, Yakovlev GI (1994) High sequence similarity between a ribonuclease from ginseng calluses and fungus-elicited proteins from parsley indicates that intracellular pathogenesis-related proteins are ribonucleases. Planta 193 : Park CJ, Kim KJ, Shin R, Park JM, Shin YC, Paek KH (2004) Pathogenesis-related protein 10 isolated from hot pepper functions as a ribonuclease in an antiviral pathway. Plant J 37 : Park P, Ishii H, Adachi Y, Kanematsu S, Ieki H, Umemoto S (2000) Infection behavior of Venturia nashicola, the cause of scab on Asian pears. Phytopathology 90 : Robert N, Ferran J, Breda C, Coutos-Thévenot P, Boulay M, Buffard D, Esnault R (2001) Molecular characterization of the incompatible interaction of Vitis vinifera leaves with Pseudomonas syringae pv. pisi: Expression of genes coding for stilbene synthase and class 10 PR protein. Eur J Plant Pathol 107 : Rozen S, Skaletsky HJ (1998) Primer 3. Code available at www-enome.wi.mit.edu/genome_software/other/primer3.html. Saraste M, Sibbald PR, Wittinghofer A (1990) The P-loop-a common motif in ATP-and GTP-binding proteins. Trend Biochem Sci 15 : Sels J, Mathys J, De Coninck B, Cammue B, De Bolle MF (2008) Plant pathogenesis-related (PR) proteins: a focus on PR peptides. Plant Physiol Biochem 46 : Shin IS, Bae KM, Nam GY, Kang B-C, Chun J, Cho KH, Kim SH, Choi HS, Kim HR, Hwang HS (2012) Identification of genes induced by Venturia nashicola in indigenous Korean pear Hwangsilri. Hort. Environ. Biotechnol. 53 : Sikorski MM, Biesiadka J, Kasperska AE, Kopciʼnska J, Łotocka B, Golinowski W, Legocki AB (1999) Expression of genes encoding PR10 class pathogenesis-related proteins is inhibited in yellow lupine root nodules. Plant Sci 149 : Somssich IE, Schmelzer E, Bollmann J, Hahlbrock K (1986) Rapid activation by fungal elicitor of genes encoding pathogenesisrelated proteins in cultured parsley cells. PNAS 83 : Srivastava S, Emery RN, Kurepin LV, Reid DM, Fristensky B, Kav NN (2006) Pea PR 10.1 is a ribonuclease and its transgenic expression elevates cytokinin levels. Plant Growth Regul 49 : Srivastava S, Fristensky B, Kav NN (2004) Constitutive expression of a PR10 protein enhances the germination of Brassica napus under saline conditions. Plant Cell Physiol 45 : Swoboda I, Hoffmann-Sommergruber K, O'Ríordáin G, Scheiner O, Heberle-Bors E, Vicente O (1996) Bet v 1 proteins, the major birch pollen allergens and members of a family of conserved pathogenesis-related proteins, show ribonuclease activity in vitro. Physiol Plant 96 : Van Loon L and Van Strien E (1999) The families of pathogenesisrelated proteins, their activities, and comparative analysis of PR-1 type proteins. Physiol Mol Plant Path 55 : Wen J, Vanek-Krebitz M, Hoffmann-Sommergruber K, Scheiner O, Breiteneder H (1997) The potential of Betv1 homologues, a nuclear multigene family, as phylogenetic markers in flowering plants. Mol Phylogenet Evol 8 : Wu F, Yan M, Li Y, Chang S, Song X, Zhou Z, Gong W (2003) cdna cloning, expression, and mutagenesis of a PR-10 protein SPE-16 from the seeds of Pachyrrhizus erosus. BBRC

38 J Plant Biotechnol (2015) 42: : Xie Y-R, Chen Z-Y, Brown RL, Bhatnagar D (2010) Expression and functional characterization of two pathogenesis-related protein 10 genes from Zea mays. J Plant Physiol 167 : Yan Q, Qi X, Jiang Z, Yang S, Han L (2008) Characterization of a pathogenesis-related class 10 protein (PR-10) from Astragalus mongholicus with ribonuclease activity. Plant Physiol Biochem 46 : Zheng Q-L and Ishii H (2009) Molecular cloning and expression analysis of genes related to phosphatidic acid synthesis in Japanese pear leaves inoculated with Venturia nashicola. J Gen Plant Pathol 75 : Zhou X-J, Lu S, Xu Y-H, Wang J-W, Chen X-Y (2002) A cotton cdna (GaPR-10) encoding a pathogenesis-related 10 protein with in vitro ribonuclease activity. Plant Sci 162 :

39 J Plant Biotechnol (2015) 42:34 42 DOI: ISSN Research Article 생물반응기를이용한적하수오부정근의바이오매스와생리활성물질대량생산 이경주 박영기 김자영 정택규 윤경섭 백기엽 박소영 Production of biomass and bioactive compounds from adventitious root cultures of Polygonum multiflorum using air-lift bioreactors Kyung-Ju Lee Youngki Park Ja-Young Kim Taek-Kyu Jeong Kyung-Seop Yun Kee-Yoeup Paek So-Young Park Received: 9 March 2015 / Revised: 23 March 2015 / Accepted: 23 March 2015 c Korean Society for Plant Biotechnology Abstract This study was conducted to investigate the productivity of biomass and antioxidant compounds in Polygonum multiflorum by culturing explants in air-lift bioreactor containing Murashige and Skoog (MS) medium, by adding different concentrations of auxins [indole-3-butyric acid (IBA) and naphthalene acetic acid (NAA)], sucrose, methyl jasmonate (MeJA), and salicylic acid (SA). Results of this study revealed that the explants culturing on the medium supplemented with 9.84 μm IBA and 50 g/l sucrose were observed to have higher productivity of biomass and bioactive compound than other treatments used. Thus, we expect that these results will be helpful for large-scale production of biomass and antioxidant compounds from Polygonum multiflorum. Keywords Bioreactor, Polygonum multiflorum, Bioactive compounds, Adventitious root, Biomass K.-J. Lee K.-Y. Paek S.-Y. Park ( ) 충북대학교원예과학과 (Department of Horticultural Science, Division of Animal, Horticulture and Food Sciences, Chungbuk National University, Cheongju , Republic of Korea) soypark7@cbnu.ac.kr Y. K. Park 국립산림과학원 ( Department of Forest Genetic Resources, Korea Forest Research Institute, Suwon , Republic of Korea) J.-Y. Kim T.-K. Jeong K.-S. Yun ( 주 ) 사임당화장품 (Saimdang Cosmetics Co., Ltd, Ochang 143, Cheongwon-eup, Chungbuk , Republic of Korea) 서언 적하수오 (Polygonum multifllorum) 는마디풀과 (Polygonaceae) 에속하는다년생덩굴성초본으로한방에서는그덩이뿌리를 적하수오 라고부른다. 적하수오는장기복용시혈압강하와동맥경화억제등의효과가있어예로부터한방과민간요법으로많이이용되어왔으며, 항산화, 신경보호, 항노화, 항돌연변이효과와함께관절통과피부감염억제에효능을나타내는것으로보고되고있다 (Choi et al. 2012). 이러한적하수오의효능은뿌리내에축적된 emodin (1,3,8-trihydroxy-6-methylantraquinone), chrysophanol, rhein, 6-OH-emodin, emodin-8-ß-d-glucoside, polygonimitin B, 2,3,5,4'-tetrahydroxystilbene-2-ß-D-glucoside, gallic acid 등과같은다양한생리활성물질때문으로밝혀졌다 (Lin et al. 2010). 그러나식물체내유효성분의함량은재배환경이나수확시기등에따라차이가심하여산업적인규모에서신약혹은한방화장품등의원료로사용하기위해서는유효성분의함량에변화가적으며대량으로생산가능한효율적인생산시스템의확립이필요하다 (Southwell and Bourke 2001). 식물의조직및세포배양기술은약용식물의유용한생리활성물질을대량생산할수있는방법중하나이다 (Verpoorte et al. 2002). 다양한조직및세포배양법중에서부정근배양법은빠른증식률과안정적인이차대사산물생산이가능하기때문에여러조직및세포배양방법중효율적인방법으로보고되고있다 (Murthy et al. 2008). 특히액체배지를이용하는 3 L 이상의대용량생물반응기배양은플라스크와 petri-dish 를이용하는기존의소규모배양방식에비해연속적인증식과안정적인바이오매스공급이가능하며, 상업적대량화가용이하다 (Chakrabarty et al. 2003). 생물반응기배양시에는많은요인들에의해

40 J Plant Biotechnol (2015) 42: 부정근의생장과생리활성물질의축적량이달라진다 (Murthy et al. 2008). 부정근을이용한생물반응기배양시바이오매스생산량에영향을미치는요인에는배지의염류농도, auxin 의종류와농도, sucrose 의농도, 공기공급량등다양한요인들이알려져있다 (Cui et al. 2011). 병충해및환경요인에의해식물의방어기작으로식물체내에서생성되는이차대사산물은주요생리활성물질로이를증가시키기위해사용되는 elicitor 들은식물체내에서 phytoalexin 축적을증가시킨다 (Zhao et al. 2005). 따라서생물반응기를이용하여부정근으로부터유용한생리활성물질을생산할때 elicitor 를이용하여인위적으로목적하는생리활성물질의함량을증가시켜줄수있다 (Rao and Ravishankar 2002). 최근에는 Echinacea purpurea (Abbasi et al. 2009), Panax ginseng (Sivakumar et al. 2006), Hypericum perforatum (Cui et al. 2010) 등의다양한식물에서부정근을이용한생물반응기대량생산시스템이보고된바있다. 그러나아직까지국내외에서생물반응기를이용한적하수오부정근생장과생리활성물질생산에대한연구는보고된바없다. 따라서본연구에서는적하수오부정근과생리활성물질대량생산을위한생물반응기배양조건을확립하고이를토대로산업적목적의적하수오대량생산을하고자하였다. 이를위해생물반응기배양시배지내무기물함량과 auxin 의종류와농도, sucrose 농도가적하수오부정근의생장과총 phenolics 와 flavonoids 함량에미치는영향을조사하였으며, 배양중 methyl jasmonate 와 salicylic acid 의첨가가생리활성물질축적에미치는영향을조사하였다. 재료및방법 식물재료 본연구에는약전시장에서구매한국내산 2 년생적하수오 (Polygonum multiflorum) 를이용하였다. 적하수오는 2 개월동안온실에서재배한후활력있는뿌리를채취하여 70% 에탄올로 30 초간침지하였다가 2% NaOCl (Sodium hypochlorite) 용액으로 15 분간표면살군한다음멸균수로 3 회세척하였다. 그후뿌리를 IBA 2.46 µm 와 sucrose 30 g/l 가첨가된 3/4 MS 배지에치상하여부정근을유도하였다. 생물반응기배양및부정근증식 총용적이 3 L 인풍선형공기부양생물반응기 (Balloon-type air-lift bioreactor) 에 IBA 4.92 µm 과 sucrose 30 g/l 가첨가된 3/4 MS 배지에부정근을배양하고 4 주간격으로계대배양하였다. 배지는 1 N NaOH 를이용하여 ph 5.8 로 조정후 121 C, 1.2 기압에서 35 분간멸균하여사용하였다. 배양은 4 주간배양한부정근을 0.5 ~ 1 cm 로절단하여생체중 5 g ( 배지 L 당 ) 를초기접종하였다. 이때생물반응기내주입되는공기공급량은공기흐름조절장치 (air meter) 와미세필터 (membrane filter) 를거친후배양전기간동안 0.1 vvm 으로일정하게공급하였다. 배양은 24±1 C 암배양실에서 4 주간유지되었다. 무기물농도에따른부정근의생장과생리활성물질축적 부정근의생장과생리활성물질축적에적합한무기물농도를선정하기위하여 1/4, 1/2, 3/4, 1 배로농도를달리한 MS (Murashige and Skoog 1962) 배지에 IBA 4.92 µm, sucrose 30 g/l 을첨가하여 4 주간배양하였다. 배지의 ph 는고압멸균전 ph 5.8 로조정하였으며, 생체중을기준으로 5 g/l 의배양밀도로부정근을생물반응기에배양한후, 공기공급량을 0.1 vvm 으로조절하였다. 배양은 24±1 C 의암조건인배양실에서 4 주간실시되었으며, 배양 4 주후에흡습지를이용하여부정근에서수분을충분히제거한다음생체중을측정하고부정근을 60 C 로조절한건조기 (FO-600M, Jeio Tech, Korea) 에서 48 시간건조한후건물중을측정하였다. 건물률은최종수확한건물중을최종수확한생체중으로나누어백분율로표시하였다. 총 phenolics 과 flavonoids 분석을위해건조된부정근을각처리별로 1 g 씩채취하여분석용시료로사용하였다. Auxin 의종류와농도에따른부정근의생장과생리활성물질축적 부정근의생장과생리활성물질축적에적합한 auxin 의종류와농도를구명하기위하여 sucrose 30 g/l 가첨가된 3/4 MS 배지에 IBA 의농도를 2.46, 4.92, 9.84, µm 로조절하고, NAA 의농도를 2.69, 5.37, 10.74, µm 로달리하여 4 주간배양하였다. 기타배양조건과조사항목은무기물실험과동일하게실시하였다. Sucrose 농도에따른부정근의생장과생리활성물질축적 Sucrose 농도가부정근의생장과생리활성물질축적에미치는영향을조사하기위하여 IBA 4.92 µm 이첨가된 3/4 MS 배지에 sucrose 농도를 15, 30, 50, 70 g/l 로달리첨가하여 4 주간배양하였다. 기타배양조건과조사항목은 auxin 실험과동일하게실시하였다. Elicitor 종류와농도에따른부정근의생장과생리활성물질축적 Elicitor 종류와농도에따른부정근내총 phenolics 와 flavonoids

41 36 J Plant Biotechnol (2015) 42:34 42 의변화를조사하기위하여 IBA 4.92 µm 과 sucrose 30 g/l 가첨가된 3/4 MS 에서부정근을 3 주간배양한다음 micro filter (0.2 µm) 로여과살균한 methyl jasmonate (MeJA) 와 salicylic acid (SA) 의농도를 0, 50, 100, 200, 400 µm 로조정하여배지내추가적으로첨가한후 1 주간배양을더진행한다음최종적으로 4 주후수확하였다. 수확후부정근은증류수에서세척한다음건조하여분석에이용하였다. 이때배양조건은 sucrose 실험과동일하게유지하였다. 추출물조제및생리활성물질분석 추출물조제건조한 1 g 의부정근을 80% (w/v) 에탄올에침지하여환류냉각추출장치 (LS-2050-S10, LS-TECH, Korea) 를이용하여 80 C 에서 1 시간추출하였다. 추출액은여과지를통과시킨후, 15 ml 로정용하여총 Phenolics 와 flavonoids 분석을위한최종추출물로사용하였다. 총 phenolics 분석추출액 0.1 ml 와표준물질용액 (galic acid) 에각각 2.5 ml 의증류슈를넣어혼합한후 Folin-Ciocalteu reagent 2 N 0.1 ml 를첨가하였다. 6 분경과후 20% Na 2 CO 3 용액 0.5 ml 를첨가한후 30 분간실온에서방치하였으며 760 nm 에서 spectrophotometer (UV-1650 PC, Shimadzu, Japan) 를이용하여흡광도를측정하였다. 표준물질용액의검량선으로부터추출액의 phenolics 함량을측정하였으며, 총 phenolics 함량은 mg/g DW 로표시하였으며, 생산성 (productivity) 은 mg/l medium 으로표시하였다 (Ali et al. 2006a). 총 flavonoids 분석추출액 0.25 ml 와표준물질용액 (catechin) 에 1.25 ml 증류 수를첨가한후 5% NaNO 2 를 0.75 ml 혼합하였다. 6 분후 5% AlCl 3 용액을 0.5 ml 첨가한후, 이혼합액의총량이 2.5 ml 가되도록증류수로적정하였다. 510 nm 에서 spectrophotometer 를이용하여흡광도를측정하였다. 표준물질용액의검량선으로부터추출액의 flavonoids 함량을측정하였으며, Sakanaka et al. (2005) 의방법에따라총 flavonoids 함량은 mg/g DW 로표시하였으며, 생산성은 mg/l medium 으로표시하였다. 통계처리통계처리는 SAS 프로그램 (Software Version 9.3; SAS Institute, Cary, NC) 을이용하여 5% 유의수준에서 Duncan 의다중검정처리하였다. 결과및고찰 무기물농도에따른부정근의생장과생리활성물질축적 적하수오부정근의생장에적합한배지내무기물농도를구명하기위하여 MS 배지의무기염류농도를 1/4, 1/2, 3/4, 1 배로달리하여 4 주간배양한결과 3/4 MS 처리구에서생체중 g 으로가장높았으며, 건물중은 1 배 MS 배지에서 10.5 g 으로가장높았다 (Fig. 1A). 전반적으로무기물농도와비례하여건물중이증가하는경향을보여, 무기물농도와건물중이상관관계를가지고있음을알수있다 (Fig. 1B). 식물의세포및조직배양에가장많이이용되는배지는 Murashigh & Skoog (MS) 배지로다른배지에비해 MS 배지는총질소함량이비교적높다 (George et al. 1988). 배지내포함된무기물농도는식물의기관형성및식물체생장에영향을미치는데 (Amiarouche et Fig. 1 Effect of MS medium strength on adventitious root culture of P. multiflorum after 4 weeks of culture. A. Effect of medium strength on adventitious root growth. B. Correlation between MS medium strength and productivity of biomass

42 J Plant Biotechnol (2015) 42: al. 1985), 부정근증식의경우식물에따라 MS 농도에대한요구도차이가있다. Panax ginseng 배양시부정근의생장량은 1 MS 배지에서가장높아본실험결과와일치하였으나 (Yu et al. 2000), Echinacea angustifolia 부정근 (Murthy et al. 2014) 과 Hypericum perforatume 부정근배양 (Cui et al. 2010) 에서는 1/2 MS 농도에서생장량이가장높아낮은농도의 MS 배지가부정근의생장에적합하였다. 부정근의건물중 1 g 당총 phenolics 와 flavonoids 함량은생장량과반대로 1/4 MS 처리구에서각각 mg/g DW, mg/g DW 로가장높았다 (Fig. 2A). Phenolics 와 flavonoids 는다양한스트레스요인에대해식물체가내성을가질수있도록한다 (Izbianska et al. 2014). 본실험에서는무기물함량이적은 1/4 MS 처리구에서스트레스를받아건물중 1 g 당총 phenolics 와 flavonoids 함량이증가한것으로보인다. 그러나배지 1 L 당 phenolics 와 flavonoids 의생산성은건물중 1 g 당함유된생리활성물질함량이조금낮아도부정근생장량이높은 1 MS 처리구에서각각 mg/l medium, mg/l medium 으로가장높았다 (Fig. 2B). 따라서본실험에서적하수오의부정근의생장과생리활성물질축적에적합한최적의 MS 무기염류농도는 1 배의 MS 배지였다. Auxin 의종류와농도에따른부정근의생장과생리활성물질축적 Auxin 의종류와농도를달리하여적하수오부정근을 4 주간배양한결과생체중은 IBA 4.92 µm 처리구에서 g 으로가장높았으며건물중은 IBA µm 처리구에서 8.91 g 으로가장높았다 (Fig. 3A). 부정근유도및증식에 IBA 처리구가 NAA 처리구에비해효과적이었으며, NAA 농도가높아질수록생체중과건물중이감소하는경향을보였다. Hasan et al. (2014) 은 Labisia 의부정근유도에 IBA 가효과적이었는데이는 IBA 가 NAA 에비해강력한뿌리근원기유도효과가있기때문이라고하였다. Auxin 은부 Fig. 2 Effect of MS medium strength on bioactive compounds in the adventitious root of P. multiflorum after 4 weeks of culture. A. Content of bioactive compounds (mg/g DW). B. Productivity of bioactive compounds (mg/l medium) Fig. 3 Effect of auxins type and concentration on adventitious root growth of P. multiflorum after 4 weeks of culture. A. IBA. B. NAA

43 38 J Plant Biotechnol (2015) 42:34 42 정근의측근형성과길이신장에가장큰역할을하는생장조절물질로부정근에미치는영향은 auxin 의종류와농도에따라, 그리고식물종에따라다르게나타난다 (Lee et al. 2010). Panax ginseng (Jeong et al. 2009) 과 Echinacea augustifolia (Wu et al. 2006) 의부정근배양에서도 IBA 는측근의형성과길이신장을촉진시켜부정근배양에최적의생장조절물질임을시사하였다. Auxin 의종류와농도가적하수오부정근의생리활성물질축적에미치는영향을조사한결과부정근의건물중 1 g 당총 phenolics 와 flavonoids 함량은처리구별로유의적인차이가보이지않았으나, 배지 1 L 당총 phenolics 와 flavonoids 함량은고농도의 IBA 처리구에서가장높았다 (Fig. 4). IBA µm 처리구에서총 phenolics 함량과총 flavonoids 함량이각각 mg/l, mg/l 로가장높은반면에고농도의 NAA 처리구에서는 phenolics 와 flavonoids 의함량이감소하여 NAA 21.4 µm 처리구에서총 phenolics 함량과총 flavonoids 함량이각각 mg/l, 67.7 mg/l 로 가장낮았다. 여러가지 auxin 종류에따른부정근의생리활성물질축적은식물종에따라다른양상을보이는데, 본실험에서고농도의 IBA 가총 phenolics 와 flavonoids 의축적에효과적이었던반면에 Hypericum perforatum (Cui et al. 2010) 와 Echinacea augustifolia (Wu et al. 2006) 부정근배양에서저농도의 IBA 처리구가생리활성물질축적에효과적이었다. 그러나 NAA 처리구가부정근의생리활성물질축적을억제한다는결과는본실험과일치하였다. 앞선실험들과다르게 Eleutherococcus koreanum 부정근배양 (Lee et al. 2010) 에서는고농도의 NAA 처리구가총 phenolics 함량과 flavonoids 함량을크게증가시켜완전히다른경향을보였다. 본실험에서는 IBA µm 처리구에서적하수오부정근의생장과생리활성물질축적이가장높았으나 IBA 9.84 µm 처리구와유의적차이를보이지않아경제성을고려할때부정근대량증식을위해서는 IBA 9.84 µm 를첨가해주는것이가장최적으로생각된다. Fig. 4 Effect of auxins type and concentration on bioactive compounds in the adventitious root of P. multiflorum after 4 weeks of culture. A. Effect of IBA on content of bioactive compounds (mg/g DW). B. Effect of IBA on productivity of bioactive compounds (mg/l medium). C. Effect of NAA on content of bioactive compounds (mg/g DW). D. Effect of NAA on productivity of bioactive compounds (mg/l medium)

44 J Plant Biotechnol (2015) 42: Fig. 5 Effect of sucrose concentration on adventitious root growth of P. multiflorum after 4 weeks of culture Sucrose 농도에따른부정근의생장과생리활성물질축적 배지내 sucrose 농도가적하수오부정근의생장과생리활성물질축적에미치는영향을조사하기위하여당농도를달리하여 4 주간배양한결과 50 g/l 처리구에서생체중과건물중이각각 g, g 으로가장높았다 (Fig. 5). 기내배양시 Sucrose 는탄소원으로이용되며, 식물체의생장과형태형성뿐만아니라삼투압조절의기능을한다. 그러나높은농도의 sucrose 는삼투압을감소시켜배양체의생장을억제하며, 스트레스요인이된다 (Yaseen et al. 2013). 본실험에서는부정근의생체중과건물중, 건물률모두 sucrose 농도가높아짐에따라증가하는경향을나타냈으나가장높은농도인 70 g/l 처리구에서는생체중과건물중이감소하였다. Panax ginseng 부정근배양 (Sivakumar et al. 2005) 에서도 50 g/l 처리구에서부정근의생장량이가장높았으며, Gymnema sylvestre 세포배양 (Lee et al. 2006) 에서는 30 g/l 처리구에서생산량이가장 높았고 30 g/l 이상의처리구에서는오히려생산량이감소한다고하였다. 부정근의건물중 1 g 당총 phenolics 와 flavonoids 함량은 70 g/l 처리구에서각각 24.0 mg/g DW, 13.5 mg/g DW 로가장높았다 (Fig. 6A). 이는높은농도의 sucrose 가삼투압스트레스요인으로작용하여총 phenolics 와 flavonoids 함량을증가시긴것으로보인다. 배지 1 L 당총 phenolics 의생산성또한 sucrose 의농도가높아질수록증가하는경향을보였다 (Fig. 6B). 그러나배지 1 L 당총 flavonoids 생산성은가장낮은농도인 15 g/l 처리구를제외한처리구에서유의적인차이를보이지않았다. Echinacea angustifolia 부정근배양 (Cui et al. 2013) 에서도 sucrose 의농도가증가함에따라총 phenolics 와 flavonoids 함량이증가하다가 70 g/l 이상의고농도에서는오히려감소하는경향을보여본실험과다소유사한결과를보였다. Methyl jasmonate 와 salicylic acid 처리에따른부정근의생장과생리활성물질축적 적하수오부정근의생장과생리활성물질축적에미치는 methyl jasmonate (MeJA) 와 salicylic acid (SA) 의영향을조사하기위하여부정근을 3 주간배양한다음 MeJA 와 SA 의농도를달리처리하여 1 주일간추가배양을하는 2 단계배양을하였다. 부정근생장은 elicitor 의농도가높아질수록감소하는경향을보였으며, 특히 SA 처리구가 MeJA 처리구에비해부정근의생장을최대 1.8 배억제하였다 (Fig. 7). 식물은환경적인스트레스상황에서방어작용을위해생리활성물질을축적한다 (Ebel and Mithofer 1998). 본실험에서는 MeJA 와 SA 가적하수오부정근의스트레스요인으로작용하여생장이감소하였으며, Panax ginseng 부정근배양 (Ali et al. 2006b) 에서도 MeJA 와 SA 처리에의해부정근의생장이억제되었다. Fig. 6 Effect of sucrose concentration on bioactive compounds in the adventitious root of P. multiflorum after 4 weeks of culture. A. Content of bioactive compounds (mg/g DW). B. Productivity of bioactive compounds (mg/l medium)

45 40 J Plant Biotechnol (2015) 42:34 42 Fig. 7 Effect of methyl jasmonate (MeJA) and salicylic acid (SA) concentrations on adventitious root growth of P. multiflorum after 4 weeks of culture. A. MeJA. B. SA Fig. 8 Effect of methyl jasmonate and salicylics acids on bioactive compounds in the adventitious root of P. multiflorum after 4 weeks of culture. A. Phenolics and flavonoids content (mg/g DW) by methyl jasmonate treatment. B. Phenolics and flavonoids productivity (mg/l medium) by methyl jasmonate treatment. C. Phenolics and flavonoids content (mg/g DW) by salicylic acid treatment. D. Phenolics and flavonoids productivity (mg/l medium) by salicylic acid treatment 부정근내총 phenolcis 와 flavonoids 함량을측정한결과모든처리구에서대조구에비해건물중 1 g 당함량이감소하였으며, SA 400 µm 처리구에서총 phenolcis 와 flavonoids 가각각 45.66, mg/g DW 으로함량이가장낮았다 (Fig. 8). 배지 1 L 당총 phenolics 와 flavonoids 의생산성을 계산한결과또한 elicitor 농도가높아질수록감소하여, SA 400 µm 처리구에서총 phenolcis 와 flavonoids 가각각 166.7, mg/l medium 으로가장낮았다. Hypericum hirsutum 과 Hypericum maculatum 배양 (Coste et al. 2011) 에서는 MeJA 와 SA 처리에의해생리활성물질인 hypericin 이증가하였으

46 J Plant Biotechnol (2015) 42: Fig. 9 Adventitious root culture of P. multiflorum. A. Mother plants in greenhouse, B. In vitro grown plantlets. C. Adventitious root culture on petri-dish, D. Adventitious root culture in 300 ml flask, E. Harvested root from liquid culture, F. Adventitious root culture in 3 L air-lift bioreactor after 4 weeks of culture 며, Rhinacanthus nasutus 모상근배양 (Cheruvathur and Thomas 2014) 에서도생리활성물질인 rhinacanthin 축적량이증가하였다. 본실험결과는이와는달리총 phenolcis 와 flavonoids 함량증가에 MeJA 와 SA 의영향은미미하였다. 사사 본연구는산업통상부의지역특화사업연구과제 (No. R ) 의지원을받아수행하였습니다. 적요 본연구는약용식물인적하수오의부정근과생리활성물질대량생산을위해생물반응기배양조건을확립하고자실시되었다. 이를위하여생물반응기배양시배지내무기물함량과, auxin 의종류와농도, sucrose 농도가적하수오부정근의생장과총 phenolics 와 flavonoids 함량에미치는영향을조사하였으며, 배양중 methyl jasmonate (MeJA) 와 salicylic acid (SA) 의첨가가생리활성물질축적에미치는영향을조사하였다. 그결과 9.84 µm IBA 와 50 g/l sucrose 가첨가된 1 배 MS 배지에서최적의부정근생장이이루어졌으며생리활성물질축적도가장높았다. MeJA 와 SA 처리시적하수오부정근의생장과생리활성물질축적은오히려감소하였다. 본연구결과는산업적목적을위한적하수오의부정근과생리활성물질대량생산시기초자료로활용될수있을것으로기대된다. References Abbasi BH, Liu E, Saxena PK, Liu CZ (2009) Cichoric acid production from hairy root cultures of Echinacea purpurea grown in a modified airlift bioreactor. J Chem Technol Biot 84 : Ali MB, Yu KW, Hahn EJ, Paek KY (2006a) Antioxidantive responses of Echinacea angustifolia cultured roots to different levels of CO 2 in bioreactor liquid cultures. Enz Microb Tech 25 : Ali MB, Yu KW, Hahn EJ, Paek KY (2006b) Methyl jasmonate and salicylic acid elicitation induces ginsenosides accumulation, enzymatic and non-enzymatic antioxidant in suspention culture Panax ginseng roots in bioreactors. Plant Cell Rep 25 : Amiarouche L, Stuchbury T, Mattews S (1985) Comparisons of cultivar performance on different nutrient media in a routine method for potato micropropagation. Potato Res 28 : Chakrabarty D, Hahn EJ, Yoon YJ, Paek KY (2003) Micropropagation of apple rootstock M.9 EMLA using bioreactor. J Hortic Sci Biotech 78 :

47 42 J Plant Biotechnol (2015) 42:34 42 Cheruvathur MK, Thomas TD (2014) Effects of plant growth regulators and elicitors on rhinacanthin accumulation in hairy root cultures of Rhinacanthus nasutus (L.) Kurz. Plant Cell Tiss Org 118 : Choi JW, Lee HS, Kim YG, Kim BM, Kim IH, Lee CH (2012) Effect of Polygonum multiflorum Thunberg Extract on Lipid Metabolism in Rats Fed High-Cholesterol Diet. J Korean Soc Food Sci Nutr 41 : Coste A, Vlase L, Halmagyi A, Deliu C, Coldea G (2011) Effects of plant growth regulators and elicitors on production of secondary metabolites in shoot cultures of Hypericum hirsutum and Hypericum maculatum. Plant Cell Tiss Org 106 : Cui XH, Chakrabarty D, Lee EJ, Paek KY (2010) Production of adventitious roots and secondary metabolites by Hypericum perforatum L. in a bioreactor. Bioresource Technol 101 : Cui XH, Murthy HN, Jin YX, Yim YH, Kim JY, Paek KY (2011) Production of adventitious root biomass and secondary metabolites of Hypericum perforatum L. in a balloon type airlift reactor. Bioresource Technol 102 : Cui HY, Baque MA, Lee EJ, Paek KY (2013) Scale-up of adventitious root cultures of Echinacea angustifolia in a pilot-scale bioreactor for the production of biomass and caffeic acid derivatives. Plant Biotechnol Rep 7 : Ebel J, Mithofer A (1998) Early events in the elicitation of plant defense. Planta 206 : George EF, Puttock DJM, Geroge HJ (1988) Plant culture media: Commentary and analysis. Vol. 2. Exegetics Ltd, Edington, UK Hasan NA, Hussein S, Ibrahim R (2014) Plant growth regulator effect on adventitious roots induction of Labisia pumila. Malaysian J Fundamental Appl Sci 10 : Izbianska K, Jelonek MA, Deckert J (2014) Phenylpropanoid pathway metabolites promote tolerance response of lupine roots to lead stress. Ecotox Environl Safe 110 : Jeong CS, Murthy HN, Hahn EJ, Paek KY (2009) Inoculum size and auxin concentration influence the growth of adventitious roots and accumulation of ginsenosides in suspension cultures of ginseng (Panax ginseng C.A. Meyer). Acta Physiol Plant 31 : Lee EJ, Mobin M, Hahn EJ, Paek KY (2006) Effects of sucrose, inoculum density, auxins, and aeration volume on cell growth of Gymnema sylvestre. J Plant Biol 49 : Lee EJ, Kim MK, Paek KY (2010) Auxin and cytokinin affect biomass and bioactive compound production from adventitious roots of Eleutherococcus koreanum. Kor J Hort Sci Technol 28 : Lin HT, Nah SL, Huang YY, Wu SC (2010) Potential antioxidant components and characteristics of fresh Polygonum multiflorum. J Food Drug Anal 18 : Murthy HN, Hahn EJ, Paek KY (2008) Adventitious roots and secondary metabolism. Chinese J Biotechnol 24 : Murthy HN, Kim YS, Park SY, Paek KY (2014) Biotechnological production of caffeic acid derivatives from cell and organ cultures of Echinacea species. Appl Microbiol Biot 14 : Rao SR, Ravishankar GA (2002) Plant cell cultures: chemical factories of secondary metabolites. Biotech Adv 20 : Sakanaka S, Tachibana Y, Okada Y (2005) Preparation and antioxidant properties of extracts of Japanese persimmon leaf tea (kakinohacha). Food Chem 89 : Sivakumar G, Yu KW, Paek KY (2005) Production of biomass and ginsenosides from adventitious roots of Panax ginseng in bioreactor cultures. Eng Life Sci 5 : Sivakumar G, Yu KW, Paek KY (2006) Enhanced production of bioactive ginsenosides from adventitious roots of Panax ginseng in bioreactor culture. J Hortic Sci Biotech 81 : Southwell LA. and Bourke CA (2001) Seasonal variation in hypercin content of Hypericum perforatum L. (St. John s wort). Phytochemistry 56 : Verpoorte R, Contin A, Memelink J (2002) Biotechnology for the production of plant secondary metabolites. Phytochem Rev 1 : Wu CH, Dewir YH, Hahn EJ, Paek KY (2006) Optimization of culturing conditions for the production of biomass and phenolics from adventitious roots of Echinacea angustifolia. J Plant Biol 49 : Yaseen M, Ahmad T, Sablok G, Standardi A, Hafiz IA (2013) Review: rol of carbon sources for in vitro plant growth and development. Mol Biol Rep 40 : Yu KW, Hahn EJ, Paek KY (2000) Production of adventitious ginseng roots using bioreactors. Korean J Plant Tiss Cult 27 : Zhao J, LC Davis, R Verpoorte (2005) Elicitor signal transduction leading to production of plant secondary metabolites. Biotechnol Adv 23 :

48 J Plant Biotechnol (2015) 42:43 48 DOI: ISSN Research Article 전라남도지역감바이로이드의감염상황및무병화효율연구 김대현 김인수 이건섭 조인숙 조강희 신일섭 김세희 천재안 최인명 Current occurrence of persimmon viroid and citrus viroid in persimmon in JellaNam-do and testing for viroid inactivation methods Dae Hyun Kim In-Soo Kim Gunsup Lee In-Sook Cho Kang Hee Cho Il Sheob Shin Se Hee Kim Jae An Chun In-Myung Choi Received: 9 March 2015 / Revised: 20 March 2015 / Accepted: 20 March 2015 c Korean Society for Plant Biotechnology Abstract It is a serious situation that the farmers' income has gradually decreased due to the decline of productivity of fruit trees infected with viroids. It has been known that Persimmon viroid (PVd) and Citrus viroid (CVd) are economically important viroids that can infected persimmon. In this study, the incidence of CVd and PVd in Fuyu persimmon were identified as 41% and 34% in JeollaNam-do, respectively. The collected persimmon samples infected by both PVd and CVd were used for testing efficiency of the viroid inactivation methods. The samples were subjected to single treatment of the heat treatment (37 C), cold treatment (4 C), or antiviral agent treatment (Ribavirin), and double treatment of combinations of the three methods. Viroid inactivation efficiency was confirmed through RT-PCR. In the case of the samples subjected to cold treatment for 4 weeks, the viroid inactivation efficiency was most significantly high as 67% against the survival rate of 100%. In addition, in the case of the samples treated for 2 weeks with the antiviral agents and cold D. H. Kim I.-S. Kim G. S. Lee K. H. Cho ( ) S. H. Kim J. A. Chun I.-M. Choi 농촌진흥청국립원예특작과학원과수과 (Fruit Research Division, National Institute of Horticultural and Herbal Science, RDA, Wanju , Korea) khc7027@korea.kr I.-S. Cho 농촌진흥청국립원예특작과학원원예특작환경과 (Horticultural and Herbal Crop Environment Division, National Institute of Horticultural and Herbal Science, RDA, Wanju , Korea) I. S. Shin 농촌진흥청국립원예특작과학원배연구소 (Pear Research Institute, National Institute of Horticultural and Herbal Science, RDA, Naju , Korea) treatment, the viroid inactivation rate was similar to that of the cold treatment. In conclusion, the cold treatment showed the highest viroid inactivation efficiency, and this result will provide valuable information for production of viroid-free persimmon. Keywords Antiviral agents, Citrus viroid, Cold treatment, Heat treatment, Persimmon viroid 서론 감은매우중요한과수작물중하나로농림축산식품부통계자료에따르면 2000 년대에들어전체감생산면적은약 3.1 만 ha, 생산량은 28 만톤으로전세계적으로중국에이어두번째로많이재배되고있다. 그러나감의병해충연구특히, 바이러스및바이로이드에관한연구는거의이루어지지않고있다. 감에감염되는대표적인바이로이드는 persimmon viroid(pvd) 와 citrus viroid(cvd) 등이존재하는것으로알려져있다 (Ito et al. 2013; Nakaune and Nakano 2008). 일반적으로알려진감바이로이드증상은잎에검은반점및얼룩이생성되거나과실의괴사반점, 줄기및가지의검은색얼룩등이있으나아직까지는이러한증상에의한피해가어느정도인지구체적인자료가없는실정이다 (Morton 1987). 사과에감염이가능한바이로이드인 ASSVd(Apple Scar Skin Viroid) 의경우과피얼룩반점및코르크화반점등의증상을유발하며, 수확기에과피전체의 50% 이상이노란색반점들로덮여착색이불균일하고정상과에비해크기가작아지는등상품성을잃는것으로보고되었다 (Kim et al. 2010). 감또한

49 44 J Plant Biotechnol (2015) 42:43 48 과실에바이로이드에의한증상이보고되고있는만큼근본적인감염률조사및바이로이드무병묘생산연구가반드시수행되어야할것으로판단된다. 과수에서바이러스및바이로이드를제거하고무병묘를생산하는연구는매우다양한방법으로수행되었다. 무병묘를생산하는방법은 38 C 로일정기간동안처리하는열처리요법 (Thermotherapy) 과 4 C 로일정기간처리하는한냉요법 (Coldtherapy), 그리고 ribavirin 과같은항바이러스제를처리하는화학적인요법 (Chemotherapy) 등으로나뉠수있다 (Feng et al. 2013; Hollings 1965; Paduch-Cichal and Kryczynski 1987; Savitri et al. 2013). Campbell(1962) 은 Virginia Crab, Spy 227, Malus platycarpa 등이열처리와경정배양에의해바이러스가제거됨을확인하였다. Paprstein 등 (2008) 은사과품종인 Idared 와 Sampion 을이용하여열처리를통해실험한결과 Idared 는바이러스가제거되었지만 Sampion 는제거되지않았다. 따라서품종에따라무병화함에있어서처리방법에차이가있음을보여주었다. Paduch-Cichal 과 Kryczynski(1987) 는한냉처리에의해 PSTVd(Potato Spindle tuber viroid) 의제거효과를보여주었으며, Hansen 과 Lane(1985) 은 Malus pumila Mill 사과에항바이러스제 (ribavirin) 를 10, 20, 40, 그리고 80 μm 농도로처리함으로써온실과과수원에식재되어있는사과신초에서 ACLSV(Apple Chlorotic Leaf Spot Virus) 제거효과를확인하였다. 또한국립원예특작과학원에서 Citrus tristeza virus, Satsuma dwarf virus, Citrus tatter leaf virus 에감염된감귤품종을이용하여열처리와경정접목 (shoot-tip grafting) 방법에의해서감귤무병화를수행한바있으며 (Kim et al. 2005), 사과에서도 Apple chlorotic leaf spot virus, Apple stem grooving virus, Apple mosaic virus 와 Apple scar skin viroid 에대해열처리및경정배양에의한무병화신품종을확보하였다 (Lee et al. 2013). 본연구에서는전라남도지역단감재배농가에서수집한부유품종을이용하여바이로이드감염현황을파악하였고, 확보된 CVd 와 PVd 가동시에감염된감식물체의무병화를수행하였다. 또한바이로이드감염이확인된감식물체를이용하여열처리, 한냉처리및항바이러스제처리를통하여무병화효율실험을수행하였다. 재료및방법 시험재료 감바이로이드감염률을조사하기위해전라남도 5 지역 ( 나주, 영암, 담양, 순천, 구례 ) 의 20 농가를선정하였다. 시료는바이로이드진단효율을높이기위하여 6 월에 198 개체의단감부유품종의신초부위에서잎을채취하여실험에이용하였다 (Fig. 1). Fig. 1 Sampling locations in Jeollanam-do and representative symptoms appeared in persimmon infected by citrus viroid and persimmon viroid. A. Locations 1: Naju, 2: Yeongam, 3: Damyang, 4: Suncheon, 5 Gurye B. Viroid symptom in fruit. C. Viroid symptom in leaf

50 J Plant Biotechnol (2015) 42: Table 1 Primer pairs used for detection of persimmon-infecting viroids a and expected sizes of RT-PCR products Target Primer Sequence (5' 3') PCR product (bp) Originated accession No. Upstream CGACAGGTGAGTCTCCTTGC CVd b Downstream TCGTCGACGAAGGCATGTGA 336 AB Upstream CGGCAGGGAGCCTTGCGAAC PVd c Downstream AGCTCGGGGCTGGAGCTTGG 396 NC_ Upstream CGCATCATTCAAATTTCTGC 18S d Downstream TTCAGCCTTGCGACCATACT 843 DQ a The primers for each viroid were designed as species-specific. b CVd: Citrus viroid. c PVd: Persimmon viroid. d 18S: 18s ribosomal RNA. RNA 분리및 RT-PCR 을통한바이로이드진단 채취한단감의신초를이용하여바이로이드진단을위해 CTAB 방법을통해 total RNA 를분리하였다 (Gambino et al. 2008). 확보된 total RNA 는 M-MLV reverse transcriptase (Invitrogen, Carlsbad, CA, USA) 를이용해 cdna 를합성하였으며, Table 1 에언급한프라이머를이용하여 PCR 을수행하였다. CVd 진단의경우 PCR 증폭은총 20 μl 의반응액에 cdna 50 ng, 1 PCR buffer, 250 μm dntps, 1.5 units Ex Taq DNA polymerase(takara, Tokyo, Japan) 를혼합하여수행하였고반응조건은 94 C 에서 40 초, 60 C 에서 40 초그리고 72 C 에서 40 초씩각각 35 회반복하였다. PVd 의경우는위의조건에 extension 시간을 20 초단축하여진단하였다. 또한 total RNA 및 cdna 가완전히합성이확인하기위해 18s 유전자를이용하여 65 C 의 annealing 온도로 PCR 을수행하였다. 경정배양과기내도입 바이로이드진단후무병화효율을확인하기위해 2 종류의바이로이드가모두감염된감시료를이용하여경정배양을통해기내도입을수행하였다. 신초의생장점부위를약 5 mm 크기로잘라내어기내도입배지에치상하였다. 기내도입배지의조성은 MS 배지 1 L 에 BA 2 mg, sucrose 30 g, plant agar 8g 을첨가하여 ph 5.8 로조정한후사용하였다. 약 4 주동안기내도입배지에서경정배양후잎과신초가생성되면바이로이드감염묘를증식배지에옮겼다. 증식배지는 MS 배지 1 L 에 BA 1 mg, IBA 0.3 mg, GA mg, sucrose 30 g, plant agar 8 g 을첨가하였으며, ph 는기내도입배지와같이 5.8 로조정한후사용하였다. 또한 RNA 추출및 RT-PCR 을통해감염여부를확인하였다. 열처리, 한냉처리및항바이러스제처리에의한무병화효율실험 CVd 및 PVd 감염이확인된감부유품종을이용하여열 처리, 한냉처리및항바이러스제처리에의한방법을통하여무병화효율실험을수행하였다. 5 cm 길이로배양된감신초를이용하여각그룹별 9 개의개체를확보하여실험하였다. 열처리와한냉처리는각각 38 C 와 4 C 가유지되는항온항습장치에서처리하였으며항바이러스제처리군은 ribavirin 을배지에 20 ppm 과 40 ppm 의농도로첨가하여 28 C 에서처리하였다. 또한열처리와항바이러스제를복합적으로처리한그룹과한냉처리와항바이러스제를복합처리한그룹으로나누어처리하였으며, 처리기간은각각 2 주, 4 주, 8 주였다. 각시기및처리별그룹들은생장점배양과기내증식을통해증식하였고약 8 주후에 RNA 추출과 RT-PCR 을이용하여바이러스진단을하였다. 결과및고찰 바이로이드감염상황 전라남도지역에서수집한단감 198 개체의바이로이드진단은 RT-PCR 을이용하였다. CVd 는나주지역에서수집한 10 개체중 8 개체가감염됨에따라 80% 의높은감염 Table 2 Incidence of Persimmon viroid (PVd) and Citrus viroid (CVd) on persimmon in Jeollanam-do Region Viroid infection rate (%) CVd a PVd b CVd+PVd Naju 8/10 (80%) 1/10 (10%) 1/10 (10%) Yeongam 26/38 (68%) 7/38 (18%) 5/38 (13%) Damyang 20/50 (40%) 10/50 (20%) 7/50 (14%) Suncheon 22/50 (44%) 30/50 (60%) 17/50 (34%) Gurye 5/50 (10%) 19/50 (38%) 3/50 (6%) In Total 81/198 (41%) 67/198 (34%) 33/198 (17%) a CVd: Citrus viroid. b PVd: Persimmon viroid.

51 46 J Plant Biotechnol (2015) 42:43 48 률을보였고, 영암은 38 개체중 26 개체 (68%), 담양은 50 개체중 20 개체 (40%), 순천은 50 개체중 22 개체 (44%), 마지막으로구례는 50 개체중 5 개체로 10% 의가장낮은감염률을나타냈다. PVd 의경우나주지역은 10% 의감염률을나타냈고, 영암 18%, 담양 20%, 순천 60%, 구례지역은 38% 의감염률을확인할수있었다. 두종류의바이로이드가복합적으로감염되어있는경우는나주 10%, 영암 13%, 담양 14%, 순천 34%, 구례 6% 로확인되었다 (Table 2). 농촌진흥청의 2013 년보고서에의하면경상남도의경우총 227 개체의단감을확인한결과 CVd 는 7.1%, PVd 는 1.7% 의감염률을보고하였으나, 전라남도의경우높은바이로이드감염률을나타냈다. 이는접수를이용해증식되는과수의특성상지역적으로편중되는현상이관찰되는것으로판단되었다. 바이로이드진단결과를기준으로하여과실및잎에서바이로이드증상을확인해본결과검은반점의증상및잎이말리는바이로이드의심증상을관찰할수있었다 (Fig. 1B, 1C). Morton(1987) 은감바이로이드증상으로잎에검은반점이나타나거나과살에괴사반점이발생하는것을보고한바있다. 따라서, 본연구에서관찰된병징은바이로이드증상으로파악하고있으나금후정확한감바이로이드관련증상연구를수행할예정이다. 단감의무병화효율 두종류의바이로이드에대해복합감염된감을경정배양하였고바이로이드진단결과기내증식된감식물체는 Fig. 2 Detection of citrus viroid and persimmon viroid in persimmon PVd and CVd were detected by RT-PCR method in persimmon plants. N: negative, PVd: Persimmon viroid, CVd: Citrus viroid Fig. 3 In vitro propagation of viroid-infected persimmon and treatments of thermotherapy, cold therapy and chemotherapy. A: In vitro culture, B: 2 weeks treated group shoot tip culture, C: 4 weeks treated group shoot tip culture, D: 8 weeks treated group shoot tip culture, E: Subculture of treated persimmon

52 J Plant Biotechnol (2015) 42: 바이로이드에대해모두감염되어있었다 (Fig. 2). CVd 및 PVd 가감염된기내배양감을이용하여무병화효율실험을수행하였다 (Fig. 3). 감무병화묘목을생산하기위해서열처리및한냉처리그리고항바이러스제처리를하는단독처리군과열처리와항바이러스제동시처리군및한냉처리와항바이러스제처리를동시에한복합처리군으로나누어각각의무병화효율을조사하였다. 각각의처리에따른감의생존율은열처리의경우 2 주처리군에서 9 개체중 9 개체모두생존하였지만 4 주및 8 주에서는생존율이 78% 와 44% 로점차낮아졌다. 한냉처리의경우 2 주와 4 주의경우 100% 의생존율을보였으나 8 주처리군에서는생존율이 33% 로급격히저하됨을알수있었다. 항바이러스제 (ribavirin) 의경우는감생존율에큰영향을보여주지않아각처리별생존율에있어서는항바이러스제처리가가장좋은것으로판단되었다. 복합처리의경우단독처리보다처리기간이증가함에따라생존율이감소하는현상이뚜렸하였으며 40 ppm 의항바이러스제와복합처리군의경우는 4 주에서도 44% 와 33% 의낮은생존율을보였고, 특히 8 주차의경우는 33% 이하의낮은생존율을확인할수있었다. 바이로이드제거효율에있어서는단독처리군의경우한냉 4 주차의결과가생존율에있어서 100% 결과를나타냈고바이로이드제거효율도 67% 로가장높은무병화효율을보여주었다 (Table 3). 열처리의경우 71% 의무병화효율을확인하였으나생존율이낮아확보한무병화개체수는한냉처리에비해적었다. Paduch-Cichal 과 Kryczynski (1987) 는국화의 potato spindle tuber viroid 가저온처리에의해효과적으로제거됨을보고하였으며, 본결과에서도바이로이드제거효율에있어서는열처리군에비해한냉처리가무병화효율이높음을알수있었다. 복합처리군의경우, 열처리와항바이러스제 40 ppm 농도로 8 주간처리한군과한냉처리와항바이러스제를 40 ppm 농도 로 8 주간처리한군에서 100% 의바이로이드제거효율을보여주었으나생존율이 11% 와 33% 로매우낮았고, 결론적으로확보된무병개체수가적었다. 열처리와항바이러스제를 20 ppm 농도로 4 주간처리한군에서도 71% 의무병화효율을보였으나최종적인 6 개체의무병묘가획득된처리는한냉처리와항바이러스제를 40 ppm 농로로 2 주간처리한군이었다 (Table 3). El-Dougdoug et al. (2010) 은단독처리에의한방법이외에도한냉처리와항바이러스제복합처리에의해효과적인무병화방법을보고하였다. Hop stunt viroid 를제거하기위해단독처리의경우항바이러스제처리가가장효과적임을확인하였으며복합처리의경우는한냉처리와항바이러스제처리를같이하였을경우생존률이높아지고무병화효율또한높아짐을보고하였다. 본결과에서는단독처리의경우한냉처리가가장좋은효과를보여주었지만복합처리의경우위논문과유사한결과를도출하였다. 결론적으로한냉처리만으로는약 4 주간처리한군에서 67% 의항바이러스제거효율을보여주었으나한냉처리에항바이러스제를복합처리한군의경우시간을단축시켜 2 주간의처리만으로도효과적으로바이로이드를제거할수있을것으로판단할수있었다. 적요 바이로이드에감염된과수의생산성하락으로인한농업인의소득이점점감소하고있는실정이다. 감에감염이가능한바이로이드는 PVd(Persimmon viroid) 와 CVd(Citrus viroid) 등이존재하는것으로알려져있다. 따라서본연구에서는전라남도감재배농가에서의감바이로이드감염현황을확인하였고열처리, 한냉처리, 항바이러스 Table 3 The percentage of survival rate and viroid inactivation efficiency upon thermotherapy, cold-therapy and chemotherapy Ribavirin 37 + Ribavirin 4 + Ribavirin Group Shoot survival rate a Viroid inactivation efficiency b 2 weeks 4 weeks 8 weeks 2 weeks 4 weeks 8 weeks % (9/9) 78% (7/9) 44% (4/9) 44% (4/9) 71% (5/7) 50% (2/4) 4 100% (9/9) 100% (9/9) 33% (3/9) 33% (3/9) 67% (6/9) 67% (2/3) 20 ppm 100% (9/9) 100% (9/9) 100% (9/9) 33% (3/9) 33% (3/9) 33% (3/9) 40 ppm 100% (9/9) 100% (9/9) 89% (8/9) 44% (4/9) 55% (5/9) 50% (4/8) 20 ppm 89% (8/9) 78% (7/9) 33% (3/9) 38% (3/8) 71% (5/7) 0% (0/3) 40 ppm 89% (8/9) 44% (4/9) 11% (1/9) 63% (5/8) 25% (1/4) 100% (1/1) 20 ppm 89% (8/9) 100% (9/9) 33% (3/9) 38% (3/8) 44% (4/9) 33% (1/3) 40 ppm 100% (9/9) 33% (3/9) 33% (3/9) 67% (6/9) 67% (2/3) 100% (3/3) Virus infection was evaluated by RT-PCR. a The number in parentheses refers to numbers of survival plant /numbers of total plants b The number in parentheses refers to numbers of viroid free plant /numbers of survival plants

53 48 J Plant Biotechnol (2015) 42:43 48 제처리를통해무병화효율성을알아보았다. 전라남도나주, 영암, 담양, 순천, 구례의 20 농가에서감부유품종 198 개체를샘플링하였다. RT-PCR 실험을통해감바이로이드의감염률을확인해본결과 CVd 41%, PVd 34% 로확인되었으며이미알려진수준에비해높게감염되어있음을알수있었다. 무병화효율실험은 PVd 와 CVd 가감염된감을이용하였으며처리방법에따라열처리 (38 C), 한냉처리 (4 C), 항바이러스제 (Ribavirin) 단독처리그룹과열처리와항바이러스제를동시에처리한그룹및한냉처리및항바이러스제를동시에처리한그룹으로나누었으며처리시간에따라 2 주와 4 주로나누어각각의바이로이드제거효율을확인하였다. 한냉처리한그룹의경우생존율이 100% 에무병화효율또한 67% 의높은제거효율을확인할수있었고, 한냉처리와항바이러스제를 2 주간복합처리한군에서도 67% 의높은효율을확인하였다. 결론적으로한냉처리가가장높은무병화율을보여주었으며본연구결과를통해감무병화연구에좋은자료가될것으로판단된다. 사사 본연구는 2015 년농촌진흥청국립원예특작과학원의기관고유사업 ( 과제번호 : PJ ) 의지원에의해수행되었음. Reference Campbell AI (1962) Apple virus inactivation by heat therapy and tip propagation. Nature 195 : 520 El-Dougdoug KA, Osman M, Abdelkader HS, Dawoud RA (2010) Elimination of Hop stunt viroid (HSVd) from infected peach and pear plants using cold therapy and chemotherapy. Aust. J. Basic Appl. Sci. 4 : Feng C, Wang R, Li J, Wang B, Yin Z, Cui Z, Li B, Bi W, Zhang Z, Li M, Wang Q (2013) Production of pathogen-free horticultural crops by cryotherapy of in vitro-grown shoot tips. Methods Mol. Biol. 994 : Gambino G, Perrone I, Gribaudo I (2008) A Rapid and effective method for RNA extraction from different tissues of grapevine and other woody plants. Phytochem. Anal. 19 : Hansen A and Lane W (1985) Elimination of apple chlorotic leaf spot virus from apple shoot cultures by ribavirin. Plant Dis. 69 : Hollings M (1965) Disease control through virus-free stock. Annu. Rev. Phytopathol. 3 : Ito T, Suzaki K, Nakano M (2013) Genetic characterization of novel putative rhabdovirus and dsrna virus from Japanese persimmon. J. Gene. Virol. 94 : Kim DH, Kim HR, Heo S, Kim SH, Kim MA, Shin IS, Kim JH, Cho KH, Hwang JH (2010) Occurrence of Apple scar skin viroid and relative quantity analysis using Real-time RT-PCR. Res. Plant Dis. 16 : Kim DH, Shim HK, Kwon HM, Hyun JW, Kim KS, Lee JK, Lee SC (2005) Production of virus-free stocks from citrus plant by the shoot-tip grafting and heat treatment. Korean J. Plant Biotech. 32 : Lee G, Kim JS, Kim HR, Shin IL, Cho KH, Kim SH, Shin J, Kim DH (2013) Production system of virus-free apple plants using heat treatment and shoot tip culture. Res. Plant Dis. 19 : Morton JF (1987) Fruit of warm climates. Julia Frances Nakaune R and Nakano M (2008) Identification of a new Apscaviroid from Japanese persimmon. Arch. Virol. 153 : Paduch-Cichal E and Kryczynski S (1987) A low temperature therapy and meristem-tip culture for eliminating four viroids from infected pplants. J. Phytopathol. 118 : Paprstein F, Sedlak J, Polak J, Svobodova L, Hassan M, Bryxiova M (2008) Results of in vitro thermotherapy of apple cultivars. Plant Cell. Tiss. Org. 94 : Savitri WD, Park KI, Jeon SM, Chung MY, Han JS, Kim CK (2013) Elimination of Chrysanthemum stunt viroid (CSVd) from meristem tip culture combined with prolonged cold treatment. Hortic. Environ. Biotechnol. 54 :

54 J Plant Biotechnol (2015) 42:49 54 DOI: ISSN Research Article 양앵두왜성대목 Gisela 5 의기내번식을위한정단배양조건의최적화 쉬쥔핑 강인규 김창길 한증술 최철 Optimization of apical tip culture condition for In Vitro propagation of Gisela 5 dwarf cherry rootstock Junping Xu In-Kyu Kang Chang Kil Kim Jeung-Sul Han Cheol Choi Received: 5 March 2015 / Revised: 14 March 2015 / Accepted: 14 March 2015 c Korean Society for Plant Biotechnology Abstract Based on the results in this study, here we propose a systematic micropropagation process for Gisela 5 that is one of the important dwarfing cherry rootstocks. When the apical tips detached from newly developed shoot in spring season were cultured on the half strength MS media with 0.5 mg/l IBA and 0.5 ~ 1.0 mg/l BA, the cultures scored the highest acquisition rate at 90% for normal shoot with vigorous growth and without hyperhydricity. As next step, the young shoots maintained in vitro well multiplied on the full strength MS medium supplemented with 0.5 mg/l IBA and 0.5 mg/l BA, in which multiplication rate was approximately nine-fold. Given the half strength MS medium containing 2.0 mg/l IBA, each transplanted shoot further developed robust roots. Finally, the plantlets were easily acclimatized in the compost consisted of vermiculite, perlite, and peatmoss in the proportion of 1:1:1. We expect that the results are useful for cherry cultivation and its rootstock production. Keywords Cherry, Rootstock, Dwarf, Gisela 5, Micropropagation J. Xu I.-K. Kang C. K. Kim J.-S. Han C. Choi ( ) 경북대학교농업생명과학대학원원예과학과 (Department of Horticultural Science, College of Agriculture & Life Sciences, Kyungpook National University, 80 Daehakro, Bukgu, Daegu , Republic of Korea) cc31@knu.ac.kr J.-S. Han 경북대학교생태환경대학생태환경전공 (Republic of Korea, Department of Ecological Environment, College of Ecology & Environmental Science, Kyungpook National University, 2559 Gyeongsangdaero, Sangju , Republic of Korea) 서론 양앵두의원산지는유럽중남부와소아시아로알려져있고현재상업적으로재배되는양앵두는맛에따라주로생과용으로소비되는단양앵두 (sweet cherry) 와가공용으로소비되는신양앵두 (sour cherry) 로구분할수있다. 터키, 미국, 이란및러시아를비롯한양앵두생산주요 20 개국의연간생산량은약 317 만 ton 에달하는데그중단양앵두가 64.2% 를차지한다 (FAO 2012). 지난세기단양앵두가전세계적으로고급생과의하나로각인되고재배면적이확대되는것에발맞추어풍산성, 내열과성등의육종목표를달성하기위한다양한육종프로그램이진행되어온반면, 양앵두대목의개량은비교적최근에서야이루어지고있다고할수있다 (Long and Kaiser 2010). 지금까지개발된상업적단양앵두대목중가장왜화성이높은품종은 Gisela 5 이다. 이대목품종은독일 Giessen 대학교에서 Prunus cerasus Schattenmorelle 와 P. canescens 간교잡을통해개발된 3 배체잡종인데, 잘알려진준왜성단양앵두품종 Mazzard 실생에비해 50% 이상의왜화도를나타낸다 (Exadaktylou et al. 2009; Šiško 2011). 또한접수의개화및숙기를 2 ~4 일단축시키고다양한양앵두유전자형과접목친화성을가지고있으며 ilarvirus 에내성도가지고있다. 이러한 Gisela 5 의특성은저수고, 초고밀식양앵두재배를가능하게함으로써노동력절감과단위면적당수확량증대를가져올수있다. 실제로유럽과미국등에서는최근 Gisela 5 의인기가상당히높은것으로알려져있다 (Bassi 2005; Liu et al. 2005; Lugli et al. 2005; Sitarek et al. 2005; Walter and Franken 1998; Whiting and Ophardt 2005; Yang et al. 2005; Zimmermann 1994). 우수한특성을보유하여인기가높은 Gisela 5 대목의공급은수요를충족하지못하고있는것으로판단되는데, 공

55 50 J Plant Biotechnol (2015) 42:49 54 급부족의가장큰원인으로기외에서삽수의발근이쉽지않다는점을들수있다 (Exadaktylou et al. 2009; Stefancic et al. 2006; Trobec et al. 2004). 포장에서 Gisela 5 번식의어려움을해결하기위한대안으로최근에는기내미세번식이시도되어각종배지첨가물등이배양물에미치는영향이보고되고있다 (Buyukdemirci 2008; Clapa et al. 2013; Fidanci et al. 2008; Ruzic and Cerovic 1998; Ružic et al. 2000; Šiško 2011). 그러나 Gisela 5 기내번식을위한배양절편의준비로부터기외순화된유묘의생산에이르는일련의조건을체계적으로보고한문헌은찾아보기어렵다. 따라서본연구에서는무병주생산의가능성이높은것으로알려진정단조직을배양재료로시작하여유식물체순화에이르기까지의각단계별최적기본배지와식물생장조절제조성등의배양환경을구명하고자하였다. 본연구의결과는양앵두왜성대목 Gisela 5 의상업적기내대량생산체계의뼈대가될것으로사료된다. 재료및방법 식물재료의채취와표면살균 2013 년 4 월 4 일경북대학교부속실험실습장에서재배중인 Gisela 5 성목으로부터약 1.5 ~ 2 cm 에달한신초를채취하여흐르는수돗물을이용하여신초표면의이물질을가볍게제거한다음 70% (v/v) 에탄올에수초간침지후멸균수로 3 회세척하였다. 계면활성제 Tween 20 (Sigma- Aldrich, USA) 이첨가된 1% NaOCl (Sigma-Aldrich) 용액에 30 분간처리한후멸균수로 3 회세척하였다. 해부현미경하에서표면살균된신초로부터엽원기가 1 ~2 매부착된 0.5 ~ 1.0 mm 크기의정단부를절취하여배양재료로이용하였다. 정단배양 정단배양성공의관건인배양초기정단의생존율을높이고식물체재생에적합한배양조건을구명하기위하여 MS 배지와 1/2MS 배지를기본배지로이용하고각각에 BA (0.5, 1.0, 2.0 mg/l) (Sigma-Aldrich) 와 IBA (0.5, 1.0, 2.0 mg/l) (Sigma-Aldrich) 를혼용첨가하였다. 또한 sucrose (Duchefa Biochemie, The Netherlands) 30 g/l 와 Plant agar (Duchefa Biochemie) 7 g/l 를첨가하였으며 ph 는 5.8 로조정하였다. 조제된배지는 121 C 에서 20 분간고압멸균한후 8 2 cm 멸균시험관에 10 ml 씩분주하였다. 채취한정단을처리당 10 반복으로치상하고밀폐하였으며배양물은 25±2 C, 20 μmol m -2 s -1, 16h 명 /8 h 암일장에서 2 주간배 양후 50 μmol m -2 s -1 에서 6 주간배양하며생육상태를관찰하였다. 신초의증식 정단배양에서유래한유식물체의마디배양 ( 배지 ; MS, IBA 0.1 mg/l, BA 1.0 mg/l, GA mg/l, sucrose 30 g/l, Plantagar 7 g/l, ph5.8) 을통해유지하고있던 Gisela 5 모식물체의신초상부약 1 cm 를절취하여신초증식에적합한배양조건을탐색하였다. 기본배지로 MS, 1/2MS 및 1/4MS 배지를이용하였으며각각의기본배지에 BA 0.5, 1.0 mg/l 와 IBA 0.05, 0.1, 0.5, 1.0 mg/l 를단용또는혼용첨가하였다 ( 총 45 처리 ). Sucrose 와 Plant agar 의농도및 ph 는이전실험에서와동일하였다. 100 ml 삼각플라스크에배지를 25 ml 씩분주하였으며각플라스크에 5 개신초를치상한후밀폐하였고처리당 4 반복으로실험을수행하였다. 배양물은 25±2 C, 50 μmol m -2 s -1 및 16 h 명 /8 h 암상태에서배양하였으며 6 주후생육상태를조사하였다. 신초로부터발근유도 BA 0.5 mg/l 와 IBA 0.5 mg/l 가혼용첨가된 MS ( 1) 배지에서증식된신초를기부에서절취하여 ( 약 1 cm) 발근유도실험에이용하였다. 기본배지는 MS, 1/2MS, 1/4MS 및 1/8MS 배지를사용하였으며식물생장조절제는예비실험을통해선발된 IBA 2.0 mg/l 를단용첨가하였다. 기타첨가물, 배지의 ph 및배양환경은신초의증식실험에서와동일하였다. 25 ml 의배지가분주된삼각플라스크에신초를 4 개씩치상한후밀폐하였고, 처리당 5 개의삼각플라스크를활용하였다. 신초이식후 5 주차에지상부생장과지하부생장양상을구분하여조사하였다. 유식물체의기외순화 IBA 2.0 mg/l 가첨가된 1/2MS 배지에서발근한유식물체를배양용기로부터꺼내어흐르는수돗물에서뿌리가상하지않도록주의하며배지를완전히제거하였다. 세척한유식물체는살균제다이센엠 -45(1 g/l) (Dongbu Farm Hannong, Korea) 로포장용수량까지관주한혼합상토 ( 버미큘라이트 : 펄라이트 : 피트모스 = 1:1:1, 2:1:1, 1:2:1, 1:1:2) 에이식하였다. 유식물체는혼합상토종류별로 10 개체씩 2 회이식하였으며이식후투명플라스틱봉지로포트를씌워습도를유지하면서배양실 (25±2 C, 50 μmol m -2 s -1, 16 h 명 /8 h 암 ) 에서생육시켰다. 생육중외기적응을위하여봉지에구멍을점차뚫어주었다. 이식 6 주후에생존율, 엽수, 초장, 근장및근수를조사하였다.

56 J Plant Biotechnol (2015) 42: 결과및고찰 Gisela 5 의정단으로부터신초생장에미치는기본배지와식물생장조절제의영향 MS 배지의농도또는식물생장조절제의조성을달리한총 20 종의배지에정단부를배양하였을때배지조성에따라생존율이 10 ~ 80% 로다르게나타났으며생존한정단의경우는 1 ~2 개의신초로생장하였다 (Table 1). 한편, 일부배지에서유의미한수준 (10 ~ 30%) 에달하는 hyperhydricity 된신초가관찰되었다 (Table 1). 기내배양에서나타나는 hyperhydricity 는지나친염류, 높은상대습도, 약광, 유해가스의량축적및호르몬불균형등다양한원인에의해나타나는것으로알려져있는데 (Cassells and Curry 2001; Franck et al. 2004), 본연구에서초기 2 주간은약광하에서배양하였고전 MS 배지에고농도의식물생장조절제를첨가한경우 hyperhydricity 빈도가높은경향을나타내었다는점은기알려진보고와무관하지않은것으로사료된다. 전체적으로식물생장조절제무첨가전 MS 배지를제외하고전 MS 배지에비하여 1/2MS 배지에서정상신초획 득율이높은경향을나타내었다 (Table 1). 식물생장조절제무첨가전 MS 배지, BA 와 IBA 각각이 0.5 mg/l 첨가된 1/2MS 배지및 BA 1.0 mg/l 와 IBA 0.5 mg/l 가첨가된 1/2MS 배지에서 90% 의높은빈도로정상신초가생장하였지만식물생장조절제무첨가전 MS 배지의경우각신초의생장량이상대적으로빈약하여다음단계신초증식을위한재료로사용하기에는부적합한것으로판단하였다 (Fig. 1A). MS 배지의농도와배지내식물생장조절제구성이 Gisela 5 의신초증식에미치는영향 MS 배지, BA 및 IBA 농도를달리하여조제한총 45 종의배지 ( 재료및방법참조 ) 에기내유식물체로부터절취한 1 cm 크기의신초상부를치상하였을때 1/4MS 를기본배지로하는일부배지를제외하고대부분의배지에서신초가생존하였으며생존한각신초는배지구성에따라적게는신초당 1.2 개많게는 9.7 개까지증식하였다 ( 자료미제시 ). 전체적으로동일한식물생장조절제조성하에서전 MS 배지가 1/2MS 배지와 1/4MS 배지에비하여신초의증식율과신초의생장측면에서양호한결과를나타 Table 1 Effect of MS medium strength and plant growth regulators on survival and growth of apical tip in Gisela 5 cherry rootstock. The data represent the mean values of ten replicates. Values in a column followed by a common letter are not significantly different at the 5% level (Duncan s multiple range test) Basal medium MS 1/2 MS Plant growth regulator (mg/l) Survival rate of explant and shoot (%) Acquisition rate BA IBA Normal Hyperhydricity for normal shoot (%) a abc abc bc abc abc c abc c c abc a abc c a abc abc ab abc ab

57 52 J Plant Biotechnol (2015) 42:49 54 Fig. 1 A process of micropropagation from shoot tips to acclimatized plants ex vitro for production of rootstock Gisela 5. (A) Growth and development of shoot tips on media containing different strength of MS elements and plant growth regulators. (B) Aspect of shoot multiplication depending on plant growth regulators BA and IBA under full strength MS medium. (C) Appearance of aerial and rhizospheric parts in plantlets grown on media with different strength of MS elements with 2.0 mg/l IBA. Arrows indicate physiological necrotic symptoms at mainly leaf blades. (D) Ex vitro acclimatization of rooted plantlets in growth room (left) and greenhouse (right) 내었다(자료 미제시). BA 단용 첨가 시 1.0 mg/l가 0.5 mg/l보다 증식 신초의 수가 많았지만 신초의 길이는 0.5 mg/l가 1.0 mg/l보다 양호하였다(Fig. 1B). 이와 같은 결 과는 사과 대목 M.9 계통의 증식 시 BA를 농도별로 처리 한 결과, 고농도 처리에서 신초가 더 많이 증식하는 경향 이 있다는 보고와 일치한다(Jun et al. 2001). 한편, IBA 단 용처리는 신초의 증식에 영향을 미치지 않았다(Fig. 1B). 또한 BA 단용 첨가보다 IBA를 혼용 첨가한 배지에서 신 초의 증식과 증식된 신초의 생장이 우수하였는데, BA에 IBA 혼용 농도를 0.05 mg/l, 0.1 mg/l, 0.5 mg/l로 높임에 따라 따라 신초의 수와 생장이 증가하였지만 IBA를 1 mg/l 혼용한 경우는 신초수와 신초의 길이가 줄어드는 결과를 나타내었다(Fig. 1B, Fig. 2). 따라서 우량한 신초 를 다수 증식시키기 위해서는 IBA를 0.5 mg/l 이하의 저 농도로 혼용하는 것이 필요한 것으로 판단하였다. MS기 본배지의 농도별로 신초 증식율과 생장이 가장 우수하였 던 식물생장조절제 조성은 전MS배지에서 BA 0.5 mg/l와 IBA 0.5 mg/l 혼용, 1/2MS배지에서 BA 0.5 mg/l와 IBA 0.1 mg/l 혼용 및 1/4MS배지에서 BA 1.0 mg/l와 IBA 1.0 mg/l 혼용으로 조사되었다(Fig. 2). 이들 배지 중 전MS배 지와 1/2MS배지 간에는 신초의 증식 효율에는 차이가 없 었지만 기본배지의 농도가 낮아질수록 신초의 생장은 뚜 렷이 둔화되었는데, 1/4MS배지에서는 신초의 생장 뿐 아 니라 신초의 증식도 극히 부진하였다(Fig. 2). 이러한 결 과를 토대로 정단배양 유래 신초의 증식 시 전MS배지에 BA 0.5 mg/l와 IBA 0.5 mg/l를 혼용 첨가하는 것이 좋은 것으로 판단하였다. Fig. 2 Multiplication and growth of Gisela 5 shoots on selected media within each strength of MS medium. Bars indicate standard errors

58 J Plant Biotechnol (2015) 42: 신초의정상생장과발근에적합한배지조성 신초증식율과신초의생장이가장우수하였던 BA 0.5 mg/l 와 IBA 0.5 mg/l 가첨가된전 MS 배지에서획득한신초를다양한조성의식물생장조절제를첨가한배지에치상한후발근양상을관찰한예비실험을통해발근유도에적합한식물생장조절제로 IBA 2.0 mg/l 를선택하였다 ( 자료미제시 ). IBA 2.0 mg/l 를동일하게첨가하고 MS 배지의농도를달리한 4 종의배지에신초를이식하여지상부와지하부의생육을관찰한결과, MS 배지의농도에따라양쪽부분의생육은차이를나타내었다 (Table 2). MS 배지의농도가낮아질수록신초의길이생장이저해되었고, 발근율은 1/2MS 와 1/4MS 배지가각각 82.5% 와 87.5% 로가장높았으며재생된뿌리의수와길이도 1/2MS 와 1/4MS 배지가다른처리에비해우수한것으로판단되었다 (Table 2, Fig. 1C). 한편, 1/8MS 배지에서는유식물체의엽연부가심하게갈변하는현상이관찰되었다 (Fig. 1C). 이러한현상은 1/4MS 배지에서도일부관찰되었는데, 발근유도초기에는모든배지에서증상이없었다는점과발근유도후기에 1/8MS 배지와 1/4MS 배지에만집중적으로나타났다는점을감안하면엽연부갈변현상은배지의양분고갈에원인이있는것으로판단된다. Jun 등 (2001) 은사과 M.9 계통대목의기내발근을위한 MS 배지의무기염농도별실험에서낮은농도처리에서양분결핍증상이나타난다고보고한바있다. 따라서신초의발근뿐아니라지상부생장을함께고려하여 IBA 2.0 mg/l 가첨가된 1/2MS 배지가증식된신초의발근에가장적합한것으로사료된다. 기외순화를위한최적용토혼합비율 IBA 2.0 mg/l 가첨가된 1/2MS 배지에서정상적으로지상부와지하부가발달하여유사한생육상을보이는유식물체를 vermiculite, perlite 및 peatmoss 의혼합비율을달리한용토를채운포트에이식하였다. 상대습도유지를위한봉지씌우기, 점진적외기적응을위한봉지구멍뚫기, 강광적응을위해포트를배양실에서온실로이동및봉지완전제거등의과정을 6 주에걸쳐실시한후용토의혼합비율에따른식물체의지상부와지하부생육상을조사하였다. 용토혼합비율에무관하게대부분의식물체는활착하였지만지상부와지하부의생육정도는다르게나타났다 (Fig. 1D, Table 3). 엽수, 신초장, 뿌리수및뿌리의길이등을기준으로 vermiculite : perlite : peatmoss 의혼합비율을 1:1:1 로구성하는것이식물체의기외순화에가장적합한것으로판단되었다 (Table 3). 적요 본연구의결과를바탕으로중요한양앵두왜성대목의하나인 Gisela 5 의미세번식을위한일련의체계적과정을제안한다. 봄철새롭게생장한신초로부터절취한정단조직을 IBA 0.5 mg/l 와 BA 0.5 또는 1.0 mg/l 가첨가된 1/2MS 배지에치상하였을때 hyperhydricity 가없고왕성한생장을하는정상신초의획득율이 90% 에달하였다. 다음단계로, 기내에서유지된모식물체로부터채취한신초 Table 2 Aerial and rhizospheric growth and development of plantlets depending on MS medium strength. The data represent the mean values of five replicates (4 plantlets per replicate). Values in a column followed by the same common letter are not significantly different at the 5% level (Duncan s multiple range test) Basal medium Shoot length (mm) Rooting rate (%) No. of roots /rooted shoot Root length of rooted shoots (mm) MS 11.2 a 77.5 b 3.3 b 13.2 b 1/2 MS 11.4 a 82.5 a 5.5 a 20.3 a 1/4 MS 10.3 a 87.5 a 5.8 a 23.0 a 1/8 MS 8.4 b 77.5 b 3.6 b 20.6 a Table 3 Effect of compost composition on aerial and rhizospheric growth and development of plants in ex vitro acclimatization. The data represent the mean values of two replicates (10 plantlets per replicate). Values in a column followed by the same common letter are not significantly different at the 5% level (Duncan s multiple range test) Compost proportion Shoot length Maximum root length No. of leaf No. of root Vermiculite : Perlite : Peatmoss (mm) (cm) 1 : 1 : a 14.3 a 4.4 a 2.6 a 2 : 1 : b 8.7 b 2.2 c 1.6 b 1 : 1 : b 12.8 a 3.5 b 2.1 a 1 : 2 : c 8.8 b 3.1 b 1.3 b

59 54 J Plant Biotechnol (2015) 42:49 54 를 IBA 0.5 mg/l 와 BA 0.5 mg/l 가첨가된전 MS 배지에이식하면약 9 배에이르는수준으로신초가증식되었다. 증식된신초는 IBA 2.0 mg/l 가첨가된 1/2MS 배지로이식하면지상부의정상생장과함께왕성하게발근하였다. 발근한유식물체는비교적손쉽게최종적으로기외순화시킬수있었는데, 기외이식상토로는버미큘라이트, 펄라이트및피트모스의혼합비율을 1:1:1 로하는것이가장적합하였다. 본연구의결과가양앵두재배와양앵두대목의생산에유용하게활용되기를기대한다. References Bassi G (2005) Influence of rootstocks on cherry production. Informatore Agrario 61:55-59 Buyukdemirci H (2008) The effects of medium ingredients on shoot propagation and rooting of cherry rootstocks in vitro. Proc 5 th I Son Cherry. Eds.: A. Erisetal. Acta Hort ISHS Cassells A, Curry R (2001) Oxidative stress and physiological, epigenetic and genetic variability in plant tissue culture: implications for micropropagators and genetic engineers. Plant Cell Tiss Org Cult 64: Clapa D, Fira A, Simu M, Horga VC (2013) In vitro propagation of Gisela 5 cherry rootstock. Fruit Grow Res XXIX: Exadaktylou E, Thomidis T, Grout B, Zakynthinos G, Tsipouridis C (2009) Methods to improve the rooting of hardwood cuttings of the Gisela 5 cherry rootstock. HortTechnol 19: FAO (2012) Production of cherry by countries Fidanci A, Burak M, Erenoglu B, Akçay E (2008) Determination of in vitro propagation techniques for some clonal cherry rootstocks. Proc. 5 th I Son Cherry. Eds.: A. Erisetal. Acta Hort ISHS Franck T, Kevers C, Gaspar T, Dommes J, Deby C, Greimers R, Serteyn D, Deby-Dupont G (2004) Hyperhydricity of Prunus avium shoots cultured on gelrite: a controlled stress response. Plant Physiol Biochem 42: Jun JH, Chung KH, Jeong SB, Hong KH, Kang SJ (2001) Rapid multiplication of M.9 rootstocks in vitro. Kor J Hort Sci & Technol 19:34-38 Liu Q, Zhang L, Li B, Zhao H (2005) A new cherry dwarf rootstock variety Gisela 5. Acta Hort Sinica 32:760 Long LE, Kaiser C (2010) Sweet cherry rootstocks for the Pacific Northwest. A Pacific Northwest Extension Publication 619, September Lugli S, Correale R, Gaiani A, Grandi M, Muzzi E, Quartieri M, Sansavini S (2005) New cherry rootstocks for intensive plantations. Rivista di Frutticoltura e di Ortofloricoltura 67:41-47 Ružic D, Cerovic R (1998) Influence of agar brands and concentration on in vitro propagation techniques for some clonal cherry rootstocks. Proc 5 th I Son Cherry. Eds.: A. Erisetal. Acta Hort 795. ISHS Sitarek M, Grzyb ZS, Omiecinaska B (2005) Performance of sweet cherry trees on Gisela 5 rootstock. Acta Hort 667: Šiško M (2011) In vitro propagation of Gisela 5 (Prunus cerasus P. canescens). Agricultura 8:31-34 Stefancic M, Stampar F, Osterc G (2006) Influence of IAA and IBA on root development and quality of Prunus Gisela 5 leafy cuttings. HortScience 40: Trobec M, Osterc G, Stefancic F (2004) Propagation of rootstocks M9 and Gisela 5 using a fog system method for greenwood cuttings. Zbornik referatov 1. Slovenskega sadjarskega kongresa zmednarodno udelezbo. Krško, Slovenia 2: Walter E, Franken BS (1998) Evaluation of new German rootstocks for sweet cherry. Gisela 5 and other hybrids of P. cerasus P. canescens [Prunus avium L.]. Rivista di Frutticoltura e di Ortofloricoltura 60:24-28 Whiting MD, Ophardt D (2005) Comparing novel sweet cherry crop load management strategies. HortScience 40: Yang X, Zhang L, Li B, Liu Q (2005) Brief report on the sweet cherry cultivars and rootstocks grown in Germany. China Fruits 4:61-62 Zimmermann A (1994) Gisela 5, a dwarfing rootstock for sweet cherries from Giessen in a trial. Obstbau (Germany) 19:62-63

60 J Plant Biotechnol (2015) 42:55 59 DOI: ISSN Research Article 울릉도자생식물삼나물 (Aruncusdioicus) 의항산화활성검증 김동희 문용선 손준호 Verification of anti-oxidative activity of Aruncus dioicus, a native plant of Ulleungdo Dong-Hee Kim Yong-Sun Moon Jun-Ho Son Received: 9 March 2015 / Revised: 18 March 2015 / Accepted: 18 March 2015 c Korean Society for Plant Biotechnology Abstract The extracts of Aruncus dioicus were investigated for anti-oxidant and biological activities in order to verify its potential as functional ingredients of cosmetic products. The ethyl acetate (EtOAc) extract of A. dioicus showed excellent scavenging activity using DPPH and ABTS anti-oxidant analysis at the 1,000 μg/ml concentration. While tyrosinase inhibitory effect was measure for whitening assay and showed 59.2%, the suppression levels of elastase and collagenase were 56% and 90% respectively for anti-wrinkle activity. Therefore, it is plausible to conclude that A. dioicus extract, especially EtOAc fraction which has outstanding whitening, anti-oxidant, and anti-wrinkle activities, could be used as a new functional materials for cosmetics. Keywords Whitening 서론 Anti-oxidant, Anti-wrinkle, Aruncus dioicus, 인체의피부는산소와접촉하고자외선에노출되어활성산소종 (reactive oxygen species, ROS) 이유도되며산화적 Two authors equally contributed in this research. D.-H. Kim Jun-Ho Son ( ) 한국한방산업진흥원 (Team of Herbal Product Development, Korea Promotion Institute for Traditional Medicine Industry, Gyeongbuk, , South Korea) bio115@dgom.re.kr Y.-S. Moon 영남대학교원예생명과학과 (Department of Horticulture & Life Science, Yeungnam University, Daedong, Gyeongsan-si, Gyeongbuk , South Korea) 스트레스를받게된다. 일부활성산소에의한자유라디칼반응으로단백질변성과유전자손상으로종양및노화등이발생한다 (Park et al. 2008). 특히자외선과같은외적스트레스는피부의탄력과윤택을감소시키고 (Voegeli 1996), 세포내의 tyrosinase 라는효소에의해만들어지는멜라닌은자외선 건조 극한온도등에대한피부저항력을높여주지만, 과도한멜라닌생성은인체에기미, 주근깨, 검버섯등과같은색소침착을일으키고, 피부의노화를유발한다 (Invengar and Mcevily 1992). 또한피부의진피조직속에는피부의탄력성과관련된 collagen 과 elastin 이그물망구조를형성하고있는데, collagenase 와 elastase 에의해이들이분해되어피부가처지고주름이생겨피부노화가발생한다 (Lee et al. 2003). 활성산소종과자외선에의한피부노화감소를위해피부에적용가능한항산화제연구개발이활발하게이루어지고있지만, 기존의합성물질들은만성독성, 발암, 돌연변이유발등의이유로사용이제한적이기때문에안전하면서효과가뛰어난천연물질개발이필요하게되었다. 삼나물 (Aruncus dioicus) 은울릉도에서자생하는장미과에속하는다년생식물이다. 삼나물의주성분은사포닌, 살리실알데히드, 칼슘, 인, 지질, 비타민 A 등이다량함유되어있다. 기능성물질인 flavonoids 및 polyphenol 등이유해산소를막아항암, 면역증진과간기능강화등에효과가있다는연구결과가보고되었다 (Lee 2003). 삼나물에관한연구는삼나물 ethanol 추출물이당뇨에미치는영향에관한연구 (Shin et al. 2008) 와삼나물미백및주름효과에대한세포실험은보고되었으나 (Kim et al. 2012; Kim et al. 2013), 항산화에관한내용은전무한상태이다. 이에본연구에서 DPPH 와 ABTS 실험을통하여삼나물추출물의항산화효과를확인하고 tyrosinase 및 collagenase 와 elastase 의활성억제실험을통해미백및항주름효과를

61 56 J Plant Biotechnol (2015) 42:55 59 검증하여새로운화장품의기능성소재로써의가능성을확인코자수행하였다. 재료및방법 식물재료및추출물 본실험에사용한삼나물 (A. dioicus) 은경북울릉군울릉웰빙식품에서식물분류가검증된재료를구입하여사용하였다. 실험재료인건조삼나물은울릉도서면에서 cm 간격으로가을에노지에직파하여차광재배하고, 2009 년 4~5 월경수확후건조하였다. 삼나물 5 kg 을 70% acetone 을가하여상온에서 1 주일간 3 회추출한다음거름종이 (Whatman No. 2) 로여과하였고, 얻어진여액은감압농축하여 acetone 추출물 (1,174 g) 을얻었다. 이 acetone 추출물을증류수에현탁시킨후용매극성차를이용해서로다른용매 (hexane, ethyl acetate; EtOAc, butanol) 를첨가하여단계적으로각각 hexane (15.8 g), EtOAc (129.7 g), butanol (182.9 g), 및추출후수용액에서 g 의잔여물을얻었다. DPPH 전자공여능측정 전자공여능 (electron donating ability) 은 Blois (1958) 의방법을변형하여측정하였다. 각시료 50 µl 에 0.2 mm 의 1,1- diphenyl-2-picryl hydrazyl(dpph) 100 µl 넣고교반한후 30 분간방치한다음 517 nm 에서흡광도를측정하였다. 전자공여능은시료용액의첨가군과무첨가군, 및비타민 C 를대조구로사용하여흡광도감소율을나타내었다. ABTS+ cation radical scavenging activity 측정 2,2-azino-bis (3-ethyl-benthiazoline-6-sulfonic acid) (ABTS) 를이용한항산화력측정은 ABTS+ 양이온탈색법을변형하여측정하였다 (Roberta et al., 1999). 7 mm ABTS 와 2.4 mm potassium persulfate 를혼합하여실온에서 24 시간동안방치하여 ABTS+ 를형성시킨후 ethanol 로희석하여 100 μl 의 ABTS+ 에시료 50 μl 를가하여 1 분동안반응한후 732 nm 에서흡광도를측정하였다. Tyrosianse 활성저해측정 Tyrosinase 활성저해를측정하기위해 Yagi 등 (1986) 의방법을변형하여이용하였다. 반응구는 100 µl 의 M sodium phosphate buffer (ph 6.8) 에 10 mm L-DOPA 40 µl 와시료 20 µl 의혼합액에버섯유래 tyrosinase (110 U/mL) 40 µl 를첨가하여 37 C 에서 2 분간반응시켜반응액중에생성된 DOPA chrome 을 475 nm 에서측정하였다. Tyrosinase 활성저해는시료의첨가구와무첨가구의흡광도감소율로나타내었다. Elastase 활성저해측정 Elastase 활성저해는변형된 Cannell 등 (1988) 의방법을활용하였다. 기질로서 n-succinyl-(l-ala) 3 -p-nitroanilide 를사용하여 37 C 에서 20 분간반응후기질로부터생성되는 p-nitroanilide 의생성량을 405 nm 에서측정하였다. 즉, 각시료를일정농도가되도록조제하여 40 µl 씩시험관에취하고, 50 mm Tris-HCl buffer (ph 8.6) 에녹인 porcine pancreas elastase (0.5 U/mL) 40 µl 를가한후 80 µl 의기질 n-succinyl- (L-Ala) 3 -p-nitroanilide(mg/ml) 을첨가하여 20 분간반응시켜측정하였다. 시료의첨가구와무첨가구의흡광도감소율로 elastase 활성저해정도를나타내었다. Collagenase 활성저해측정 Collagenase 활성저해정도는 Lee 와 An (2012) 의방법을변형하여측정하였다. 즉반응구는 4-phenylazobenzyl-oxycarbonyl-Pro-Leu-Gly-Pro-D-Arg (0.5 mg/ml) 를 4 mm CaCl 2 를포함한 0.1 M Tris-HCl buffer (ph 7.5) 에녹이고, 이기질 125 µl 와시료 50 µl 의혼합액에 75 µl collagenase (0.2 mg/ml) 를첨가하여실온에서 20 분간방치한후 6% citric acid 0.5 ml 을넣어반응을정지시킨후, EtOAc 1,500 µl 을첨가하여 320 nm 에서흡광도를측정하였다. Collagenase 활성저해는시료용액의첨가구와무첨가구의흡광도감소율로나타내었다. 결과및고찰 삼나물 EtOAc 분획물의우수한 DPPH 전자공여능 Free radical 은인체내에서지질또는단백질등과결합하여노화를일으키기쉬운데, 페놀성화합물의경우 free radical 을환원시키거나상쇄시키는능력이강해인체내에서 free radical 에의한노화를억제하는척도로이용할수있다 (Kim et al. 1995). DPPH 는짙은자색을띄는비교적안정한 free radical 로서 cysteine glutathion 과같은함황아미노산과 l-ascorbic acid BHA 등에의해환원되어탈색되므로다양한천연소재로부터항산화물질을검색하는데많이이용되고있다. 삼나물추출물의전자공여능은 1,000 μg/ml 에서 acetone 추출물 (88.5%), hexane 분획물 (63.43%), EtOAc 분획물 (99.3%), butanol 분획물 (87.8%) 과 59.9% 의수

62 J Plant Biotechnol (2015) 42: 용액잔여물을획득하였으며, 대조군인 vitamin C (Vit. C) 에서는 96.9% 의전자공여능을나타내었다 (Fig. 1). 삼나물분획물중 EtOAc 분획물이가장강한전자공여능을나타내었으며, 이는 Lee 와 Park (2008) 의제비꽃추출물의항산화효과실험에서같은농도 1 mg/ml 에서 methanol 추출물 (10.4%), ethanol 추출물 (12.7%), acetone 추출물 (21.1%) 보다현저히높은전자공여능을확인하였다. 또한 Kwon 등 (2008) 의연구결과에서같은농도의산겨릅나무 ethanol 추출물과열수추출물, 수용액분획물이보여준각각 85.3%, 77.7% 와 79.8% 의높은항산화효과보다삼나물 EtOAc 분획물의더욱우수한항산화효과를확인할수있었다. 삼나물농도에따른 ABTS+ 양이온 radical 소거능증가 와의반응으로 ABTS+ radical 이생성되면특유의색인청록색을띄게되는데, 시료를첨가함에따라연한녹색으로탈색되는것을측정하는방법으로 hydrogen-donating anti-oxidant 와 chain breaking anti-oxidant 모두를측정할수있다. 각시료용액 1,000 μg/ml 농도에서 ABTS radical 소거능은 acetone 추출물은 90.9%, hexane 분획물 41.4%, EtOAc 분획물 94.0%, butanol 분획물 89.8% 과마지막수용액에서 81.9% 각각나타내었으며, 대조군에서는 99.1% 의 radical 소거능을나타내었다. 이와같은 DPPH 와 ABTS 항산화실험결과는삼나물의항산화물질들은대부분 ethyl acetate 층에함유되어있으며, Oh 등 (2010) 의울금과강황추출물 (1,000 μg/ml) 의 75% 이상의효능보다훨씬우수하다는것을나타냈다 (Fig. 2). ABTS 양이온 radical 소거능은 2,2-azino-bis (3-ethyl-benthiazoline-6- sulfonic acid) diammonium salt (ABTS) 와 potassium persulfate ADA : 70% Acetone Extract ADH : n-hexane Extract ADE : Ethyl Acetate Extract ADB : Butyl Alcohol Extract ADW : Water soluble residue Vit. C : L-ascorbic acid Results are mean ± SD of triple replicated Tyrosinase 활성저해로인한미백효과 Tyrosinase 는 melanosome 내에서 tyrosine 을산화시켜 DOPA 를만드는 tyrosine hydroxylase 로작용하여 melanin 을합성하는데중요한효소로작용한다 (Lee et al. 2001). 이렇게피부내에서 melanin 중합체생합성억제효과를측정하기위하여버섯유래의 tyrosinase 활성억제정도를관찰하였다. 삼나물 EtOAc 분획물 1,000 μg/ml 농도에서 59.2% tyrosinase 활성억제효능을나타냈으나이외의분획물에서는미백효과가거의나타나지않음을확인할수있었다 (Fig. 3). An 등 (2005) 은진달래꽃의열수및 EtOH 추출물의 tyrosinase 활성저해를측정한결과삼나물과같은농도 1,000 μg/ml 에서각각 24.0% 와 48.0% 의저해를나타낸결과를보고하였으며, 삼나물의 EtOAc 분획물의미백효능이더욱우수함을기대할수있었다. Fig. 1 DPPH electron donating ability of solvent fractions from Aruncus dioicis extract ADA : 70% Acetone Extract ADH : n-hexane Extract ADE : Ethyl Acetate Extract ADB : Butyl Alcohol Extract ADW : Water soluble residue Vit. C : L-ascorbic acid Results are mean ± SD of triple replicated Fig. 2 ABTS + cation radical scavenging activity of solvent fractions from Aruncus dioicis extract ADA : 70% Acetone Extract ADH : n-hexane Extract ADE : Ethyl Acetate Extract ADB : Butyl Alcohol Extract ADW : Water soluble residue Vit. C : L-ascorbic acid Results are mean ± SD of triple replicated Fig. 3 Tyrosinase inhibition activity for whitening effect from Aruncus dioicis extracts

63 58 J Plant Biotechnol (2015) 42:55 59 Elastase 활성억제로인한항주름효과 Elastase 는단백질인 elastin 을분해하는효소이며, 다른중요한기질단백질인콜라겐을분해할수있는비특이적가수분해효소이다. 주름생성과관련한 elastase 활성저해를측정한결과 Fig. 4 와같이나타났다. Lee 등 (2010) 은백련꽃, 뿌리, 잎추출물의 1,000 μg/ml 농도에서 elastase 활성을 10-30% 저해를확인하였다. 대조군인 epigallocatechin-3-o-gallate (EGCG) 의경우 1,000 μg/ml 에서 56% 의 elastase 활성억제효과와비교해보면삼나물의여러분획물들은 10.1 ~ 23.5%, 특히 EtOAc 분획물에서 35.2% 의높은억제효과가나타났다. Collagenase 활성억제로인한항주름효과 Collagen 은많은섬유아세포 (fibroblast) 에의해생성되며 2 ~4% 의 elastin, glycosamino-glycans 와같은당단백질등과 함께세포외기질 (extracellular matrix) 의 70 ~ 80% 를구성한다. 이러한 collagen 은연령및자외선에의한광노화에의해감소하며피부주름형성과밀접한연관이있다고알려져있다 (Kwak et al. 2005; Kim et al. 2004; Jeroma et al. 1998). 또한 collagen 은 collagenase 에의해분해되어주름을형성함으로삼나물추출물의 collagenase 활성억제정도를 Fig. 5 과같이측정하였다. 삼나물 acetone 추출물의경우 1,000 μg/ml 의농도에서 87%, hexane 분획물 (41%) 을제외한대부분의용매분획물의경우 82% 이상의높은효소활성억제효과가나타났고, 특히 EtOAc 분획물은 90% 억제율로대조군인 EGCG 의 98% 와유사한저해능을나타내는것을확인할수있었다. 이는 Kang (2007) 의토사자, 음양곽, 건지황 250 μg/ml 에서각각 40%, 37.5%, 35% 의저해능과비교시삼나물 EtOAc 분획물은 100 μ g/ml 에서거의 80% 의높은 collagenase 활성억제효능을확인할수있었다. 적요 ADA : 70% Acetone Extract ADH : n-hexane Extract ADE : Ethyl Acetate Extract ADB : Butyl Alcohol Extract ADW : Water soluble residue EGCG : Epigallocatechin-3-o-gallate Results are mean ± SD of triple replicated Fig. 4 Elastase inhibition activity for anti-wrinkle effect from Aruncus dioicis extracts 삼나물추출물의항산화및생리활성효과를검증하여화장품의기능성소재로서의가능성을검증하였다. 항산화실험결과삼나물의 ethyl acetate (EtOAc) 분획물 1,000 μg/ml 농도에서 DPPH, ABTS 와같은전자공여능실험에서가장높은활성을나타났다. 미백효과측정을위한 tyrosinase 활성억제도삼나물 EtOAc 분획물에서 59.2% 의효과를나타내었고, elastase 활성은 56% 그리고 collagenase 활성은 90% 저해효과로항주름효과가검증되었다. 따라서삼나물추출물특히 EtOAc 분획물은우수한항산화, 항주름및미백생리활성으로화장품의새로운기능성소재로서응용이가능함을확인하였다. References ADA : 70% Acetone Extract ADH : n-hexane Extract ADE : Ethyl Acetate Extract ADB : Butyl Alcohol Extract ADW : Water soluble residue EGCG : Epigallocatechin-3-o-gallate Results are mean ± SD of triple replicated Fig. 5 Collagenase inhibition activity for anti-wrinkle effect from Aruncus dioicis extracts An BJ, Lee CE, Son JH, Lee JY, Choi CH, Park TS (2005) Antioxidant, anticancer and tyrosinase inhibition activities of extracts from Rhododendron mucronulatum T. J Kor Soc Appl Biol Chem 48: Blois MS (1958) Antioxidant determination by the use of a stable free radical. Nature 181: Cannell RJP, Kellan SJ, Owsianks AM, Walker JM (1988) Results of a large scale screen of microalgae for the production of protease inhibitors. Planta Media 54:10-14 Invengar R, Mcevily AJ (1992) Anti-browning agents: alternatives to the use of sulfites in foods. Trends Food Sic Technol 3:60-63 Jeroma SP, Gabrielle L, Raul F (1998) Identification of collagen fibrils in scleroderma skin. J Invest Dermatol 90:48-54