J Plant Biotechnol (2015) 42:43 48 DOI:http://dx.doi.org/10.5010/JPB.2015.42.1.43 ISSN 1598-6365 Research Article 전라남도지역감바이로이드의감염상황및무병화효율연구 김대현 김인수 이건섭 조인숙 조강희 신일섭 김세희 천재안 최인명 Current occurrence of persimmon viroid and citrus viroid in persimmon in JellaNam-do and testing for viroid inactivation methods Dae Hyun Kim In-Soo Kim Gunsup Lee In-Sook Cho Kang Hee Cho Il Sheob Shin Se Hee Kim Jae An Chun In-Myung Choi Received: 9 March 2015 / Revised: 20 March 2015 / Accepted: 20 March 2015 c Korean Society for Plant Biotechnology Abstract It is a serious situation that the farmers' income has gradually decreased due to the decline of productivity of fruit trees infected with viroids. It has been known that Persimmon viroid (PVd) and Citrus viroid (CVd) are economically important viroids that can infected persimmon. In this study, the incidence of CVd and PVd in Fuyu persimmon were identified as 41% and 34% in JeollaNam-do, respectively. The collected persimmon samples infected by both PVd and CVd were used for testing efficiency of the viroid inactivation methods. The samples were subjected to single treatment of the heat treatment (37 C), cold treatment (4 C), or antiviral agent treatment (Ribavirin), and double treatment of combinations of the three methods. Viroid inactivation efficiency was confirmed through RT-PCR. In the case of the samples subjected to cold treatment for 4 weeks, the viroid inactivation efficiency was most significantly high as 67% against the survival rate of 100%. In addition, in the case of the samples treated for 2 weeks with the antiviral agents and cold D. H. Kim I.-S. Kim G. S. Lee K. H. Cho ( ) S. H. Kim J. A. Chun I.-M. Choi 농촌진흥청국립원예특작과학원과수과 (Fruit Research Division, National Institute of Horticultural and Herbal Science, RDA, Wanju 565-852, Korea) e-mail: khc7027@korea.kr I.-S. Cho 농촌진흥청국립원예특작과학원원예특작환경과 (Horticultural and Herbal Crop Environment Division, National Institute of Horticultural and Herbal Science, RDA, Wanju 565-852, Korea) I. S. Shin 농촌진흥청국립원예특작과학원배연구소 (Pear Research Institute, National Institute of Horticultural and Herbal Science, RDA, Naju 520-821, Korea) treatment, the viroid inactivation rate was similar to that of the cold treatment. In conclusion, the cold treatment showed the highest viroid inactivation efficiency, and this result will provide valuable information for production of viroid-free persimmon. Keywords Antiviral agents, Citrus viroid, Cold treatment, Heat treatment, Persimmon viroid 서론 감은매우중요한과수작물중하나로농림축산식품부통계자료에따르면 2000 년대에들어전체감생산면적은약 3.1 만 ha, 생산량은 28 만톤으로전세계적으로중국에이어두번째로많이재배되고있다. 그러나감의병해충연구특히, 바이러스및바이로이드에관한연구는거의이루어지지않고있다. 감에감염되는대표적인바이로이드는 persimmon viroid(pvd) 와 citrus viroid(cvd) 등이존재하는것으로알려져있다 (Ito et al. 2013; Nakaune and Nakano 2008). 일반적으로알려진감바이로이드증상은잎에검은반점및얼룩이생성되거나과실의괴사반점, 줄기및가지의검은색얼룩등이있으나아직까지는이러한증상에의한피해가어느정도인지구체적인자료가없는실정이다 (Morton 1987). 사과에감염이가능한바이로이드인 ASSVd(Apple Scar Skin Viroid) 의경우과피얼룩반점및코르크화반점등의증상을유발하며, 수확기에과피전체의 50% 이상이노란색반점들로덮여착색이불균일하고정상과에비해크기가작아지는등상품성을잃는것으로보고되었다 (Kim et al. 2010). 감또한
44 J Plant Biotechnol (2015) 42:43 48 과실에바이로이드에의한증상이보고되고있는만큼근본적인감염률조사및바이로이드무병묘생산연구가반드시수행되어야할것으로판단된다. 과수에서바이러스및바이로이드를제거하고무병묘를생산하는연구는매우다양한방법으로수행되었다. 무병묘를생산하는방법은 38 C 로일정기간동안처리하는열처리요법 (Thermotherapy) 과 4 C 로일정기간처리하는한냉요법 (Coldtherapy), 그리고 ribavirin 과같은항바이러스제를처리하는화학적인요법 (Chemotherapy) 등으로나뉠수있다 (Feng et al. 2013; Hollings 1965; Paduch-Cichal and Kryczynski 1987; Savitri et al. 2013). Campbell(1962) 은 Virginia Crab, Spy 227, Malus platycarpa 등이열처리와경정배양에의해바이러스가제거됨을확인하였다. Paprstein 등 (2008) 은사과품종인 Idared 와 Sampion 을이용하여열처리를통해실험한결과 Idared 는바이러스가제거되었지만 Sampion 는제거되지않았다. 따라서품종에따라무병화함에있어서처리방법에차이가있음을보여주었다. Paduch-Cichal 과 Kryczynski(1987) 는한냉처리에의해 PSTVd(Potato Spindle tuber viroid) 의제거효과를보여주었으며, Hansen 과 Lane(1985) 은 Malus pumila Mill 사과에항바이러스제 (ribavirin) 를 10, 20, 40, 그리고 80 μm 농도로처리함으로써온실과과수원에식재되어있는사과신초에서 ACLSV(Apple Chlorotic Leaf Spot Virus) 제거효과를확인하였다. 또한국립원예특작과학원에서 Citrus tristeza virus, Satsuma dwarf virus, Citrus tatter leaf virus 에감염된감귤품종을이용하여열처리와경정접목 (shoot-tip grafting) 방법에의해서감귤무병화를수행한바있으며 (Kim et al. 2005), 사과에서도 Apple chlorotic leaf spot virus, Apple stem grooving virus, Apple mosaic virus 와 Apple scar skin viroid 에대해열처리및경정배양에의한무병화신품종을확보하였다 (Lee et al. 2013). 본연구에서는전라남도지역단감재배농가에서수집한부유품종을이용하여바이로이드감염현황을파악하였고, 확보된 CVd 와 PVd 가동시에감염된감식물체의무병화를수행하였다. 또한바이로이드감염이확인된감식물체를이용하여열처리, 한냉처리및항바이러스제처리를통하여무병화효율실험을수행하였다. 재료및방법 시험재료 감바이로이드감염률을조사하기위해전라남도 5 지역 ( 나주, 영암, 담양, 순천, 구례 ) 의 20 농가를선정하였다. 시료는바이로이드진단효율을높이기위하여 6 월에 198 개체의단감부유품종의신초부위에서잎을채취하여실험에이용하였다 (Fig. 1). Fig. 1 Sampling locations in Jeollanam-do and representative symptoms appeared in persimmon infected by citrus viroid and persimmon viroid. A. Locations 1: Naju, 2: Yeongam, 3: Damyang, 4: Suncheon, 5 Gurye B. Viroid symptom in fruit. C. Viroid symptom in leaf
J Plant Biotechnol (2015) 42:43 48 45 Table 1 Primer pairs used for detection of persimmon-infecting viroids a and expected sizes of RT-PCR products Target Primer Sequence (5' 3') PCR product (bp) Originated accession No. Upstream CGACAGGTGAGTCTCCTTGC CVd b Downstream TCGTCGACGAAGGCATGTGA 336 AB019508 Upstream CGGCAGGGAGCCTTGCGAAC PVd c Downstream AGCTCGGGGCTGGAGCTTGG 396 NC_010308 Upstream CGCATCATTCAAATTTCTGC 18S d Downstream TTCAGCCTTGCGACCATACT 843 DQ341382 a The primers for each viroid were designed as species-specific. b CVd: Citrus viroid. c PVd: Persimmon viroid. d 18S: 18s ribosomal RNA. RNA 분리및 RT-PCR 을통한바이로이드진단 채취한단감의신초를이용하여바이로이드진단을위해 CTAB 방법을통해 total RNA 를분리하였다 (Gambino et al. 2008). 확보된 total RNA 는 M-MLV reverse transcriptase (Invitrogen, Carlsbad, CA, USA) 를이용해 cdna 를합성하였으며, Table 1 에언급한프라이머를이용하여 PCR 을수행하였다. CVd 진단의경우 PCR 증폭은총 20 μl 의반응액에 cdna 50 ng, 1 PCR buffer, 250 μm dntps, 1.5 units Ex Taq DNA polymerase(takara, Tokyo, Japan) 를혼합하여수행하였고반응조건은 94 C 에서 40 초, 60 C 에서 40 초그리고 72 C 에서 40 초씩각각 35 회반복하였다. PVd 의경우는위의조건에 extension 시간을 20 초단축하여진단하였다. 또한 total RNA 및 cdna 가완전히합성이확인하기위해 18s 유전자를이용하여 65 C 의 annealing 온도로 PCR 을수행하였다. 경정배양과기내도입 바이로이드진단후무병화효율을확인하기위해 2 종류의바이로이드가모두감염된감시료를이용하여경정배양을통해기내도입을수행하였다. 신초의생장점부위를약 5 mm 크기로잘라내어기내도입배지에치상하였다. 기내도입배지의조성은 MS 배지 1 L 에 BA 2 mg, sucrose 30 g, plant agar 8g 을첨가하여 ph 5.8 로조정한후사용하였다. 약 4 주동안기내도입배지에서경정배양후잎과신초가생성되면바이로이드감염묘를증식배지에옮겼다. 증식배지는 MS 배지 1 L 에 BA 1 mg, IBA 0.3 mg, GA 3 0.5 mg, sucrose 30 g, plant agar 8 g 을첨가하였으며, ph 는기내도입배지와같이 5.8 로조정한후사용하였다. 또한 RNA 추출및 RT-PCR 을통해감염여부를확인하였다. 열처리, 한냉처리및항바이러스제처리에의한무병화효율실험 CVd 및 PVd 감염이확인된감부유품종을이용하여열 처리, 한냉처리및항바이러스제처리에의한방법을통하여무병화효율실험을수행하였다. 5 cm 길이로배양된감신초를이용하여각그룹별 9 개의개체를확보하여실험하였다. 열처리와한냉처리는각각 38 C 와 4 C 가유지되는항온항습장치에서처리하였으며항바이러스제처리군은 ribavirin 을배지에 20 ppm 과 40 ppm 의농도로첨가하여 28 C 에서처리하였다. 또한열처리와항바이러스제를복합적으로처리한그룹과한냉처리와항바이러스제를복합처리한그룹으로나누어처리하였으며, 처리기간은각각 2 주, 4 주, 8 주였다. 각시기및처리별그룹들은생장점배양과기내증식을통해증식하였고약 8 주후에 RNA 추출과 RT-PCR 을이용하여바이러스진단을하였다. 결과및고찰 바이로이드감염상황 전라남도지역에서수집한단감 198 개체의바이로이드진단은 RT-PCR 을이용하였다. CVd 는나주지역에서수집한 10 개체중 8 개체가감염됨에따라 80% 의높은감염 Table 2 Incidence of Persimmon viroid (PVd) and Citrus viroid (CVd) on persimmon in Jeollanam-do Region Viroid infection rate (%) CVd a PVd b CVd+PVd Naju 8/10 (80%) 1/10 (10%) 1/10 (10%) Yeongam 26/38 (68%) 7/38 (18%) 5/38 (13%) Damyang 20/50 (40%) 10/50 (20%) 7/50 (14%) Suncheon 22/50 (44%) 30/50 (60%) 17/50 (34%) Gurye 5/50 (10%) 19/50 (38%) 3/50 (6%) In Total 81/198 (41%) 67/198 (34%) 33/198 (17%) a CVd: Citrus viroid. b PVd: Persimmon viroid.
46 J Plant Biotechnol (2015) 42:43 48 률을보였고, 영암은 38 개체중 26 개체 (68%), 담양은 50 개체중 20 개체 (40%), 순천은 50 개체중 22 개체 (44%), 마지막으로구례는 50 개체중 5 개체로 10% 의가장낮은감염률을나타냈다. PVd 의경우나주지역은 10% 의감염률을나타냈고, 영암 18%, 담양 20%, 순천 60%, 구례지역은 38% 의감염률을확인할수있었다. 두종류의바이로이드가복합적으로감염되어있는경우는나주 10%, 영암 13%, 담양 14%, 순천 34%, 구례 6% 로확인되었다 (Table 2). 농촌진흥청의 2013 년보고서에의하면경상남도의경우총 227 개체의단감을확인한결과 CVd 는 7.1%, PVd 는 1.7% 의감염률을보고하였으나, 전라남도의경우높은바이로이드감염률을나타냈다. 이는접수를이용해증식되는과수의특성상지역적으로편중되는현상이관찰되는것으로판단되었다. 바이로이드진단결과를기준으로하여과실및잎에서바이로이드증상을확인해본결과검은반점의증상및잎이말리는바이로이드의심증상을관찰할수있었다 (Fig. 1B, 1C). Morton(1987) 은감바이로이드증상으로잎에검은반점이나타나거나과살에괴사반점이발생하는것을보고한바있다. 따라서, 본연구에서관찰된병징은바이로이드증상으로파악하고있으나금후정확한감바이로이드관련증상연구를수행할예정이다. 단감의무병화효율 두종류의바이로이드에대해복합감염된감을경정배양하였고바이로이드진단결과기내증식된감식물체는 Fig. 2 Detection of citrus viroid and persimmon viroid in persimmon PVd and CVd were detected by RT-PCR method in persimmon plants. N: negative, PVd: Persimmon viroid, CVd: Citrus viroid Fig. 3 In vitro propagation of viroid-infected persimmon and treatments of thermotherapy, cold therapy and chemotherapy. A: In vitro culture, B: 2 weeks treated group shoot tip culture, C: 4 weeks treated group shoot tip culture, D: 8 weeks treated group shoot tip culture, E: Subculture of treated persimmon
J Plant Biotechnol (2015) 42:43 48 47 바이로이드에대해모두감염되어있었다 (Fig. 2). CVd 및 PVd 가감염된기내배양감을이용하여무병화효율실험을수행하였다 (Fig. 3). 감무병화묘목을생산하기위해서열처리및한냉처리그리고항바이러스제처리를하는단독처리군과열처리와항바이러스제동시처리군및한냉처리와항바이러스제처리를동시에한복합처리군으로나누어각각의무병화효율을조사하였다. 각각의처리에따른감의생존율은열처리의경우 2 주처리군에서 9 개체중 9 개체모두생존하였지만 4 주및 8 주에서는생존율이 78% 와 44% 로점차낮아졌다. 한냉처리의경우 2 주와 4 주의경우 100% 의생존율을보였으나 8 주처리군에서는생존율이 33% 로급격히저하됨을알수있었다. 항바이러스제 (ribavirin) 의경우는감생존율에큰영향을보여주지않아각처리별생존율에있어서는항바이러스제처리가가장좋은것으로판단되었다. 복합처리의경우단독처리보다처리기간이증가함에따라생존율이감소하는현상이뚜렸하였으며 40 ppm 의항바이러스제와복합처리군의경우는 4 주에서도 44% 와 33% 의낮은생존율을보였고, 특히 8 주차의경우는 33% 이하의낮은생존율을확인할수있었다. 바이로이드제거효율에있어서는단독처리군의경우한냉 4 주차의결과가생존율에있어서 100% 결과를나타냈고바이로이드제거효율도 67% 로가장높은무병화효율을보여주었다 (Table 3). 열처리의경우 71% 의무병화효율을확인하였으나생존율이낮아확보한무병화개체수는한냉처리에비해적었다. Paduch-Cichal 과 Kryczynski (1987) 는국화의 potato spindle tuber viroid 가저온처리에의해효과적으로제거됨을보고하였으며, 본결과에서도바이로이드제거효율에있어서는열처리군에비해한냉처리가무병화효율이높음을알수있었다. 복합처리군의경우, 열처리와항바이러스제 40 ppm 농도로 8 주간처리한군과한냉처리와항바이러스제를 40 ppm 농도 로 8 주간처리한군에서 100% 의바이로이드제거효율을보여주었으나생존율이 11% 와 33% 로매우낮았고, 결론적으로확보된무병개체수가적었다. 열처리와항바이러스제를 20 ppm 농도로 4 주간처리한군에서도 71% 의무병화효율을보였으나최종적인 6 개체의무병묘가획득된처리는한냉처리와항바이러스제를 40 ppm 농로로 2 주간처리한군이었다 (Table 3). El-Dougdoug et al. (2010) 은단독처리에의한방법이외에도한냉처리와항바이러스제복합처리에의해효과적인무병화방법을보고하였다. Hop stunt viroid 를제거하기위해단독처리의경우항바이러스제처리가가장효과적임을확인하였으며복합처리의경우는한냉처리와항바이러스제처리를같이하였을경우생존률이높아지고무병화효율또한높아짐을보고하였다. 본결과에서는단독처리의경우한냉처리가가장좋은효과를보여주었지만복합처리의경우위논문과유사한결과를도출하였다. 결론적으로한냉처리만으로는약 4 주간처리한군에서 67% 의항바이러스제거효율을보여주었으나한냉처리에항바이러스제를복합처리한군의경우시간을단축시켜 2 주간의처리만으로도효과적으로바이로이드를제거할수있을것으로판단할수있었다. 적요 바이로이드에감염된과수의생산성하락으로인한농업인의소득이점점감소하고있는실정이다. 감에감염이가능한바이로이드는 PVd(Persimmon viroid) 와 CVd(Citrus viroid) 등이존재하는것으로알려져있다. 따라서본연구에서는전라남도감재배농가에서의감바이로이드감염현황을확인하였고열처리, 한냉처리, 항바이러스 Table 3 The percentage of survival rate and viroid inactivation efficiency upon thermotherapy, cold-therapy and chemotherapy Ribavirin 37 + Ribavirin 4 + Ribavirin Group Shoot survival rate a Viroid inactivation efficiency b 2 weeks 4 weeks 8 weeks 2 weeks 4 weeks 8 weeks 37 100% (9/9) 78% (7/9) 44% (4/9) 44% (4/9) 71% (5/7) 50% (2/4) 4 100% (9/9) 100% (9/9) 33% (3/9) 33% (3/9) 67% (6/9) 67% (2/3) 20 ppm 100% (9/9) 100% (9/9) 100% (9/9) 33% (3/9) 33% (3/9) 33% (3/9) 40 ppm 100% (9/9) 100% (9/9) 89% (8/9) 44% (4/9) 55% (5/9) 50% (4/8) 20 ppm 89% (8/9) 78% (7/9) 33% (3/9) 38% (3/8) 71% (5/7) 0% (0/3) 40 ppm 89% (8/9) 44% (4/9) 11% (1/9) 63% (5/8) 25% (1/4) 100% (1/1) 20 ppm 89% (8/9) 100% (9/9) 33% (3/9) 38% (3/8) 44% (4/9) 33% (1/3) 40 ppm 100% (9/9) 33% (3/9) 33% (3/9) 67% (6/9) 67% (2/3) 100% (3/3) Virus infection was evaluated by RT-PCR. a The number in parentheses refers to numbers of survival plant /numbers of total plants b The number in parentheses refers to numbers of viroid free plant /numbers of survival plants
48 J Plant Biotechnol (2015) 42:43 48 제처리를통해무병화효율성을알아보았다. 전라남도나주, 영암, 담양, 순천, 구례의 20 농가에서감부유품종 198 개체를샘플링하였다. RT-PCR 실험을통해감바이로이드의감염률을확인해본결과 CVd 41%, PVd 34% 로확인되었으며이미알려진수준에비해높게감염되어있음을알수있었다. 무병화효율실험은 PVd 와 CVd 가감염된감을이용하였으며처리방법에따라열처리 (38 C), 한냉처리 (4 C), 항바이러스제 (Ribavirin) 단독처리그룹과열처리와항바이러스제를동시에처리한그룹및한냉처리및항바이러스제를동시에처리한그룹으로나누었으며처리시간에따라 2 주와 4 주로나누어각각의바이로이드제거효율을확인하였다. 한냉처리한그룹의경우생존율이 100% 에무병화효율또한 67% 의높은제거효율을확인할수있었고, 한냉처리와항바이러스제를 2 주간복합처리한군에서도 67% 의높은효율을확인하였다. 결론적으로한냉처리가가장높은무병화율을보여주었으며본연구결과를통해감무병화연구에좋은자료가될것으로판단된다. 사사 본연구는 2015 년농촌진흥청국립원예특작과학원의기관고유사업 ( 과제번호 : PJ010228052015) 의지원에의해수행되었음. Reference Campbell AI (1962) Apple virus inactivation by heat therapy and tip propagation. Nature 195 : 520 El-Dougdoug KA, Osman M, Abdelkader HS, Dawoud RA (2010) Elimination of Hop stunt viroid (HSVd) from infected peach and pear plants using cold therapy and chemotherapy. Aust. J. Basic Appl. Sci. 4 : 54-60 Feng C, Wang R, Li J, Wang B, Yin Z, Cui Z, Li B, Bi W, Zhang Z, Li M, Wang Q (2013) Production of pathogen-free horticultural crops by cryotherapy of in vitro-grown shoot tips. Methods Mol. Biol. 994 : 463-482 Gambino G, Perrone I, Gribaudo I (2008) A Rapid and effective method for RNA extraction from different tissues of grapevine and other woody plants. Phytochem. Anal. 19 : 520-525 Hansen A and Lane W (1985) Elimination of apple chlorotic leaf spot virus from apple shoot cultures by ribavirin. Plant Dis. 69 : 134-135 Hollings M (1965) Disease control through virus-free stock. Annu. Rev. Phytopathol. 3 : 367-396 Ito T, Suzaki K, Nakano M (2013) Genetic characterization of novel putative rhabdovirus and dsrna virus from Japanese persimmon. J. Gene. Virol. 94 : 1917-1921 Kim DH, Kim HR, Heo S, Kim SH, Kim MA, Shin IS, Kim JH, Cho KH, Hwang JH (2010) Occurrence of Apple scar skin viroid and relative quantity analysis using Real-time RT-PCR. Res. Plant Dis. 16 : 247-253 Kim DH, Shim HK, Kwon HM, Hyun JW, Kim KS, Lee JK, Lee SC (2005) Production of virus-free stocks from citrus plant by the shoot-tip grafting and heat treatment. Korean J. Plant Biotech. 32 : 45-50 Lee G, Kim JS, Kim HR, Shin IL, Cho KH, Kim SH, Shin J, Kim DH (2013) Production system of virus-free apple plants using heat treatment and shoot tip culture. Res. Plant Dis. 19 : 288-293 Morton JF (1987) Fruit of warm climates. Julia Frances Nakaune R and Nakano M (2008) Identification of a new Apscaviroid from Japanese persimmon. Arch. Virol. 153 : 969-972 Paduch-Cichal E and Kryczynski S (1987) A low temperature therapy and meristem-tip culture for eliminating four viroids from infected pplants. J. Phytopathol. 118 : 341-346 Paprstein F, Sedlak J, Polak J, Svobodova L, Hassan M, Bryxiova M (2008) Results of in vitro thermotherapy of apple cultivars. Plant Cell. Tiss. Org. 94 : 347-352 Savitri WD, Park KI, Jeon SM, Chung MY, Han JS, Kim CK (2013) Elimination of Chrysanthemum stunt viroid (CSVd) from meristem tip culture combined with prolonged cold treatment. Hortic. Environ. Biotechnol. 54 : 177-182