Journal of the Korea Academia-Industrial cooperation Society Vol. 14, No. 4 pp. 1857-1862, 2013 http://dx.doi.org/10.5762/kais.2013.14.4.1857 진피섬유모세포에서대복피추출물의세포외기질합성촉진효과 이민호 1, 김형진 2, 정현아 3, 이영근 4* 1 오비엠랩, 2 피코스텍, 3 대전대학교한의과대학, 4 대전보건대학교 Stimulation of the Extracellular Matrix Production in Dermal Fibroblasts by Areca catechu Extract Min-Ho Lee 1, Hyung-Jin Kim 2, Hyun-Ah Jung 3 and Young-Keun Lee 4* 1 OBM LAB, 2 PICOSTECH, 3 Oriental Medical College, Daejeon University 4 Department of Cosmetic Science, Daejeon Health Science College 요약교원질을비롯한세포외기질의생합성을통해피부장력과탄력등피부특성을제공하는진피섬유모세포는피부노화와함께활성이감소되어주름형성의이유가된다. 따라서젊고건강한피부를유지하기위해서는진피섬유모세포의활성화가큰의미를지닌다. 본연구에서는대복피에탄올추출물이진피섬유모세포의세포외기질합성에미치는영향을 ELISA, Western blot analysis 및 RT-PCR 등의 in vitro 평가법으로측정하였다. ELISA와 western blot analysis에서대복피추출물은제1형교원질, fibronectin, transforming growth factor-β1 (TGF-β1) 의생성을촉진시켰고, RT-PCR에서는 COL1A1, TGF-β1, keratinocyte growth factor (KGF), insulin growth factor (IGF)-1의유전자발현을증가시켰다. 이상의결과로부터대복피추출물은진피섬유모세포에서세포외기질의생성을촉진시키는천연소재인것으로판단되었다. Abstract Dermal fibroblasts produce the many components of the extracellular matrix (ECM) that are needed to maintain connective tissue integrity and repair tissue injuries. This study investigated the effects of Areca catechu extract (ACE) on dermal fibroblast cell activation. Cultured human dermal fibroblasts were treated with ACE, and then ECM production was determined by ELISA, Western blot and RT-PCR. ACE significantly accelerated the production of type 1 collagen, fibronectin, and transforming growth factor (TGF)-β1 by ELISA and type 1 collagen by Western blot assay. ACE also increased the gene expression of COL1A1, TGF-β1, keratinocyte growth factor (KGF) and insulin growth factor (IGF)-1. These results suggest that ACE has the potential to stimulate ECM production and that it might be suitable for maintaining skin texture. Key Words : Areca catechu, Dermal fibroblast, Extracellular matrix 1. 서론 피부는바깥쪽에서부터표피, 진피및피하지방층의세개의층으로구성되어있다. 진피는피부의대부분을차지하며피부의장력, 탄력성, 유연성등의피부특성을제공한다. 이러한피부특성은진피섬유모세포 (dermal fibroblast cell) 에의해만들어지는교원섬유 (collagen fiber), 탄력섬유 (elastic fiber), 기질 (dermal matrix) 등에의해결정된다 [1]. 사람의피부는나이가들어가면서피부장력과유연성감소되고주름이발생하게되는데, 이는섬유모세포의활성저하에기인한세포외기질의합성감소및분해증가에의해발생되는결체조직 (connective 본논문은중소기업청에서지원하는 2012년도산학연공동기술개발사업 (No. C0027582) 의연구수행으로인한결과물임을밝힙니다. * Corresponding Author : Young-Keun Lee(Daejeon Health Sciences College) Tel: +82-42-670-9394 email: ykleeb@hit.ac.kr Received January 29, 2013 Revised February 25, 2013 Accepted April 11, 2013 1857
한국산학기술학회논문지제 14 권제 4 호, 2013 tissue) 의붕괴에서비롯된다 [2]. 진피섬유모세포는피부조직유지뿐아니라상처치유과정에도중요한역할을한다. 피부에상처가발생하면섬유모세포는세포증식과이동을통해손상된피부를복구하고, 다양한세포외기질합성하며, transforming growth factor (TGF)-β와같은세포조절물질과 epidermal growth factor (EGF), keratinocyte growth factor (KGF), vascular endothelial growth factor (VEGF), platelet derived growth factor (PDGF), insulin growth factor (IGF) 등의세포성장인자를분비해상처치유과정에관여한다 [3-5]. 따라서건강한피부조직의유지를위해서는진피섬유모세포의활성이중요한것으로인식되고있으며, 이에따라학계와산업계를중심으로진피세포의활성화연구가활발히진행되고있다 [6-8]. 대복피는야자과 (Palmae) 에속하는빈랑 (Areca catechu Linne) 의과피를말한다. 빈랑의씨인빈랑자의경우소화계 [9] 와신경계 [10] 에미치는영향과유효성분인 arecoline에대한연구 [11] 등이활발히진행된반면, 그과피인대복자에대한연구는 α-naphthylisothiocyanate 에의해유도된랫드의간손상에유효하다는보고 [12] 가있을뿐으로피부세포와관련된연구는찾아보기힘든실정이다. 본연구는대복피에탄올추출물이사람의피부에서분리해배양한진피섬유모세포를자극해교원질을비롯한세포외기질합성과상처치유에효과적인지의여부를검증하여, 이를화장품천연소재로서의활용가능성을검토코자하였다. 2. 실험재료및방법 2.1 시료 본연구에사용한대복피는대전대학교한의과대학에서제공받아사용하였다. 입수한대복피 500 g을분쇄한후천연물추출기에넣고 95% ethyl alcohol을 1:10 weight/volume으로가하여상온에서 5일간추출하였다. 추출한약재는 filter paper를사용해고형분을제거하고, rotary evaporator를이용해감압농축시켜대복피에탄올추출물 (Areca catechu extract, 이하 ACE라약함 ) 을제조하였다. 2.2 세포배양본연구에사용한진피섬유모세포는충남대피부과학연구실에서제공받아사용하였다 [13]. 세포배양은 10% fetal bovine serum과 penicillin/streptomycin이첨가된 Dulbeco s modified Eagle s medium ( 이상 Gibco BRL, USA) 을사용하였으며 37, 5% CO2 incubator에서배양하였다. 본연구의모든실험은 5 12 계대의세포주를이용하였다. 2.3 세포독성실험농도선정을위한세포독성실험은 MTT (3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) 법으로실시하였다 [14]. 2.4 Collagen 합성촉진효능 2.4.1 Enzyme-linked immunosorbent assay (ELISA) 제1형교원질정량은 Takara Bio (Japan) 에서구입한 ELISA kit를사용하였으며, 제조사에서제공한실험법에준하여평가를실시하였다. 2.4.2 Western blot analysis 세포배양액을제거하고, Proprep solution (Intron, 한국 ) 을사용하여세포를용해시킨후 Bradford protein assay kit (Bio-Rad, USA) 를이용해총단백질량을측정하고 SDS-polyacrylamide gel electrophoresis를실시하였다. 결과물을 nitrocellulose membrane 으로옮긴후 primary antibody를가하여 4 에서 18시간반응시키고, peroxidase-conjugated secondary antibody를첨가해실험결과를확인하였다. 본연구에사용한 primary antibody 로는 collagen type 1 α 1 (Santa Cruz, USA) 과 actin (Sigma, USA) 을사용하였다 [8]. 2.5 TGF-β1 과 fibronectin 정량 TGF-β1과 fibronectin 정량을위한 ELISA kit는 R&D 시스템 (USA) 과 American Diagnostica (USA) 에서각각구입하였으며, 각제조사에서제공한실험법에준하여 TGF-β1과 fibronectin을각각정량하였다. 2.6 Reverse transcriptase polymerase chain reaction (RT-PCR) Total RNA 2 μg을취하여 M-MLV reverse transcriptase (ELPIS Biotech, 한국 ) 을이용해 complementary DNA를제조하고, 이를활용해 PCR를실시하였다 [15]. 본연구에사용한 primer set은 Table 1과같다. 1858
진피섬유모세포에서대복피추출물의세포외기질합성촉진효과 [Table 1] Nucleotide sequence of primers. Name Primer Expected Size (bp) COL1A1 GGAGGGAATCACTGGTGCTA 309 AGGGGGAAAAACTGCTTTGT TGF-β1 KGF FGF-1 IGF-1 Cyclophilin TTCACCAGCTCCATGTCGAT CCTGCCACAGATCCCCTATT ACACACAACGGAGGGGAAAT GCCATAGGAAGAAAGTGGGC AGCCCACAGAGCCTGAATTT CAGGAAGGACAAAAGGGAGC GATTCTCCTGCCTCAGCCTC TAAGAGGGAACACATGGGCA CAGCCACCCAACGTTTACTT GAACTGGCTGCCATTGGTAT 2.7 세포이동 (cell migration) 431 552 339 224 309 세포단층 (cell monolayer) 에 scratch를가하면주변의세포들은세포증식과이동을통해손상된부위를복구하게된다. 즉세포이동은세포증식과함께창상치유과정에서큰의미를갖는다 [16]. 본연구에서는실험물질에의한세포이동촉진여부를평가하기위해진피섬유모세포세포단층에 p200 pipet tip으로 scratch를가해빈공간을만들고, 혈청을포함하지않은배지를가해 24시간배양하며실험군의세포이동정도를 inverted microscope를이용해대조군과비교하였다. 3.2 세포외기질합성촉진효과세월의흐름에발생하는내인성노화 (intrinsic aging) 와자외선등에의한광노화 (photoaging) 등으로구분되는피부노화의대표적인현상중하나는진피세포에서생합성되는기질단백질의감소이다 [17]. 이러한사실은나이든사람의피부에서는세포외기질의합성이현저하게감소함에서확인된다 [2]. 따라서젊고건강한피부유지에유용한소재의발굴을위해서는진피섬유모세포의활성화효능이큰의미를지닌다. 본연구에서는우선 ACE가세포외기질의합성에미치는영향을평가하였다. ELISA 결과 ACE는 25 μg / ml에서제1형교원질의생합성을 37%, 50 μg / ml에서 fibronectin과 TGF-β1의합성을각각 43% 와 42% 증가시켰다 (Fig. 2A, B, C). Western blot analysis에서도 ACE는세포내의제1형교원질합성을촉진시켜 ELISA 결과와일치하였다 (Fig. 2D). 또한 RT-PCR 에서도 ACE는 3. 실험결과및고찰 3.1 세포독성 ACE는본연구에서설정한최고실험농도인 50 μg / ml 까지세포독성을보이지않았다 (Fig. 1). [Fig. 1] Cytotoxicity of Areca catechu extract (ACE) on dermal fibroblast cells determined by MTT assay. [Fig. 2] Effect of Areca catechu extract (ACE) on collagen production in dermal fibroblasts. Cells were treated with ACE at the indicated concentrations for 2 days. The conditioned medium was collected, and the amounts of secreted (A) procollagen type 1, (B) fibronectin, and (C) transforming growth factor-β1 (TGF-β1) were measured by enzyme linked immunosorbent assay (ELISA). Results are shown as a percentage of a control±standard deviation (*p<0.05 vs. control). (D) Cellular proteins were harvested and the protein level of collagen type 1 α 1 was verified using western blot analysis. (E) The expression levels of the COL1A1 and TGF-β1 genes were determined using reverse transcription-polymerase chain reaction (RT-PCR). 1859
한국산학기술학회논문지제 14 권제 4 호, 2013 COL1A1와 TGF-β1의유전자의발현을증진시켜 (Fig. 2E), ACE는 RNA와단백질수준모두에서제1형교원질과 TGF-β1의생합성을촉진시키는효능을보였다. 제1 형교원질과 fibronectin은피부결체조직을구성하는주요요소이다. 교원질은진피섬유모세포에서전교원질 (procollagen) 의형태로합성되어효소분해과정등을거쳐다양한유형의교원질로만들어진다. 사람의피부를구성하고있는대표적인교원질은제1형으로전체교원질의 80% 를차지하며피부장력과창상치유에중요한역할을한다 [1]. Fibronectin은진피에서섬유모세포와세포외지질사이의상호작용에관여하는다기능성 glycoprotein이다 [18]. TGF-β는주요세포외기질의합성을조절하는물질로보고되어있다 [19, 20]. TGF-β는세포내에서 TGF-β receptor에결합해 serine/threonine kinase activity를활성화시켜연쇄적인신호전달반응을유도하고, 최종적으로세포증식과분화, 세포외기질합성과상처치유과정에관여한다 [21]. 따라서추가적인분자생물학적기전연구를통해밝히겠지만, ACE는 TGF-β1과관련된일련의세포신호전달체계를통해세포외기질의합성을촉진하는작용을하는것으로생각되었다. 3.3 In vitro wound healing 효과교원질, fibronectin 및 TGF-β1 생합성촉진은모두세포외지질강화와함께상처치유과정과도밀접한관련이있다 [4,22]. TGF-β 신호전달계는상처부위에서 re-epithelization, wound contraction, extracellular matrix deposition, remodeling 등에작용하는것으로보고되었으며 [23], 동물실험에서도 TGF-β1은상처치유를가속화하였다 [24]. Fibronectin 역시상처치유과정에서혈소판응집, 상피세포이동및분화, collagen matrix assembly, wound contraction 과정에작용한다 [18]. 진피섬유모세포도상처치유과정에도중요한역할을한다. 지혈및염증단계 (hemostasis and inflammation), 증식단계 (proliferation), 성숙단계 (remodeling) 로진행되는복잡한상처치유과정에서진피섬유모세포는증식단계에활발한세포분열과이동으로손상된부위를복원하고재구성하는데작용한다 [22]. 많은성장인자도상처치유과정에역할을하는데 EGF, KGF, FGF, VEGF, PDGF, IGF 등이대표적이다 [4]. 이에본연구에서는 ACE가이들성장인자에미치는영향을평가하기위해 RT-PCR를실시하였으며, 그결과 KGF와 IGF-1의유전자발현이 ACE 처리에의해증가됨을확인하였다 (Fig. 3). IGF-1은 in vitro 실험에서섬유모세포와각질세포의증식과이동을촉진하고, 동물실험에서도상처치유에도움을주는것으로알려져있으며 [25], KGF는상처치유과정의초기와 대량생산되며, 동물의상처치유에도움을준다는연구결과 [26] 를고려할때 ACE는상처치유에도움을줄수있는소재인것으로생각되었다. [Fig. 3] Dermal fibroblasts were treated with Areca catechu extract (ACE) at the indicated concentrations for 2 days. The levels of expression of keratinocyte growth factor (KGF), fibroblast growth factor (FGF)-1, insulin growth factor (IGF)-1 genes were verified by reverse transcription-polymerase chain reaction (RT-PCR). ACE에의해생성이촉진된 TGF-β, fibronectin, IGF-1 은모두상처치유과정에서세포이동을촉진하는것으로알려져있다. 이에본연구에서는마지막실험으로 ACE가상처치유에도움을주는지의여부를실험실적으로검증하기위해 ACE가진피섬유모세포성장과이동에미치는영향을평가하였다. In vitro 상처치유실험중직접적이고경제적인평가법으로인정받고있는 cell scratch assay[16] 로세포이동촉진효과를평가한결과, ACE를처치한실험군은대조군에비해 scratch wound가빠르게회복되어 ACE가창상치유에유용한물질임을확인할수있었다 (Fig. 4). 그러나 ACE는섬유모세포의증식에는영향을미치지못했다 (data 생략 ). [Fig. 4] Effect of Areca catechu extract(ace) on cell migration. Confluent monolayers of dermal fibroblast cells were wounded using a pipette tip, and the monolayer cells were treated with ACE at the indicated concentrations. The areas of cell-free wounds were photographed in inverted microscope after 24 h treatment. 1860
진피섬유모세포에서대복피추출물의세포외기질합성촉진효과 4. 결론 본연구는대복피에탄올추출물 (ACE) 이진피섬유모세포의활성화에미치는영향을검증하기위해실시하였다. ELISA 실험에서 ACE는진피섬유모세포를자극해 25 μg / ml에서제1형교원질의생합성을 37%, 50 μg / ml에서 fibronectin과 TGF-β1의합성을각각 43% 와 42% 증가시켰다. Western blot analysis에서도 ACE 처리군은제 1형교원질단백질생성이농도의존적으로증가되어 ELISA와일치된결과를보였다. RT-PCR에서는 COL1A1, TGF-β1, KGF 및 IGF-1 등세포외기질생합성및상처치유와관련된유전자의발현도증가되었다. 또한 in vitro scratch assay에서 ACE 처리군은대조군에비해 scratch wound가빠르게회복되는현상을보였다. 이상의결과를종합하면 ACE는진피섬유모세포에서세포외기질의합성및상처치유를도움을주는우수한기능성화장품소재인것으로판단된다. References [1] KDA Textbook Editing Board. Dermatology (5th Ed.). p.11-33, Ryo Moon Gak, 2008. [2] J. Uitto. Connective tissue biochemistry of the aging dermis. Age-related alterations in collagen and elastin. Dermatologic Clinics, 4, 433-446, 1986. [3] T. Kanzaki, N. Morisaki, R. Shiina, Y. Saito. Role of transforming growth factor-beta pathway in the mechanism of wound healing by saponin from Ginseng Radix rubra. Br J Pharmacol, 125, 255-262, 1998. DOI: http://dx.doi.org/10.1038/sj.bjp.0702052 [4] C. P. Kiritsy, A. B. Lynch, S. E. Lynch. Role of growth factors in cutaneous wound healing: a review. Crit Rev Oral Biol Med, 4, 729-760, 1993. [5] K. Haukipuro, J. Melkko, L. Risteli, M. Kairaluoma, J. Risteli. Synthesis of type I collagen in healing wounds in humans. Ann Surg, 213, 75-80, 1991. DOI: http://dx.doi.org/10.1097/00000658-199101000-00013 [6] Y. Kishimoto, N. Saito, K. Kurita, K. Shimokado, N. Maruyama, A. Ishigami. Ascorbic acid enhances the expression of type 1 and type 4 collagen and SVCT2 in cultured human skin fibroblasts. Biochem Biophys Res Commun, 430, 579-584, 2013. DOI: http://dx.doi.org/10.1016/j.bbrc.2012.11.110 [7] M, D. Adil, P. Kaiser, N. K. Satti, A. M. Zargar, R. A. Vishwakarma, S. A. Tasduq. Effect of Emblica officinalis (fruit) against UVB-induced photo-aging in human skin fibroblasts. J Ethnopharmacol, 132, 109-114, 2010. DOI: http://dx.doi.org/10.1016/j.jep.2010.07.047 [8] M. H. Jin, S. G. Park, Y. L. Hwang, M. H. Lee, N. J. Jeong, S. S. Roh, Y. Lee, C. D. Kim, J. H. Lee. Cedrol enhances extracellular matrix production in dermal fibroblasts in a MAPK-dependent manner. Ann Dermatol, 24, 16-21, 2012. DOI: http://dx.doi.org/10.5021/ad.2012.24.1.16 [9] M. Kumar, A. Kannan, R. K. Upreti. Effect of betel/areca nut (Areca catechu) extracts on intestinal epithelial cell lining. Vet Hum Toxicol, 42, 257-260, 2000. [10] N. S. Chu. Effects of Betel chewing on the central and autonomic nervous systems. J Biomed Sci, 8, 229-236, 2001. DOI: http://dx.doi.org/10.1007/bf02256596 [11] S. H. Lee, S. Y. Kim, K. H. Son, S. J. Kang, S. Y. Chang, J. H. Park, K. S. Lee. Isolation and quantitative determination of arecoline from Arecae semen. Kor J Pharm, 32, 39-42, 2001. [12] S. Ohata, N. Sato, S. H. Tu, M. SHinoda. Protective effect of Taiwan crude drugs on experimental live injuries. Yakugaku Zasshi, 113, 870-880, 1993. [13] S. S. Roh, M. H. Lee, Y. L. Hwang, H. H. Song, M. H. Jin, S. G. Park, C. K. Lee, C. D. Kim, T. J. Yoon, J. H. Lee. Stimulation of the extracellular matrix production in dermal fibroblasts by velvet antler extract. Ann Dermatol, 22, 173-179, 2010. DOI: http://dx.doi.org/10.5021/ad.2010.22.2.173 [14] M. H. Lee, C. D. KIm, H. J. Ahn. Evaluation of surfactant cytotoxicity potential by neutral red utake assay, MTT assay and cell protein assay. Korean J Toxiciol, 10, 215-220, 1994. [15] Y. W. Wang, J. H. Ren, K. Xia, S. H. Wang, T. F. Yin, D. H. Xie, L. H. Li. Effect of mitomycin on normal dermal fibroblast and HaCat cell: an in vitro study. J Zhejiang Univ Sci B, 13, 997-1005, 2012. DOI: http://dx.doi.org/10.1631/jzus.b1200055 [16] C. C. Liang, A. Y. Park, J. L. Guan. In vitro scratch assay: a convenient and inexpensive method for analysis of cell migration in vitro. Nat Protoc, 2, 329-333, 2007. DOI: http://dx.doi.org/10.1038/nprot.2007.30 [17] J. H. Chung. Photoaging in Asians. Photo- dermatol Photoimmunol Photomed, 19, 109 121, 2003. DOI: http://dx.doi.org/10.1034/j.1600-0781.2003.00027.x [18] L. F. Brown, D. Dubin, L. Lavigne, B. Logan, H. F. Dvorak, L. Van de Water. Macrophages and fibroblasts express embryonic fibronectins during cutaneous wound healing. Am J Pathol, 142, 793-801, 1993. [19] R. A. Ignotz, J. Massagué. Transforming growth factor-beta stimulates the expression of fibronectin and collagen and their incorporation into the extracellular 1861
한국산학기술학회논문지제 14 권제 4 호, 2013 matrix. J Biol Chem, 261, 4337-4345, 1986. [20] K. J. Rolfe, J. Richardson, C. Vigor, L. M. Irvine, A. O. Grobbelaar, C. Linge. A role for TGF-beta1-induced cellular responses during wound healing of the non-scarring early human fetus? J Invest Dermatol, 127, 2656-2667, 2007. DOI: http://dx.doi.org/10.1038/sj.jid.5700951 [21] J. Massagué, Y.G. Chen. Controlling TGF-beta signaling. Genes Dev, 14, 627-644, 2000. [22] R. F. Diegelmann, M. C. Evans. Wound healing: an overview of acute, fibrotic and delayed healing. Front Biosci, 9, 283-289, 2004. DOI: http://dx.doi.org/10.2741/1184 [23] M. Martinez-Ferrer, A. R. Afshar-Sherif, C. Uwamariya, B. Crombrugghe, J. M. Davidson, N. A. Bhowmick. Dermal transforming growth factor-beta responsiveness mediates wound contraction and epithelial closure. Am J Pathol, 176, 98-107, 2010. DOI: http://dx.doi.org/10.2353/ajpath.2010.090283 [24] T. A. Mustoe, G. F. Pierce, A. Thomason, P. Gramates, M. B. Sporn, T. F. Deuel. Accelerated healing of incisional wounds in rats induced by transforming growth factor-b. Science, 237, 1333 1336, 1987. DOI: http://dx.doi.org/10.1126/science.2442813 [25] E. Emmerson, L. Campbell, F. G. Davies, N. L. Ross, G. S. Ashcroft, A. Krust, P. Chambon, M. J. Hardman. Insulin-like growth factor-1 promotes wound healing in estrogen-deprived mice: new insights into cutaneous IGF-1R/ERα cross talk. J Invest Dermatol, 132, 2838-2848, 2012. DOI: http://dx.doi.org/10.1038/jid.2012.228 [26] G. P. Marti, P. Mohebi, L. Liu, J. Wang, T. Miyashita, J. W. Harmon. KGF-1 for wound healing in animal models. Methods Mol Biol, 423, 383-391, 2008. DOI: http://dx.doi.org/10.1007/978-1-59745-194-9_30 이민호 (Min-Ho Lee) [ 정회원 ] 생명과학, 피부과학 1983 년 8 월 : 중앙대학교대학원생물학과 ( 이학사 ) 1985 년 8 월 : 중앙대학교대학원생물학과 ( 이학석사 ) 1988 년 9 월 ~ 2006 년 5 월 : LG 생활건강기술원책임연구원 2006 년 10 월 ~ 현재 : ( 주 ) 오비엠랩연구소장 김형진 (Hyung-Jin Kimg) [ 정회원 ] 화장품, 화학공학 1985 년 2 월 : 한양대학교화공학과 ( 공학사 ) 1998 년 2 월 : 충북대학교공업화학과 ( 공학석사 ) 1984 년 12 월 ~ 2005 년 1 월 : LG 생활건강화장품연구소팀장 2006 년 3 월 ~ 현재 : ( 주 ) 피코스텍대표이사 정현아 (Hyun-Ah Jung) [ 정회원 ] 한의학, 생명과학 2003 년 2 월 : 대전대학교한의과대학한의학과 ( 한의학석사 ) 2007 년 2 월 : 대전대학교한의과대학한의학과 ( 한의학박사 ) 2009 년 3 월 ~ 현재 : 대전대학교한의과대학한의학과교수 이영근 (Young-Keun Lee) [ 정회원 ] 1984 년 2 월 : 부산대학교화학공학과 ( 공학사 ) 1996 년 2 월 : 충북대학교공업화학과 ( 공학석사 ) 2005 년 2 월 : 충북대학교화학공학과 ( 공학박사 ) 1984 년 12 월 ~ 2004 년 4 월 : LG 생활건강화장품연구소팀장 2008 년 3 월 ~ 현재 : 대전보건대학교화장품과학과교수 화장품, 화학공학 1862