Journal of Biomedical Research 13(1) : 35-46 (2012) Morphological and Histological Changes in Photoaged Hairless Mice Induced by Phellodendrin cortex Water Extract Application In-Soon Bae 1, Mi-Ja Shim 2, Mi-Soon Park 3, Young-Chul Kim 1 * 1 Department of Public Health, Graduate School, Keimyung University, Daegu 704-701, Korea 2 Department of Broadcasting & Entertainment Coordination, Gyeongbuk Provincial College, Yecheon Gun 757-807, Korea 3 Department of Health Care, Graduate School, Hanseo University, Chungnam 356-706, Korea (Received Jan 10, 2012 / Revised Feb 18, 2012 / Accepted Mar 8, 2012) ABSTRACT: This study was intended to evaluate the alleviating effects of Phellodendrin cortex water extract (PCWE) on skin aging in hairless mice via observing morphogical and histological changes. Skin aging was induced by UVB irradiation and squalene monohydroperoxide (Sq-OOH) application to the back skin of hairless mice for 6 weeks. And at the same time, saline (C), jojoba oil (VC), PCWE (E) and 0.01% retinoic acid diluted with polyethylene glycol (PC) were applied topically twice a day, 6 days a week for 6 weeks. Retinoic acid and PCWE application groups improved wrinkle formation in a pattern of shallow furrows and thin and narrow crests compared to the C group. As based on the morphologic analysis for skin wrinkles, E group showed lower levels in skin roughness, maximum roughness, average roughness, smoothness depth and arithmetic average roughness by 13.1, 17.2, 18.4, 15.4 and 16.1%, respectively than the C group, indicating that PCWE inhibited potential formation of wrinkles in the skin. The structure of lipid lamellae and collagen fibers were broken or deformed with an irregular arrangement in the C group. The retinoic acid and PCWE applications protect against the deformity of lipid lamellae and collagen fibers. Elastic fibers in dermis of the C group were also transformed severely but applications of retoinoic acid and PCWE significantly decreased the number of denatured elastic fibers. Therefore, PCWE could have a alleviating effects on the skin aging induced by UVB irradiation and Sq-OOH application. Key words: Phellodendrin cortex water extract, Skin aging, Collagen fiber, Elastic fiber *Corresponding author: Young-Chul Kim Department of Public Health, Graduate School, Keimyung University, 1000 Shindang-dong, Dalseo-gu, Daegu 704-701, Korea Tel: +82-53-580-5931 Fax: +82-53-588-5233 E-mail: yckim@kmu.ac.kr
36 In-Soon Bae et al. 서론과량의자외선에지속적으로노출된피부에서는기질금속단백분해효소 (matrix metalloproteinases, MMPs) 의과다한발현증가로세포와세포외기질의변형이관찰되며피부진피조직의교원섬유 (collagen) 와탄력섬유 (elastin) 의양과탄성이감소하고피부세포내수분이감소되어 [1] 피부가건조해지고거칠며탄력성이저하되어주름형성이깊어진다 [2]. MMPs는세포외기질의많은성분을분해할수있는 endopeptidase로서염증세포에서만만들어지고자외선에의한광노화피부에서는피부표면조직의파괴로표피가두꺼워지고진피에피부염증을유발, 비만세포의탈과립, 홍반을수반하게된다 [3]. Squalene monohydroperoxide (Sq-OOH) 는과산화된 squalene의초기생성물로자외선에노출됨으로써피부에서생성된다 [4]. Hairless 마우스실험에서 Sq-OOH는활성산소종을생성시키고다른 monohydroperoxides나자극제들보다더피부거침, 각화층의수분손실, 주름형성을야기시키는것으로보고되었다 [5]. Hairless 마우스는 UVB 조사시표피세포의과증식으로인해피부두께가두꺼워지고, 탄력섬유의변형등표피와진피의변화양상이사람에게일어나는광노화와유사한변화가나타나기때문에노화연구모델로가장널리사용되고있는실험동물이다 [6]. Retinoid는세포분화를촉진하고생체에필요한각종단백질의생합성등의기능으로주름개선에효과가있는것으로보고되고있다 [7]. Retinol은생체내에서레티노인산 (retinoic acid) 으로변환되고, retinoic acid는비타민 A 유도체로서세포내활성산소를제거하여세포의증식을억제하는작용을한다 [8]. Retinoic acid는 transforming growth factorbeta (TGF-β) 를유도하고 TGF-β는진피층에있는 Type-1, 3의 procollagen 유전자의생성을유도하여교원섬유의합성을증가시키며 [7] 피지선억제, 면역조절및항염증작용등이있어여드름, 건선등의피부질환이나피부암, T세포림프종등의악성종양 의치료에도이용된다. 또한, 자외선조사로생성된교원섬유분해효소인 MMP-1의생성을억제할수있기때문에광노화의치료제로서사용되기도하며 retinol은얼굴등피부의주름을예방또는개선하고자하는목적으로기능성화장품원료로서국내에서도널리상용되고있다. 그러나 retinoid를국소도포제로사용하는많은환자들은레티노이드피부염 (retinoid dematitis) 이라고불리는일종의자극성접촉피부염을경험하게되는데증상은홍반, 건조, 작열감, 소양감등을나타내며환자들중다수가이러한부작용으로치료를중단하게된다 [9]. 최근웰빙열풍과자연주의확산으로천연소재를이용한기능성화장품개발이지속적으로증가하고, 천연물소재개발이전세계적으로매우활발히진행되고있다. 황백 ( 黃柏, Phellodendri cortex) 은운향과 (rutaceae) 식물에속하는황벽나무 (Phellodendron amurense Ruprecht) 의주피를벗겨내고말린줄기껍질이다. 황백의성분중 berberine은항산화작용 [10], 및항염작용 [11] 이있는것으로알려져있으나현재까지황백열수추출물의피부노화억제효과에관한실험문헌을찾아보기힘들어그유효성을판단하기는힘든실정이다. 이에본연구는 hairless 마우스에반복적으로 UVB 조사와 Sq-OOH를도포하여피부노화를유발시키면서황백열수추출물을도포하여피부노화억제에미치는효과를확인하였다. 재료및방법시약및기기 Hydrogen peroxide는 Junsei사 (Japan) 의제품, hematoxylin, bovine serum albumin, retinoic acid, polyethylene glycol은 Sigma사 (USA) 의제품, squalene은 Acros사 (USA) 의제품, 호호바오일 (jojoba oil) 은 Desert Whale사 (USA) 의제품을사용하였으며그외일반시약들은특급품을사용하였
Morphological and Histological Changes in Hairless Mice by Phellodendrin cortex Water Extract 37 다. 실험기기중자외선조사장치는 UVB sunlamp (UVM-225D, Mineral Lamp UVP, USA) 를, 자외선측정장치는 UV-radiometer (HD9021, Delta OHM, Italy) 를사용하였다. 피부유분및수분함량측정은각각 Sebumeter (SM815, CK electronic GmbH, Germany) 와 Corneometer (CM825, CK ele-ctronic GmbH, Germany) 를사용하였다. 시료추출은초고속감압저온추출기 (COSMOS-660, 경서기계산업, 한국 ) 를사용하였다. 조직표본관찰은 Olympus BX51 light microscope (Olympus, Japan) 와 Progres C14 plus digital camera system (Olympus, Japan) 을사용하였다. 시료조제경북영주시에서유기농재배한황백 600 g을구입하여물 6 l를가하여초고속감압저온추출기로열수추출한후 5 l의양을얻었다. 5 l를진공농축용기에담아 2 l로농축하였고파우치진공포장후냉장보관하여실험에사용하였다. 동결건조로측정한황백열수추출물의수율 (yield rate) 은 15.27% 였다. 황백추출물 10 ml + jojoba oil 1 ml + 100% 에탄올 2.5 ml + 물 6.5 ml 비율로혼합하여황백추출물시료로사용하였다. 실험동물및처치실험동물은 7주령의 SKH-1 hairless mouse (Charles-River, Japan) 를분양받아 1주일간사육실에서적응시킨후실험전기간동안사료와물은자유롭게공급하였다. 사육실은온도 22 ± 1 C, 상대습도 50 ± 5%, 조명주기 12시간씩밤낮을유지하였다. 실험동물은실험 6주째되는날 4시간전부터절식시킨다음에테르로마취한후피부를적출한후일부는 10% 중성포르말린용액에고정하여조직학적검사에사용하였고나머지는냉동보관후 MMP 발현측정에사용하였다. 실험군은정상군 (Normal, N) : 아무런처치를하지않은군, 대조 군 (Control, C) : 자외선조사 + Squalene-OOH 도포 + Saline 도포군, 용매대조군 (Vehicle Control, VC) : 자외선조사 + Squalene-OOH 도포 + 용매 (100% 에탄올 + Jojoba oil + 물 ) 도포군, 양성대조군 (Positive Control, PC) : 자외선조사 + Squalene- OOH 도포 + Retinoic acid 도포군, 실험군 (Experimental, E) : 자외선조사 + Squalene-OOH 도포 + 황백열수추출물도포군, 총 5개군으로분류하여군별로 5마리씩총 25마리를실험에사용하였다. 피부노화유발및시료도포자외선조사장치의광원은 302 nm의 UVB를방출하는 sunlamp를사용하였다. 마우스를자외선조사용 cage에가둔후등부위에격일간격으로 1주일에 3회, 6주동안조사하였으며, 자외선조사량은 UV-radiometer로측정하였다. 1주에는 100 mj/ cm 2, 2-3주는 200 mj/cm 2, 4-6주는 300 mj/cm 2 의광량을조사하였다. 피부염증을유발하기위하여 Sq- OOH를 1일 2회, 주 6일, 매회 100 μl씩 6주간도포하였다. 황백열수추출물 (0.366 g/kg BW/day), 용매, saline은 1일 2회, 주 6일, 6주동안매회 200 μl 씩도포하였다. Retinoic acid는 polyethylene glycol에 0.01% 로희석하여 1일 2회, 주 6일, 6주동안매회 200 μl씩도포하였다. 피부유분함량, 수분함량측정유분함량은 Sebumeter (SM815), 수분함량은 Corneometer (CM825) 를사용하여비침습적방법으로실험기간동안주 1회측정하였다. 피부조직의형태 조직학적관찰 1) 육안적관찰피부의육안적관찰은 6주째에테르로가볍게마취를하고디지털카메라로사진촬영을한후 replica를떠서 SV600 software program (C+ K, Germany) 을사용하여주름지표를분석하고주름의양상을알아보았다.
38 In-Soon Bae et al. 2) Masson s trichrome 염색관찰절취한피부조직을실온에서 10% 중성포르말린용액에 24시간고정한후통상적인방법으로수세, 탈수, 투명, 침투과정을거친다음파라핀으로포매하고 4 μm 두께로절편을만들어실온에서 bouin 용액에하룻밤담그고 Masson s trichrome 염색후진피층내교원섬유 (collagen fiber) 의양과 형태를광학현미경으로관찰하였다. 3) Verhoeff s 염색관찰절취한피부조직을실온에서 10% 중성포르말린용액에 24시간고정한후통상적인방법으로수세, 탈수, 투명, 침투과정을거친다음파라핀으로포매하고 4 μm 두께로절편을만들어 Verhoeff 용 Table 1. Nucleotide sequence of the primers and expected size of PCR products Items Primers Expected size (bp) 3) GAPDH 1) MMP-3 2) Forward (5' 3') Reverse (5' 3') Forward (5' 3') Reverse (5' 3') 1) GAPDH : Glyceraldehyde-3-phosphate dehydrogenase. 2) MMP-3 : Matrix metalloproteinase-3. 3) bp : basepair. CCCACTAACATCAAATGGGG ACACATTGGGGGTAGGAACA TAGCAGGTTATCCTAAAAGCA CCAGCTATTGCTCTTCAAT 478 317 Table 2. Changes in lipid capacity of SKH-1 hairless mice skin in 6-week experiment to evaluate the inhibition effect of Phellodendri cortex water extract on skin aging Weeks Normal Control Experimental N C VC PC E 1 3.60 ± 1.14 ab 2.50 ± 0.58 a 5.50 ± 1.30 abc 8.00 ± 1.58 c 5.80 ± 4.03 bc 2 3.00 ± 1.58 a 1.20 ± 0.84 a 1.20 ± 1.10 a 1.60 ± 0.55 a 1.60 ± 1.82 a 3 2.40 ± 1.14 a 0.75 ± 0.96 a 0.80 ± 0.84 a 2.60 ± 2.51 a 0.80 ± 0.45 a 4 3.00 ± 1.58 a 1.00 ± 0.82 a 1.40 ± 0.89 a 2.40 ± 2.51 a 1.60 ± 1.34 a 5 3.60 ± 1.95 b 1.00 ± 0.71 a 1.20 ± 1.10 a 1.80 ± 1.10 ab 2.00 ± 1.58 ab 6 3.00 ± 1.23 b 1.00 ± 0.71 a 1.00 ± 1.16 a 1.25 ± 0.50 ab 3.00 ± 2.00 b Values are mean ± SD of 5 mice. Unit: μg/cm 2 N: No treatment group C: UVB irradiation + Squalene-OOH + Saline application group VC: UVB irradiation + Squalene-OOH + Jojoba oil + 100% ethanol + Water application group PC: UVB irradiation + Squalene-OOH + Retinoic acid application group E: UVB irradiation + Squalene-OOH + Phellodendri cortex extracts application group Values with different superscripts in the same row are significantly different (P<0.05) by ANOVA and Duncan's multiple range tests.
Morphological and Histological Changes in Hairless Mice by Phellodendrin cortex Water Extract 39 액에염색후수세, ferric chloride 2% 로감별수세후 sodium thiosulfate에처리하여피부진피층내의탄력섬유 (elastic fiber) 의변화, 소실및퇴행성변화등을광학현미경으로관찰하였다. 피부조직의 Matrix metalloproteinase-3 1) RNA 추출 Deep freezer에냉동보관하였던피부조직을액화질소에담아이송한후얼음으로저온을유지시키며조직 50 mg당 1 ml의 Trizol (Invitrogen, New Zealand) 을첨가하여조직을마쇄하고실온에서 5 분간 incubation 시킨후 chloroform 200 μl를첨가하여실온에서 3분간방치후 15000 rpm, 4 C, 10 분간원심분리하였다. 상층액을취한후 isopropyl alcohol을 500 μl 첨가한다음 15000 rpm, 4 C, 15 분간원심분리후상층액은제거하고 70% ethanol 1 ml을첨가하여 RNA pellet을 washing하고 15000 rpm, 4 C, 2분간원심분리하여나온상층액은제거하고남은 RNA pellet을실온에서건조후 diethylpyrocarbonate (DEPC) 로희석하여 260 nm 에서 optical density (OD) 값을측정하여 RNA를정량하였다. 280 nm에서 OD값을측정하고 absorbance ratio (A260/A280) 가 1.8~2.0 사이인지확인하였다. 2) cdna 합성 BioNEER사의 CycleScript RT PreMix (dt20) kit에서제공하는 protocol에따라 total RNA 양이 0.1~1 μg/μl가되도록 RNA sample을넣고 DEPC 를 20 μl까지채운후 30 C에서 1분간, 50 C에서 4 분간 12 cycle 반응시키고 95 C에서 5분간가열하여반응을종결시켰다. 3) PCR과전기영동 BioNEER사의 AccuPower TM PCR PreMix kit 를구입하여사용하였다. Template 2 μl, forward primer와 reverse primer (10 pmole/l, Bio- NEER, Korea) 를각각 1.4 μl, 멸균된증류수 15.2 μl를섞 고 PCR 반응 (Bio-RAD, Mycycler TM thermal cycler, USA) 을실시하였다. Primer는대조군으로 GAPDH (57 C, 35 cycle), 실험군으로 MMP-3 (60 C, 35 cycle) 을사용하였으며사용된 primer들의염기서열은 Table 1과같다. Tris-acetate ethylenediaminetetra acetic acid (TAE) buffer를이용하여 1.5% agarose gel에전기영동시켜 ethidium bromide에염색한후수세하고 UV를조사하여 DNA band를확인하였고 Gel Logic 100 Imaging System (Kodak, USA) 을이용하여발현량을수치화하여통계처리하였다. 자료분석통계적분석은 SPSS 12.0 for windows (SPSS Inc., USA) 를이용하여일원배치분산분석 (oneway ANOVA) 을이용하였고각그룹간의차이를검증하기위하여 Duncan s 다중비교분석을이용하여사후분석을실시하였다. 통계적유의성검정은 α=0.05 이하에서실시하였다. 결과및고찰피부의유분및수분함량피부유분및수분함량의변동을측정한결과는각각 Table 2와 3과같다. 실험 6주후에대조군, 용매대조군은정상군에비해유의하게낮았으며대조군에비교할때양성대조군은약 25% 높았고황백열수추출물도포군은약 200% 유의하게높았으며 (P<0.05) 정상군과비슷한수치를나타내었다. 피부수분함량의변동을측정한결과는 Table 3과같다. 실험 6주후에대조군, 용매대조군은정상군에비해유의하게낮았으며 (P<0.05) 양성대조군, 황백열수추출물도포군은각각약 18%, 22.5% 수분함량이낮았다. 양성대조군과황백열수추출물도포군은대조군에비해각각 59%, 50.3% 유의하게높았다 (P<0.05). 이와같이황백열수추출물도포
40 In-Soon Bae et al. 군은대조군에비해피부유분함량과수분함량에있어유의하게높게나타나표피층내피부장벽의손상이경감되었음을확인하였다. 피부는외부환경과직접적으로접하고있는광범위한기관으로서수분과전해질의손실을막고, 세균의침입을막아주며물리화학적손상으로부터인체를보호하는보호장벽의기능이있다 [12]. 자외선에노출된피부표면에서지질과산화물의함유량이높으며광노화피부에서만성적으로태양에노출된부위에지질과산화생성이증가된다. 각질층지질은피부장벽대의역할인각질층내수분유지와함께외부수분의유입을막는기능을담당하며상피세포증식조절, 세포간응집과표피탈락에도관여한다 [13]. 피부장벽을손상시키는외부의물리화학적자극이피부에가해지면표피를통한수분의손실이발생하는데, 이때에칼슘이온등의표피내농도를변화시키고, 이는피부장벽을회 복시키는항상성반응을시작하는신호로작용하여, 각질세포간지질의전구체를함유한층판소체 (lamellar body) 를분비시키고, 새로운층판소체를생성하여손상된각질세포간지질을보충하여다시튼튼한각질세포간지질막을재형성하게된다 [14]. 이때표피의각질형성세포에서는 cytokine을분비하여각질형성세포의증식을직접자극하거나자극을받은진피내의염증세포에서분비된 cytokine에의하여각질형성세포의 DNA합성을증가시키고증식을간접적으로자극시켜서표피의증식을초래한다 [15]. 피부조직의형태 조직학적변화 1) 육안적및주름지표비교피부주름의형태를비교한결과는 Fig. 1과같다. 정상군과비교할때대조군은주름능선의두께 Table 3. Changes in water capacity of SKH-1 hairless mice skin in 6-week experiment to evaluate the inhibition effect of Phellodendri cortex water extract on skin aging Weeks Normal Control Experimental N C VC PC E 1 44.86 ± 5.45 b 22.15 ± 5.18 a 24.79 ± 4.32 a 29.40 ± 8.18 a 24.33 ± 3.86 a 2 44.61 ± 6.40 b 25.09 ± 8.58 a 33.31 ± 4.42 ab 39.53 ± 8.90 b 45.08 ± 13.12 b 3 45.31 ± 4.99 b 19.94 ± 8.02 a 22.29 ± 6.71 a 27.64 ± 8.42 a 20.63 ± 3.13 a 4 48.26 ± 8.25 b 27.74 ± 6.86 a 30.24 ± 5.54 a 34.73 ± 4.47 a 34.85 ± 6.89 a 5 46.57 ± 4.64 c 22.83 ± 6.18 a 30.75 ± 3.76 b 34.43 ± 4.04 b 33.54 ± 2.94 b 6 42.79 ± 12.60 c 22.05 ± 6.76 a 28.90 ± 6.38 ab 35.05 ± 6.61 bc 33.15 ± 4.07 bc Values are mean ± SD of 5 mice. Unit: AU(Arbitrary Unit) N: No treatment group C: UVB irradiation + Squalene-OOH + Saline application group VC: UVB irradiation + Squalene-OOH + Jojoba oil + 100% ethanol + Water application group PC: UVB irradiation + Squalene-OOH + Retinoic acid application group E: UVB irradiation + Squalene-OOH + Phellodendri cortex extracts application group Values with different superscripts in the same row are significantly different (P<0.05) by ANOVA and Duncan's multiple range tests.
Morphological and Histological Changes in Hairless Mice by Phellodendrin cortex Water Extract 41 가굵고간격이넓으며주름이깊게형성된반면, 양성대조군과황백열수추출물도포군은상대적으로주름능선의두께가얇고간격이좁으며주름이얕게형성되어있어정상군에가까운양상을보였다. 피부주형을이용하여군별주름양상을나타내는객관적지표 (R1-R5) 들의분석치를통계처리한 결과는 Table 4와같다. 피부주름형태분석에서실험군이대조군에비해 R1 (Skin Roughness), R2 (Maximum Roughness), R3 (Average Rough ness), R4 (Smoothness Depth), R5 (Arithmetic Average Roughness) 가각각 13.1, 17.2, 18.4, 15.4, 16.1% 낮게나타나황백열수추출물이피부노화의대표적인징후인주름형성억제효과가있음을확인하 Fig. 1. Anti-wrinkle effect of 6-week Phellodendri cortex water extract application in photoaged SKH-1 hairless mice skin.
42 In-Soon Bae et al. 였다. 인간의피부에서노화와관련하여관찰되는변화중상피세포의형태학적변화와더불어각질층에서의습윤감소로인한거칠어짐과주름등이두드러진다 [16]. 피부는자외선에노출되면표피의각질형성세포와진피의섬유아세포의표면에있는성장인자나 cytokine 수용체를활성화시켜 nuclear transcription factor인 AP-1을활성화시키고, 이는 matrix metalloproteinases (MMPs) 유전자전사를촉진시킨다. AP-1은또한섬유아세포에작용하여 procollagen 유전자의발현을억제한다 [17]. MMP 는진피의교원섬유와그외세포외기질단백질을분해시키는작용을하며손상된진피의불완전한수복은세포외기질을기능적구조적으로취약하게하여반복적인자외선노출은진피의손상을심화시키고결국광노화의특징인주름을생성시킨다 [18]. 2) Masson s Trichrome 염색관찰진피층내교원섬유의양과형태를관찰한결과는 Fig. 2와같다. 정상군은교원섬유의밀도가조 밀하고배열이규칙적인반면, 대조군은교원섬유가파괴되어밀도가엉성하고배열이불규칙적이고양도많이줄어있었다. 양성대조군과황백열수추출물도포군은대조군에비해교원섬유의밀도가조밀하고배열이규칙적으로나타남을확인하였다. 3) Verhoeff s 염색관찰진피층내탄력섬유의양과형태를관찰한결과는 Fig. 3과같다. 정상군은탄력섬유의배열이규칙적인반면, 대조군은진피가두꺼워지고변성되고엉긴탄력섬유가증가하였다. 양성대조군과황백열수추출물도포군은대조군에비해변성된탄력섬유가많이줄어들어있음을확인하였다. 피부의진피조직속에는교원섬유와탄력섬유가그물망구조를형성하고있는데, 이러한탄력섬유는 elastase에의해분해되어그물망구조가깨어지면서피부가처지고주름이생겨내인성피부노화가발생한다. 선행연구에서 UV 조사에의한 hairless 마우스의진피층에서교원섬유의감소와함께변형된탄력섬유가다소증가하는탄력섬유증 (elastosis) 이관찰되었으며 [19], elastosis는 UV 조 Table 4. Comparison in wrinkle parameters of SKH-1 hairless mice skin induced by 6-week Phellodendri cortex water extract application Items Normal Control Experimental N C VC PC E R1 1.51 ± 0.13 a 1.75 ± 0.18 a 1.62 ± 0.67 a 1.52 ± 0.22 a 1.52 ± 0.28 a R2 1.24 ± 0.16 a 1.63 ± 0.18 a 1.49 ± 0.63 a 1.40 ± 0.21 a 1.35 ± 0.34 a R3 0.88 ± 0.15 a 1.14 ± 0.13 a 1.07 ± 0.46 a 1.00 ± 0.16 a 0.93 ± 0.24 a R4 0.20 ± 0.03 a 0.26 ± 0.03 a 0.24 ± 0.15 a 0.23 ± 0.04 a 0.22 ± 0.04 a R5 0.45 ± 0.05 a 0.56 ± 0.06 a 0.54 ± 0.23 a 0.55 ± 0.09 a 0.47 ± 0.13 a Values are mean ± SD of 5 mice. R1: Skin Roughness R2: Maximum Roughness R3: Average Roughness R4: Smoothness Depth R5: Arithmetic Average Roughness
Morphological and Histological Changes in Hairless Mice by Phellodendrin cortex Water Extract 43 사에 의한 전형적인 병변으로 보고된바 있다[20]. 매대조군, 양성대조군, 황백 열수추출물 도포군은 피부조직의 MMP-3 발현 비교 출물이 자외선에 의한 MMP의 발현을 억제시키는 피부조직의 MMP-3 mrna 발현량을 측정한 결 과는 Fig. 4와 같다. 정상군에 비해 대조군은 유의 하게 높았고(P<0.05), 용매대조군은 유의성은 없 었지만 약 68.1% 높게 나타났다. 대조군에 비해 용 유의하게 낮았다(P<0.05). 이를 통해 황백 열수추 효과가 있음을 확인하였으며 이와 같은 결과는 대 조군과 용매대조군에 비해 양성대조군과 황백 열수 추출물 도포군이 교원섬유의 밀도가 조밀하고 배열 이 규칙적이며 탄력섬유의 변성도 적게 나타난 조 Fig. 2. Histological observation on collagen fibers in photoaged SKH-1 hairless mice skin after 6-week application of Phellodendri cortex water extract. Masson s Trichrome stain, 200.
44 In-Soon Bae et al. Fig. 3. Histological observation on elastic fibers in photoaged SKH-1 hairless mice skin after 6-week application of Phellodendri cortex water extract. Verhoff s stain, 200 & 400. 120. c 직학적 소견을 뒷받침해 준다. UVB 조사로 유도된 MMPs는 피부의 교원섬유 를 감소시킨다. 그 중 MMP-3는 각질형성세포, 섬 유아세포에서 발현되며[21], gelatin, proteoglycan, laminin, fibronectin, type III과 IV collagen을 포함 한 다양한 세포외 기질단백질의 분해를 담당한다 [22]. MMP-3/GAPDH(%) 100 b 80 60 ab a ab 40 20 0 N C VC PC E Groups Fig. 4. Comparison of MMP-3 mrna expression in photoaged SKH-1 hairless mice skin induced by 6-week Phellodendri cortex water extract application.
Morphological and Histological Changes in Hairless Mice by Phellodendrin cortex Water Extract 45 참고문헌 1. So SH, Lee SK, Hwang EI, Koo BS, Han GH, Kim NM. Effects of Korean red ginseng and herb extracts mixture (KTNG0345) on procollagen biosynthesis and matrix metalloproteinase-1 activity in human dermal fibroblast. J Ginseng Res 2007;31:196-202. 2. Karin SK, Peter B, Jutta W, Gernot H, Weijan M, Lale K, Christian M, Meinhard W. Photoaging of the skin from phenotype to mechanisms. Exper Gerontol 2000;35:307-316. 3. Chiba K, Kawakami K, Sone T, Onoue M. Characteristics of skin wrinkling and dermal changes induced by repeated application of squalene monohydroperoxide to hairless mouse skin. Skin Pharm Appl Skin Physiol 2003;16:242-251. 4. Kohno Y, Takahashi M. Peroxidation in human skin and its prevention. J Jpn Oil Chem Soc 1995;44(4):10-17. 5. Chiba K, Sone T, Kawakami K, Onoue M. Skin roughness and wrinkle formation induced by repeated application of squalenemonohydroperoxide to the hairless mouse. Exp Dermatol 1999;8:471-479. 6. Kligman LH. The hairless mouse model for photoaging. Clin Dermatol 1996;14:183-195. 7. Gary JF, Kang SW, Varani J, Zsuzsanna BC, Wan Y, Datta S, Voorhees JJ. Mechanisms of photoaging and chronological skin aging. Arch Dermatol 2002;138:1462-1470. 8. Weiss JS, Ellis CN, Headington JT, Voorhees JJ. Topical tretinoin in the treatment of aging skin. J Am Acad Dermatol 1988;19:169-175. 9. Fisher GJ, Esmann J, Griffiths CEM, Talwar HS, Duell EA, Hammerberg C, Elder JT, Karabin GD, Nickoloff BJ, Cooper KD, Voorhees JJ. Cellular, immunologic and biochemical characterization of topical retinoic acid-treated human skin. J Invest Dermatol 1991;96:699-707. 10. Lee MJ, Park JW, Kim DS, Kim JK, Choi DY, Kim CH. Antioxidant and Nitrite Scavenging Activity of Water - Extract from Phellodendron amurense Rupr. Kor J Ori Med Pathol 1999;13(1):112-118. 11. Choi KH, Kim YK, Kang SK, Jung SY, Jung JH, Seo HS, Yoo JG. The study on the antiinflammatory effects of Phellodendri cortex, indigo naturalis, alumen, and Chinensis galla, most frequently used for the external theraphy of Gu-Chang. J Kor Orient Med Ophthal Otolaryngol Dermatol 2005;18:183-198. 12. Elias PM, Choi EH. Interactions among stratum corneum defensive functions. Exp Dermatol 2005;14:719-726. 13. Blanken R, Van Vilsteren MJT, Tupker RA, Conraads PJ. Effect of mineral oil and linoleicacid-containing emulsions on the skin vapour loss of sodium-lauryl-sulphate-induced irritant skin reactions. Contact Dermatitis 1989;20:93-97. 14. Schurer NY, Plewig G, Elias PM. Stratum corneum lipid function. J Dermatol 1991;183:77-94. 15. Candi E, Melino G, Mei G, Tarcsa E, Chung SI, Marekov LN. Biochemical, structural, and transglutaminase substrate properties of human loricrin, the major epidermal cornified cell envelope protein. J Biol Chem 1995;270:26382-26389. 16. Freeberg IM, Eisen AZ, Wolff K, Austen KF, Goldsmith LA, Katz SI. Aging of skin. In: Gilchrest BA, Blog FB, Szabo G (eds.). Fitzpatrick s Dermatology in General Medicine. 5th ed. New York: Mcgraw Hill; 1999. p. 1341-1348. 17. Fisher GJ, Kang S, Varani J, Bata-Csorgo Z, Wan Y, Datta S, Voorhees JJ. Mechanisms of photoaging and chronological skin aging. Arch Dermatol 2002;138:1462-1470. 18. Yang ES, Hong RH, Kang SM. The effect of genistein on the proliferation and type I pn collagen synthesis in aged normal human fibroblasts. J Kor Soc Microbiol Biotechnol 2007;35:316-324. 19. Lee JH, Lee BS, Yang MS, Byun BS, Kim WG, Kim BH, Lee SJ. Prevention of photoaging and
46 In-Soon Bae et al. wrinkle formation in hairless mice dorsal skin by APB-03. J Kor Soc Food Sci Technol 2005;37(6): 989-996. 20. Sternlicht M, Lochter A, Sympson CJ. The stromal proteinase MMP3/storelysin-1 promotes mammary carcinogenesis. Cell 1999;98:137-146. 21. MacNaul KL, Chartrain N, Lark M, Tocci MJ, Hutchinson NI. Discoordinate expression of stromelysin, collagenase, and tissue inhibitor of metalloproteinases-1 in rheumatoid human synovial fibroblast. Synergistic effects of interleukin-1 and tumor necrosis factoralpha on stromelysin expression. J Biol Chem 1990;265:17238-17245.