식물병연구 Note Open Access Res. Plant Dis. 24(1): 81-85 (2018) https://doi.org/10.5423/rpd.2018.24.1.81 3 Detection and Identification of a Mixed Infection of Three Viruses in Chinese Artichoke in Korea * *Corresponding author Tel: +82-33-250-6437 Fax: +82-33-259-5558 E-mail: jinsunghong@kangwon.ac.kr Eun-Kyoung Kim, Jae-Won You, Ji-Soo Park, Dong-Joo Min, Suk-Hyun Park, and Jin-Sung Hong* Department of Applied Biology, Kangwon National University, Chuncheon 24341, Korea Received November 3, 2017 Revised November 30, 2017 Accepted December 4, 2017 Chinese artichoke (Stachys sieboldii Miq.) belongs to herbaceous perennial plants of Labiatea and is cultivated as edible and medicinal crops in China, Japan and Korea. A Chinese artichoke plant showing virus-like symptoms was collected in Chungju, Korea. Plant sap of the sample was inoculated in Nicotiana tabacum cv. Xanthi-nc, Chenopodium quinoa and Chenopodium amaranticolor. Necrotic local lesions were observed in the inoculated leaves of N. tabacum cv. Xanthi-nc and C. amaranticolor, C. quinoa with systemic chlorotic spots and mosaic symptoms on the upper leaves. The disease reactions on indicator plants suggested that the collected Chinese artichoke sample was mixed-infected with different viruses. We detected three viruses by RT- PCR analysis using genus- and species-specific primer sets for Alfalfa mosaic virus (AMV), Cucumber mosaic virus (CMV) and Tobacco mosaic virus (TMV). This study is the first report of a mixed infection of three viruses in Chinese artichoke in Korea. Keywords: Alfalfa mosaic virus, Chinese artichoke, RT-PCR, Cucumber mosaic virus, Tobacco mosaic virus Alfalfa mosaic virus (AMV) Bromoviridae, Alfamovirus,. (Mueller Grau, 2007; Hiruki Hampton, 1990). Cucumber mosaic virus (CMV) Bromoviridae, Cucumovirus, 100 1,200 subgroup IA, subgroup IB subgroup II (Choi, 1990; Douine, 1979; Kaper Waterworth, 1981; Research in Plant Disease pissn 1598-2262, eissn 2233-9191 www.online-rpd.org Owen Palukaitis, 1998; Palukaitis Garcia-Arenal, 2003). CMV 75 (Francki, 1979). 5 (2007 2011 ), CMV (Kim, 2012). Tobacco mosaic virus (TMV) Virgaviridae, Tobamovirus.,, (Broadbent, 1965; Hollings Huttinga, 1976; Taylor, 1961). (Stachys sieboldii Miq.) (Labiatea),,. The Korean Society of Plant Pathology This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/ by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
82 Research in Plant Disease Vol. 24 No. 1 복용하면 간경화, 지방간, 뇌경색, 동맥경화, 노인성 치매의 예방 모자이크바이러스(Alfalfa mosaic virus, AMV)가 초석잠에 감염하는 및 치료, 기억력 증진에 효과가 있는 것으로 알려져 있다(Back 등, 것으로 보고되어 있다(Lirong 등, 1986; Fuji 등, 2003). 본 연구에서 2004). 국내에는 중국과 일본에서 유입된 품종이 자생하고 있으며 는 최근(2016-2017년) 충북 충주에서모자이크 병징을 보이는 초 최근 초석잠의 효능이 알려지면서 재배면적이 증가하고 있다. 국내 석잠에서 바이러스를 분리하여 TMV, AMV 및 CMV를 동정하였다. 에서는 현재까지 초석잠에 감염하는 바이러스가 보고되지 않았 의 경우, Potyvirus 속에 속하는 초석잠모자이크바이러스(Chinese 기주식물반응. 2016년과 2017년 충북 충주에서 바이러스 에 감염된 것으로 추정되는 초석잠을 채집하였다(Fig. 1). 모자 artichoke mosaic virus, ChAMV)와 Tobamovirus 속의 담배모자이 이크 병징을 보이는 초석잠 잎 100 mg과 0.01 M 인산완충액 크바이러스(Tobacco mosaic virus, TMV), Alfamovirus 속의 알팔파 (Phosphate buffer, ph7.2) 1 ml을 멸균한 막자사발로 마쇄하여 고, 초석잠의 바이러스병에 대한 정보 또한 부족한 실정이다. 국외 Fig. 1. Symptoms on the leaves of a Chinese artichoke plant. (A) Chinese artichoke showing mosaic symptoms. (B) Mosaic symptoms on upper leaves. The symptomatic leaf samples were collected from Chungju in 2016. Fig. 2. Symptoms on the leaves of indicator plants induced by mechanical sap-inoculation. Photographs were taken at 14 days post inoculation (dpi). Necrotic local lesions on the inoculated leaves of N. benthamiana (A), N. tabacum cv. Xanthi-nc (B), C. quinoa (C) and C. amaranticolor (D). Mosaic symptoms on the upper leaves of N. benthamiana (E) and N. tabacum cv. Xanthi-nc (F) and C. quinoa (G). C. amaranticolor was induced chlorotic spots on the upper leaves (H).
Research in Plant Disease Vol. 24 No. 1 83 Nicotiana benthamiana, N. tabacum cv. Xanthi-nc, Chenopodium quinoa, C. amaranticolor. 3 N. tabacum cv. Xanthi-nc TMV, C. amaranticolor CMV. 7 C. quinoa AMV (Fig. 2). (TMV, CMV, AMV). RT-PCR. N. benthamiana Plant RNA Prep Kit (BIO CUBE, Suwon, Korea) Total RNA. degenerate primers (Table 1). Tobamovirus Cucumovirus, Ilarvirus-degenerate primer 1a. Reverse Transcription-Polymerase Chain Reaction (RT-PCR), Potyvirus Cucumovirus, Ilarvirus, Tobamovirus positive control (Fig. 3A). PCR (Macrogen), Ilarvirus-degenerate Table 1. Primers designed for RT-PCR amplification of different four viruses Genus Primer Sequence (5 3 ) * Expected size (bp) References Cucumovirus Cucumo-F ASYTTTDRGGTTCAATTCC Cucumo-R GACTGACCATTTTAGCCG 950 Choi et al. (1999) CMV CP-F ATGGACAAATCTGAATCAACCAG CMV-R TGGTCTCCTTTGGAAGCCC 970 ** Ilarvirus Ilar-F GCNGGWTGYGGDAARWCNAC Ilar-R AMDGGWAYYTGYTYNGTRTCACC 306 Untiveros et al. (2010) Alfamovirus AMV-F ATGAGTTCTTCACAAAAGAAAGC AMV-R TCAATGACGATCAAGATCGTC 655 ** Potyvirus Poty-F GTITGYGTIGAYGAYTTYAAYAA Poty-R TCIACIACIGTIGAIGGYTGICC 350 Zheng et al. (2010) Tobamovirus Tobamo-F GTYGTTGATGAGTTCRTGGA Tobamo-R ATTTAAGTGGASGGAAAAICACT 800 Letschert et al. (2002) TMV-F ATGTCTTACAGTATCACTACTC TMV-R TCAAGTTGCAGGACCAGAG 480 ** Internal control Nb-Actin-F ATCGGAATGGAAGCTGCTG Nb-Actin-R GTACCACCACTGAGGACAATG 110 ** * I: Inosine, Y: C/T, R: A/G, D: G/A/T, M: A/C, N: A/C/G/T, W: A/T, K: T/G. Designed in this study. Fig. 3. Agarose gel electrophoresis analysis of the PCR products obtained using degenerate primers (A) and specific primers (B). (A) M: 100 bp, Lane 1: Cucumovirus (950 bp), Lane 2: Ilarvirus (390 bp), Lane 3: Potyvirus (700 bp), Lane4: Tobamovirus (800 bp), Lane 5: Healthy, N: Negative control, P: Positive control. (B) M: 100 bp, Lane 1: CMV (1,050 bp), Lane 2: AMV-CP (670 bp), Lane 3: TMV-CP (480 bp), Lane 4: healthy, N: negative control, P: positive control.
84 Research in Plant Disease Vol. 24 No. 1 primer, AMV. Alfamovirus Ilarvirus Bromoviridae AMV 1a. specific primer RT-PCR, 3 (CMV, AMV, TMV) (Table 1, Fig. 3B). 3 CMV-Cha, AMV-Cha TMV-Cha.. (NCBI) BLAST, TMV-Cha Zehenfeng (HE818459) 97%, AMV-Cha Joe Davis (HQ185569) 99%. CMV-Cha RP20 (KC527749) 98%. CMV, AMV TMV, CMV-Cha, (Fig. 4). TMV AMV CMV.. Fig. 4. Phylogenetic analysis of each coat protein gene of CMV (A), AMV (B) and TMV (C) isolated from Chinese artichoke. The phylogenetic tree was reconstructed by the maximum likelihoods test using Mega 7 program with 1,000 bootstrap replication. The number at each branch shows bootstrap value. GenBank accession numbers; Fny (D10538), Mf (AJ27648), Y (D12499), Nt9 (D28780), SD (AB008777), Tfn (Y16926), LS (AF127976), Q (M21464), S (U37227), PSV (JN135292), 425 Madison (K02703), KR2 (AF294433), Lst (FN667967), 195AN (AJ130705), Ca616 (DQ314756), Lyh1 (AJ130709), Dac16 (AJ130708), Ca616 (DQ314756), VRU (AF015716), TSV (AF400664), TMV-152 (AF395129), Bacgiang (AM412008), K3 (AJ310339), YN (AJ239099), LCGM (KC572633), KMAN (KC572627), TOM (AF103779), SD1 (DQ014551), THN1 (LN651240), PMMoV (KY288633). 2016. 2., RT-PCR 3 (AMV, CMV, TMV). 3 CMV. Conflicts of Interest No potential conflict of interest relevant to this article was reported.
Research in Plant Disease Vol. 24 No. 1 85 Acknowledgement This study was carried out with the support of Cooperative Research Program for Agricultural Science & Technology Development (Project No. PJ012266012017) in Rural Development Administration, Republic of Korea and 2016 Research Grant from Kangwon National University. References Back, H. S., Na, Y. S., Kim, D. H., Lee, C. H., Lyu, B. H. and Song, S. K. 2004. Antioxidant activities of Stachys sieboldii MIQ roots. J. Life Sci. 14: 1-7. Broadbent, L. 1965. The epidemiology of tomato mosaic. Ann. Appl. Biol. 56: 177-205. Choi, J. K., Kwon, S. B., Lee, S. Y. and Park, W. M. 1990. Some properties of two isolates of Cucumber mosaic virus isolated from Aster yomena Makino and Commelina communis L. Korean J. Plant Pathol. 6: 138-143. Choi, S. K., Choi, J. K., Park, W. M. and Ryu, K. H. 1999. RT-PCR detection and identification of three species of cucumoviruses with a genus-specific single pair of primers. J. Virol. Methods 83: 67-73. Douine, L., Quiot, J. B., Marchoux, G. and Archange, P. 1979. Recensement des espèces végétales sensibles au Virus de la Mosaïque du Concombre (CMV) Etude bibliographique. Ann. Phytopathol. 11: 439-475. Francki, R. I. B., Mossop, D. W. and Hatta, T. 1979. Cucumber mosaic virus. In: CMI/AAB Descriptions of Plant Viruses, 213 pp. Fuji, S., Yamamoto, H., Furuya, H. and Naito, H. 2003. Characterization of a new potyvirus isolated from Chinese artichoke in Japan. Arch. Virol. 148: 2249-2255. Hollings, M. and Huttinga, H. 1976. Tomato mosaic virus. In: CMI/ AAB Descriptions of plant viruses, 156 pp. Hiruki, C. and Hampton, R. O. 1990. Diseases caused by viruses and viruses infectious to alfalfa. In: Compendium of Alfalfa Diseases, pp. 51-58. American Phytopathological Society. Kaper, J. M. and Waterworth, H. E. 1981. Cucummoviruses. In: Handbook of Plant Virus Infections: Comparative Diagnosis. Kim, J. S., Lee, S. H., Choi, H. S., Kim, M. K., Kwak, H. R., Kim, J. S. and Choi, G. S. 2012. 2007-2011 characteristics of plant virus infections on crop samples submitted from agricultural places. Res. Plant Dis. 18: 277-289. (In Korean) Letschert, B., Adam, G., Lesemann, D. E., Willingmann, P. and Heinze, C. 2002. Detection and differentiation of serologically crossreacting tobamoviruses of economical importance by RT-PCR and RT-PCR-RFLP. J. Virol. Methods 106: 1-10. Lirong, C. M. Z. G. J. and Jiyan, Q. 1986. Meristem-tip culture and value of application of virus-free clone in Chinese artichoke. Acta Agric. Bor. Sin., 2: 15-22. Mueller, E. E. and Grau, C. R. 2007. Seasonal progression, symptom development, and yield effects of Alfalfa mosaic virus epidemics on soybean in Wisconsin. Plant Dis. 91: 266-272. Owen, J. and Palukaitis, P. 1988. Characterization of Cucumber mosaic virus I. Molecular heterogeneity mapping of RNA 3 in eight CMV strains. Virology 166: 495-502. Palukaitis, P. and García-Arenal, F. 2003. Cucumoviruses. Adv. Virus Res. 62: 241-323. Taylor, R. H., Grogan, R. G. and Kimble, K. A. 1961. Transmission of tobacco mosaic viras in tomato seed. Phytopathology 51: 837-42. Untiveros, M., Perez-Egusquiza, Z. and Clover, G. 2010. PCR assays for the detection of members of the genus Ilarvirus and family Bromoviridae. J. Virol. Methods 165: 97-104. Zheng, L., Rodoni, B. C., Gibbs, M. J. and Gibbs, A. J. 2010. A novel pair of universal primers for the detection of potyviruses. Plant Pathol. 59: 211-220.