J Plant Biotechnol (2016) 43:391 396 DOI:http://dx.doi.org/10.5010/JPB.2016.43.3.391 ISSN 1229-2818 (Print) ISSN 2384-1397 (Online) Research Article 항바이러스제처리와경정배양에의한배 (Pyrus pyrifolia L.) 만수 의 Apple stem grooving virus 무병화 조강희 신주희 김대현 박서준 김세희 천재안 김미영 한점화 이한찬 Elimination of Apple stem grooving virus from Mansoo pear (Pyrus pyrifolia L.) by an antiviral agent combined with shoot tip culture Kang Hee Cho Juhee Shin Dae-Hyun Kim Seo Jun Park Se Hee Kim Jae An Chun Mi Young Kim Jeom Hwa Han Han Chan Lee Received: 2 May 2016 / Revised: 7 June 2016 / Accepted: 7 June 2016 c Korean Society for Plant Biotechnology Abstract In this study, in vitro-cultured Mansoo pear (Pyrus pyrifolia L.) plants infected with Apple stem grooving virus (ASGV) were used for testing the efficiency of the virus elimination methods. The shoot tips cut from infected plants were treated by thermotherapy (37 C), cold therapy (4 C), chemotherapy with ribavirin, and combination of these methods. Treatment periods were 2, 4, and 8 weeks, and concentrations of ribavirin were 20 and 40 mg L -1. The efficiency of ASGV elimination was evaluated by reverse transcription polymerase chain reaction. The shoot survival rate was the highest at 100% after cold therapy, chemotherapy, and combination of two methods, while the rate was the lowest at 33.3% after thermotherapy for 2 weeks. The shoot survival rate after chemotherapy decreased gradually as the treatment period was prolonged. The ASGV elimination rate was the highest at 100% after ribavirin treatment at a concentration of 40 mg L -1 and combination of ribavirin treatment and thermotherapy for 2 weeks, whereas the ASGV elimination rate after cold therapy was the lowest at 16.7%. However, the efficiency of ASGV elimination was enhanced up to 43.3% by the combination of cold therapy and ribavirin treatment. The efficiency of ASGV elimination for all treatments was increased as the treatment period was K. H. Cho ( ) J. H. Shin D.-H. Kim S. J. Park S. H. Kim J. A. Chun M. Y. Kim J. H. Han H. C. Lee 농촌진흥청국립원예특작과학원과수과 (Fruit Research Division, National Institute of Horticultural and Herbal Science, Rural Development Administration, Wanju 55365, Korea) e-mail: khc7027@korea.kr prolonged. Based on these results, we suggest that ribavirin treatment at a concentration of 20 mg L -1 for 4 weeks or at a concentration of 40 mg L -1 for 2 weeks combined with shoot tip culture was efficient for the elimination of ASGV from pear. Keywords Shoot tip, Thermotherapy, Cold therapy, Chemotherapy, Elimination 서언 배 (Pyrus pyrifolia L.) 는우리나라의신선농산물수출 2 위작목으로농업생산에서중요한원예작물로알려져있다 (MAFRA 2015). 배에서주로발생하는대표적인바이러스는 Apple chlorotic leaf spot virus (ACLSV), Apple stem grooving virus (ASGV), Apple stem pitting virus (ASPV) 가있다 (Cho et al. 2010; Wang et al. 2010). 이중국내배재배단지에서는 ASGV 의발생률이가장높으며 ASPV 는 2010 년에국내에서처음발생이보고되었다 (Cho et al. 2010). 이러한바이러스에감염된배나무는생장과과실품질이저하되고생산량이감소된다 (Desvignes and Boye 1989). 특히 ASPV 와 ACLSV 가감염된식물체와달리 ASGV 가감염된 신고 의잎에서는부정형의검은점증상이나타나피해가큰것으로관찰되었다 (Cho et al. 2010). 바이러스는주로접목에의해전염이되며감염된식물체는소각외에는다른방제대책이없기때문에무병묘생산시스템의개발이중요하다 (Lee et al. 2013). 따라서과수에서바이러스를제거하기위한무병화연구는다양한방법으로수행되었다. This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
392 J Plant Biotechnol (2016) 43:391 396 바이러스를무병화하는방법은 37 C 로일정기간처리하는열처리요법 (thermotherapy), 4 C 로일정기간처리하는한냉요법 (cold therapy), ribavirin 과같은항바이러스제를처리하는화학적요법 (chemotherapy) 등이있다 (El-Dougdoug et al. 2010; Paprstein et al. 2008; Wang et al. 2006). 경정배양과열처리는사과 (Lee et al. 2013; Paprstein et al. 2008), 배 (Tan et al. 2010; Zilka et al. 2002), 복숭아 (Gella and Errea 1998), 포도 (Maliogka et al. 2009) 등의바이러스를제거하는데효과적으로사용되어왔다. Tan et al. (2010) 은 ACLSV, ASGV, ASPV 가감염된배 Fengshui 의식물체를주간 42 C, 야간 34 C 에서 55 일이상의열처리와경정배양을통해바이러스가제거되는것을확인하였다. 열처리에의해경정조직에서바이러스가제거되는기작은고온에서바이러스의복제또는이동이저해되고식물체의생장속도가빨라그결과생정점부위로부터바이러스가제거되는것으로알려져있다 (Cooper and Walkey 1978). 또한고온처리에의해 RNA 의 silencing 이증가되고경정조직에서바이러스 RNA 가분해되는되는것이확인되었다 (Chellappan et al. 2005; Wang et al. 2008). El-Dougdoug et al. (2010) 은 Hop stunt viroid (HSVd) 에감염된복숭아 Florida prince 와배 Balady 를이용하여한냉처리와항바이러스제처리를통해 40% 의무병화개체를획득하였다. 이러한바이러스제거효율은바이러스와기주식물체의종류와복합감염된바이러스의조합에따라달라진다고보고되었다 (Knapp et al. 1995). 본연구에서는 ASGV 감염이확인된배기내식물체를이용하여열처리, 한냉처리및항바이러스제단독및복합처리를통하여효율적인 ASGV 무병화방법을찾고자하였다. 재료및방법 시험재료 배바이러스무병화효율실험을위하여국립원예특작과학원에보존중인배 만수 의기내배양묘신초부위의잎을 채취하여실험에이용하였다. RNA 추출및 reverse transcription polymerase chain reaction (RT-PCR) 을이용한바이러스진단 바이러스를진단하기위하여배 만수 의신초를이용하여 Cetyl trimethyl ammonium bromide 방법을통해 total RNA 를추출하였다 (Gambino et al. 2008). 확보된 total RNA 는 M-MLV reverse transcriptase (Invitrogen, Carlsbad, CA, USA) 와 random hexamer 프라이머를이용하여 cdna 를합성하였으며, 바이러스특이프라이머 (Table 1) 를이용하여 PCR 을수행하였다. 진단바이러스와바이로이드종류는 ACLSV, ASGV, Apple scar skin viroid (ASSVd) 의 3 종이었다. PCR 조건은총 20 μl 의반응액에 cdna 50 ng, 1 PCR buffer, 250 μm dntps, 1.5 units Ex Taq DNA polymerase (TaKaRa, Tokyo, Japan) 를혼합하였다. PCR 반응조건은 94 C 에서 5 분간초기변성시키고, 94 C 에서 40 초, 60 C 에서 40 초, 72 C 에서 40 초씩 35 회반복하였다. 마지막으로 5 분간처리후반응을종료하였다. 또한 18S ribosomal RNA 를함께증폭시켜 RT-PCR 반응이제대로이루어졌는지확인하기위한대조구로이용하였다. 바이러스감염식물체의기내증식 바이러스감염이확인된배기내식물체를증식하기위하여증식배지에치상하였다. 사용한증식배지의조성은 Murashige & Skoog (MS) 배지 4.4 g L -1, 6-benzylaminpurin 1.0 mg L -1, 3-indole-butyric acid 0.1 mg L -1, sucrose 30 g L -1, plant agar 8 g L -1 였으며 ph 5.8 로조정하였다. 증식배지에치상한식물체는 3 주마다계대배양을실시하여실험재료를확보하였다. 무병화처리 RT-PCR 을통해바이러스감염이확인된배 만수 의기내식물체를이용하여열처리, 한냉처리및항바이러스제처 Table 1 RT-PCR primer pairs used for the detection of pear-infecting viruses and viroid infected pear plants Target Apple chlorotic leaf spot virus Apple stem grooving virus Apple scar skin viroid 18S ribosomal RNA Primer sequence (5' 3') F: TTCATGGAAAGACAGGGGCAA R: AAGTCTACAGGCTATTTATTATAAGTCTAA F: ATGAGTTTGGAAGACGTGCTTCAA R: CTAACCCTCCAGTTCCAAGTTACT F: CCCGGTAAACACCGTGCGGT R: ACCGCGAAACACCTATTGTG F: CGCATCATTCAAATTTCTGC R: TTCAGCCTTGCGACCATACT PCR product size (bp) Original accession No. 677 KC935956 699 JX885581 331 JX860405 843 DQ341382
J Plant Biotechnol (2016) 43:391 396 393 리를통하여무병화효율실험을수행하였다. 각처리별 30 개의배양된배신초를확보하였고약 5 mm 크기로잘라실험에이용하였다. 열처리와한냉처리는각각 37 C 와 4 C 가유지되는항온항습장치에서처리하였으며항바이러스제처리그룹은 ribavirin (1-B-D-ribofuransyl-1,2,4-triazole caboxamide, Virazole) 을배지에 20 mg L -1 과 40 mg L -1 의농도로첨가하여 25 C 에서처리하였다. 또한열처리와항바이러스제를복합적으로처리한그룹과한냉처리와항바이러스제를복합처리한그룹으로나누어처리하였다. 처리기간은 2 주, 4 주및 8 주였으며처리후경정배양을통해자란식물체는 RT-PCR 를이용하여무병화여부를확인하였다. 통계처리는 SAS 프로그램 (SAS 9.2, SAS Institute Inc., NC, USA) 을이용하였으며 Duncan 의다중검정 (p < 0.05) 으로평균치간의차이에대한유의성을검정하였다. 결과및고찰 배 만수 의기내식물체를이용하여 RT-PCR 로 ACLSV, ASGV, ASSVd 를진단한결과 ASGV 의감염이확인된식물체를확보할수있었다 (Fig. 1A). 무병화효율실험을위한재료를확보하기위하여 ASGV 가감염된기내식물체를증식하였고 (Fig. 1B), 증식된식물체의 ASGV 를진단하여감염 여부를재확인하였다 (Fig. 1C). 증식된식물체를이용하여열처리, 한냉처리, 항바이러스제를단독또는복합처리하여신초생존율과바이러스제거율을조사하였다 (Fig. 2). 처리에따른신초생존율은 37 C 열처리의경우 2 주간처리그룹에서 33.3% 였고, 4 주및 8 주간처리그룹에서는 3.3% 와 0% 으로낮아졌다 (Table 2). 이와같이열처리에의한바이러스제거방법의가장큰문제는본실험에서같이식물체의낮은생존율이다 (Hu et al. 2012; Lee et al. 2013). 고온이거나처리기간이길어지면바이러스의불활성화율은높아지지만식물체가분화되는비율은현저하게저하된다. Lee et al. (2013) 은사과 썸머드림 등 4 품종의바이러스무병묘를생산하기위해열처리와경정배양을통한기내도입과정중신초생존율은 25.0 ~ 41.7% 로낮았음을보고하였다. 따라서신초생존율을높이기위해비교적낮은온도인 35 C 에서열처리하는방법도보고되었다 (Hu et al. 2012). 경정배양을하기전에낮은온도에서처리하는것은바이러스를제거하는방법중의하나로알려져있다 (Paduch-Cichal and Kryczyński 1987). 4 C 에서 2 개월처리한 HSVd 에감염된배의신초생존율이 31.0% 였다는 El-Dougdoug et al. (2010) 의연구결과와달리본실험의한냉처리에서는 2 ~8 주의처리기간모두 100% 의높은생존율을나타내었다. 항바이러스제인 ribavirin 을 20 mg L -1 농도로 2 주및 4 주간처리한그룹에서는 100% 의생존율을보였지만 8 주간처리한그룹에서 Fig. 1 Preparation of plant materials for the elimination test of Apple stem grooving virus (ASGV). (A) RT-PCR products amplified from in vitro Mansoo pear plants using 18S ribosomal RNA and ASGV specific primers. M, 100 bp DNA plus ladder; N, negative control; P, positive control; 1-7, In vitro Mansoo pear plants. (B) In vitro propagation of Mansoo pear infected with ASGV. (C) Results for the detection of ASGV in in vitro propagated plants by RT-PCR
394 J Plant Biotechnol (2016) 43:391 396 Fig. 2 Comparison of in vitro pear plants treated by thermotherapy, cold therapy, and chemotherapy. A, Two week treated in vitro plants; B, Four week treated in vitro plants; C, Eight week treated in vitro plants Table 2 Shoot survival rate in pear shoots after being subjected to in vitro thermotherapy, cold therapy, and chemotherapy Treatment 2 weeks Shoot survival rate (%) 4 weeks 8 weeks 37 C 33.3 (10/30) a c b 3.3 (1/30) c 0.0 (0/30) d 4 C 100.0 (30/30) a 100.0 (30/30) a 100.0 (30/30) a Ribavirin 20 mg L -1 100.0 (30/30) a 100.0 (30/30) a 30.0 (9/30) b 40 mg L -1 100.0 (30/30) a 96.7 (29/30) b 20.0 (6/30) c 37 C + Ribavirin 20 mg L -1 46.7 (14/30) b 0.0 (0/30) d 0.0 (0/30) d 40 mg L -1 36.7 (11/30) c 0.0 (0/30) d 0.0 (0/30) d 4 C + Ribavirin 20 mg L -1 100.0 (30/30) a 100.0 (30/30) a 100.0 (30/30) a 40 mg L -1 100.0 (30/30) a 100.0 (30/30) a 100.0 (30/30) a a The number in parentheses refers to the number of surviving shoots/the number of treated shoots b Different letters within each column indicate significant differences based on Duncan s multiple range test at p < 0.05 는 30.0% 로급격히낮아졌다. 또한 ribavirin 을 40 mg L -1 농도로처리한그룹에서는신초생존율이처리기간에따라 100%, 96.7% 및 20.0% 로점차낮아져항바이러스제처리기간은 4 주까지가적당한것으로판단되었다. 이는 Kim et al. (2015) 의결과와도유사하여 Persimmon viroid 와 Citrus viroid 가감염된감을이용한무병화효율연구에서항바이러스제처리가신초생존율이가장높은것으로보고하였다. 열처리와항바이러스제의복합처리인경우 ribavirin 을 20 mg L -1 농도로 2 주간처리한그룹에서는 46.7%, 40 mg L -1 농도로처리한그룹에서는 36.7% 의낮은생존율을나타냈고, 4 주및 8 주간처리한그룹에서는생존한개체가없었다. 이와달리한냉처리와항바이러스제복합처리에서는처리기간에상관없이모두 100% 의생존율을나타내었다. ASGV 제거효율에있어서는단독처리인경우열처리의바이러스제거율은 2 주및 4 주간처리한그룹에서는 80.0% 와 100% 였지만생존율이매우낮아 4 주간열처리를통하여확보된무병화개체수는 1 개체로다른처리에비해가장적 었다. 열처리에의한바이러스제거효율은감염된식물체의바이러스농도와도관련이있으며바이러스제거가어려운품종도있고, 단독감염보다여러종류의바이러스가복합감염된경우에바이러스제거가더어려운것으로알려져있다 (Knapp et al. 1995; Paprstein et al. 2008). 한냉처리를 2 주간처리한그룹에서는 16.7%, 4 주및 8 주간처리한그룹에서는 66.7% 의 ASGV 제거율을나타내었다 (Table 3). 경정배양전의한냉처리는고온에저항성바이로이드인 Chrysanthemum stunt viroid, Hop latent viroid 등을제거하는효과적인방법으로보고되었다 (El-Dougdoug et al. 2010). Ribavirin 을 20 mg L -1 와 40 mg L -1 으로 2 주간처리하였을때바이러스제거율은각각 80% 와 100% 였고 4 주및 8 주간처리그룹에서는모두 100% 의바이러스제거율을나타내었다. 식물에있어서열처리와달리항바이러스제처리를이용한바이러스제거기작은명확히알려져있지않지만핵산과 RNA polymerase 의합성을저해하여바이러스복제를억제하는것으로보고되었다 (Hansen 1989; Verma et al. 2005). 복합처리의경우
J Plant Biotechnol (2016) 43:391 396 395 Table 3 Effect of in vitro treatments on inactivation of Apple stem grooving virus in pear Treatment 2 weeks Apple stem grooving virus inactivation efficiency (%) 4 weeks 8 weeks 37 C 80.0 (8/10) a b b 100.0 (1/1) a NT c 4 C 16.7 (5/30) d 66.7 (20/30) c 66.7 (20/30) b Ribavirin 37 C + Ribavirin 20 mg L -1 80.0 (24/30) b 100.0 (30/30) a 100.0 (9/9) a 40 mg L -1 100.0 (30/30) a 100.0 (29/29) a 100.0 (6/6) a 20 mg L -1 92.9 (13/14) a NT NT 40 mg L -1 100.0 (11/11) a NT NT 20 mg L -1 43.3 (13/30) c 93.3 (28/30) b 100.0 (30/30) a 4 C + Ribavirin 40 mg L -1 83.3 (25/30) b 100.0 (30/30) a 100.0 (30/30) a a The number in parentheses refers to the number of virus free shoots/number of surviving shoots b Different letters within each column indicate significant differences based on Duncan s multiple range test at p < 0.05 c NT: Not tested 열처리와 ribavirin 2 주간처리에서는 ribavirin 을 20 mg L -1 농도로처리한그룹에서는 92.9%, 40 mg L -1 에서는 100% 의바이러스제거율을나타내었다. 한냉처리와 ribavirin 복합처리에서는 ribavirin 농도를 20 mg L -1 하여 2 주간처리한그룹에서는바이러스제거율이 43.3%, 4 주및 8 주간처리한그룹에서는 93.3% 와 100% 로처리기간이길수록바이러스제거율이높았고 40 mg L -1 농도로 2 주간처리한그룹에서의바이러스제거율은 83.3% 였다. 이는최종적으로획득한무병화개체가 30 개체중 25 개체로 ribavirin 단독처리에비해바이러스제거율이낮았다. Cieślińska (2002) 는 ACLSV 가감염된배 Pierre Corneille (Pyrus communis L.) 의기내식물체를이용하여열처리 (36 C) 와 ribavirin 처리를통하여바이러스를제거하고자하였다. 항바이러스제처리효과는 ribavirin 의농도에따라달라지는데 100 mg L -1 의고농도에서는 77% 의신초가식물독성을나타내었고고온과함께처리하면대부분의신초가고사되었다. Ribavirin 25 mg L -1 와 50 mg L -1 의농도로처리된신초는 enzyme-linked immunosorbent assay 를통해각신초의 78% 와 88% 에서 ACLSV 가검출되지않은것을확인하였다. 또한열처리와항바이러스제복합처리가항바이러스제단독처리보다더좋은결과를나타내지는않았다고보고하여본실험에서얻은결과와유사하였다. 이와달리 Hu et al. (2012) 은 ACLSV 와 ASGV 가감염된배 Jinshui (Pyrus pyrifolia L.) 의기내식물체에열처리와항바이러스제를복합처리하였을때단독처리보다 ACLSV 와 ASGV 의제거효율이높았다. 특히 36 C 에서 40 일간열처리와 25 mg L -1 농도의 ribavirin 복합처리후생장점배양을통해바이러스가 100% 제거되어가장높은효율을나타내었다. 또한 10-25 mg L -1 농도의 ribavirin 처리는유의하게기내배식물체의증식을향상시켰다. 이와같이항바이러스제는바이러스제거에효과적이지만고농도에서는식물체에식물독성과같은약해를줄수있다. 식물독성의증상으로 는식물체의엽록소분해, 선단괴사및재생이저해되는것으로알려져있으나배양후 15 일부터는그영향이없어지는것으로보고되었다 (El-Dougdoug et al. 2010). 본실험에서도 ribavirin 처리배지에서는시간이지날수록신초엽이연한녹색을띄었지만증식배지에옮겨주면엽색이진한녹색으로되는것을관찰할수있었다 ( 자료미제시 ). Knapp et al. (1995) 은 immune tissue-printing 방법을이용하여 ACLSV 가감염된기내사과품종들의 ACLSV 분포를살펴보았는데 ACLSV 의축적은줄기기저부분에서가장많고신초선단으로갈수록감소하는것을확인할수있었다. 바이러스감염정도는줄기횡단면내에서의바이러스의분포뿐만아니라생장점으로바이러스가확산되는것에영향을주었고, 경미하게바이러스에감염된신초의생장점조직에서는바이러스가전혀관찰되지않았다. 바이러스무병화에는열처리등다양한기술이이용되지만단독처리로는감염된바이러스를완전히불활성화시킬수없는것이많기때문에경정배양과함께병행하고있다. 결론적으로본실험에서는경정배양과더불어항바이러스제인 ribavirin 을 20 mg L -1 농도로 4 주간처리하거나 40 mg L -1 농도로 2 주간단독처리만으로도효과적으로배 ASGV 를제거할수있을것으로판단할수있었다. 그러나실험대상바이러스가 ASGV 1 종으로제한적이어서 ACLSV, ASPV 등다른바이러스가단독또는복합감염된식물체를이용하여정밀한추가적인연구가수행되어야할것으로생각한다. 적요 본연구는 Apple stem grooving virus (ASGV) 에감염된배 (Pyrus pyrifolia L.) 만수 의기내배양식물체를이용하여효과적
396 J Plant Biotechnol (2016) 43:391 396 인배바이러스무병화기술을알아보고자수행하였다. 식물체의경정조직을잘라열처리 (37 C), 한냉처리 (4 C), 항바이러스제인 ribavirin 을단독또는복합처리하였다. 처리기간은 2, 4, 8 주였으며 ribavirin 농도는 20 과 40 mg L -1 이었다. 바이러스제거율은 Reverse transcription polymerase chain reaction 분석으로확인하였다. 신초생존율은 2 주간한냉처리, 항바이러스제단독처리와한냉처리와항바이러스제가복합처리된그룹에서 100% 로높았고열처리에서 33.3% 로가장낮았다. 단독으로 ribavirin 을처리한그룹은처리기간이길수록신초생존율이감소하는경향이었다. ASGV 제거율은 2 주간 ribavirin 40 mg L -1 농도로처리한그룹과열처리와 ribavirin 을복합처리한그룹에서 100% 로높았다. 한냉처리한그룹의바이러스제거율은 16.7% 로가장낮았으나한냉처리와 ribavirin 을복합처리한그룹에서는 43.3% 로향상되었다. 모든처리에서처리기간이길수록바이러스제거율은증가하였다. 본실험을통해배 ASGV 제거에는경정배양과더불어항바이러스제인 ribavirin 을 20 mg L -1 농도로 4 주간처리하거나 40 mg L -1 농도로 2 주간단독처리만으로도효과적으로무병화가가능할것으로판단되었다. 사사 본논문은농촌진흥청연구사업 ( 세부과제번호 : PJ01022805) 의지원에의해이루어진것임. References Chellappan P, Vanitharani R, Ogbe F, Fauquet CM (2005) Effect of temperature on geminivirus-induced RNA silencing in plants. Plant Physiol 138:1828-1841 Cho IS, Kim DH, Kim HR, Chung BN, Cho JD, Choi GS (2010) Occurrence of pome fruit viruses on pear trees (Pyrus pyrifolia) in Korea. Res Plant Dis 16:326-330 Cieślińska M (2002) Elimination of Apple chlorotic leaf spot virus (ACLSV) from pear by in vitro thermotherapy and chemotherapy. Acta Hortic 596:481-484 Cooper VC, Walkey DGA (1978) Thermal inactivation of Cherry leaf roll virus in tissue cultures of Nicotiana rustica raised from seeds and meristem tips. Ann Appl Biol 88:273-278 Desvignes JC, Boye R (1989) Different diseases caused by the Chlorotic leaf spot virus on the fruit trees. Acta Hortic 235:31-38 El-Dougdoug KA, Osman ME, Abdelkader HS, Dawoud RA, Elbaz RM (2010) Elimination of Hop stunt viroid (HSVd) from infected peach and pear plants. Aust J Basic Appl Sci 4:54-60 Gambino G, Perrone I, Gribaudo I (2008) A rapid and effective method for RNA extraction from different tissues of grapevine and other woody plants. Phytochem Anal 19:520-525 Gella R, Errea P (1998) Application of in vitro therapy for ilarvirus elimination in three Prunus species. J Phytopathol 146:445-449 Hansen AJ (1989) Antiviral chemicals for plant disease control. Crit Rev Plant Sci 8:45-88 Hu GJ, Hong N, Wang LP, Hu HJ, Wang GP (2012) Efficacy of virus elimination from in vitro-cultured sand pear (Pyrus pyrifolia) by chemotherapy combined with thermotherapy. Crop Prot 37:20-25 Kim DH, Kim IS, Lee G, Cho IS, Cho KH, Shin IS, Kim SH, Chun JA, Choi IM (2015) Current occurrence of Persimmon viroid and Citrus viroid in persimmon in JellaNam-do and testing for viroid inactivation methods. J Plant Biotechnol 42:43-48 Knapp E, Hanzer V, Weiss H, da Câmara Machado A, Wang Q, Weiss B, Katinger H, Laimer da Câmara Machado M (1995) Distribution of Apple chlorotic leaf spot virus in apple shoots cultivated in vitro. Acta Hortic 386:187-194 Lee G, Kim JH, Kim HR, Shin IS, Cho KH, Kim SH, Shin J, Kim DH (2013) Production system of virus-free apple plants using heat treatment and shoot tip culture. Res Plant Dis 19:288-293 Maliogka VI, Skiada FG, Eleftheriou EP, Katis NI (2009) Elimination of a new ampelovirus (GLRaV-Pr) and Grapevine rupestris stem pitting associated virus (GRSPaV) from two Vitis vinifera cultivars combining in vitro thermotherapy with shoot tip culture. Sci Hortic 123:280-282 Ministry of Agriculture, Food and Rural Affairs (2015) Paduch-Cichal E, Kryczyński S (1987) A low temperature therapy and meristem-tip culture for eliminating four viroids from infected plants. J Phytopathol 118:341-346 Paprstein F, Sedlak J, Polak J, Svobodova L, Hassan M, Bryxiova M (2008) Results of in vitro thermotherapy of apple cultivars. Plant Cell Tiss Organ Cult 94: 347-352 Tan R, Wang L, Hong N, Wang G (2010) Enhanced efficiency of virus eradication following thermotherapy of shoot-tip cultures of pear. Plant Cell Tiss Organ Cult 101:229-235 Verma N, Ram R, Zaidi AA (2005) In vitro production of Prunus necrotic ringspot virus-free begonias through chemo-and thermotherapy. Sci Hortic 103:239-247 Wang L, Hong N, Wang GP, Xu WX, Michelutti R, Wang AM (2010) Distribution of Apple stem grooving virus and Apple chlorotic leaf spot virus in infected in vitro pear shoots. Crop Prot 29:1447-1451 Wang L, Wang G, Hong N, Tang R, Deng X (2006) Effect of thermotherapy on elimination of Apple stem grooving virus and Apple chlorotic leaf spot virus for in vitro-cultured pear shoot tips. HortScience 41:729-732 Wang QC, Cuellar WJ, Rajamäki ML, Hirata Y, Valkonen JPT (2008) Combined thermotherapy and cryotherapy for efficient virus eradication: relation of virus distribution, subcellular changes, cell survival and viral RNA degradation in shoot tips. Mol Plant Pathol 9:237-250 Zilka S, Faingersh E, Rotbaum A, Tam Y, Spiegel S, Malca N (2002) In vitro production of virus-free pear plants. Acta Hortic 596:477-479