Microsoft Word - 08-안태영

Size: px

Start display at page:

Download "Microsoft Word - 08-안태영"

연희 윤
6 years ago
Views:

1 Journal of Bacteriology and Virology Vol. 45, No. 1 p Communication Development and Verification of Nested PCR Assay for Detection of Tobacco rattle virus in Plant Quarantine Siwon Lee 1, Jin-Young Lee 2, Yong-Gil Shin 2, Su-Heon Lee 3* and Tae-Young Ahn 4 * 1 Environmental Infrastructure Research Department, National Institute of Environmental Research, Incheon; 2 Incheon International Airport Regional Office, Animal and Plant Quarantine Agency, Incheon; 3 School of Applied Biosciences, Kyungpook National University, Daegu; 4 Department of Microbiology, College of Natural Sciences, Dankook University, Cheonan, Korea Tobacco rattle virus (TRV) is a plant pathogen belonging to the Group IV positive-sense single-stranded RNA viruses. TRV causes disease in various plants (e.g., potato, tomato and tobacco), for which it was classified as a controlled quarantine virus in Korea. This study aimed to develop specific primer sets for the rapid detection of TRV. Two RT-PCR primer sets were developed for specific detection of TRV. Furthermore, nested primer sets were also developed, which is required for high sensitivity detection in plant quarantine. The RT-PCR and nested PCR products had the following sizes: set 5 (1, bp), and set 7 ( bp), respectively. In addition, a modified positive-control plasmid was also developed for use as a positive control in TRV quarantine. The diagnostic system for TRV detection was verified using samples from Korean quarantine sites for the last five years ( ). A total of 83 cases were detected among various import crops. This system for detection of TRV will continuously contribute to plant quarantine in the future. Key Words: Tobacco rattle virus, Nested PCR, Quarantine INTRODUCTION 수입개방화에따라다양한종류의식물들이국내로수입되고있으며, 이에따라잠재적또는동정되지않은병원성식물바이러스들이함께유입될가능성이높아지고있다 (1). 이들은유입시막대한경제적피해를입힐가능성을가지고있어, 수출입유통시철저한관리가필요하다 (2). 우리나라에서는위험평가를통하여, 금지, 관리, 규제-비검역, 비검역및잠정규제등으로검역바이러스를지정하고있다 (3). 이중 Tobacco rattle virus (TRV) 는 Group IV positive-sense single-stranded RNA virus에속하는바이러스로, 전체핵산은 RNA 1 ( 약 7 kb) 과 RNA2 ( 약 2~4 kb) 로약 11 kb 길이로구성되며, 폭 22 nm 길이는약 190 nm 또는 50~115 nm의막대형이다. TRV 는식물병원성바이러스로주로즙액과선충에의해전염되며감자, 토마토및담배등 400여종이상의숙주를가지며자연상태에서는가지과식물, 구근류및잡초에발생할수있는관리급검역바이러스이다. 농림축산검역본부예규제107호와식물병해충정보시스템에따르면, TRV 는수입식물에서가장많은검사를수행해야하는바이러스이며, 평균검사건수는연간 4,200 Received: December 12, 2014/ Revised: February 22, 2015/ Accepted: February 27, 2015 * Corresponding author: Su-Heon Lee. School of Applied Biosciences, Kyungpook National University, Daegu , Korea. Phone: , Fax: , suheon@knu.ac.kr * Corresponding author: Tae-Young Ahn. Department of Microbiology, College of Natural Sciences, Dankook University, Cheonan , Korea. Phone: , Fax: , ahnty@dankook.ac.kr ** The present research was conducted by the Research Fund of Animal and Plant Quarantine Agency in CC This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( 54

2 Development of TRV Nested PCR Assay 55 건이다. TRV 는전세계적으로 potato (4~6), greenhouse and field specimens (7), soil (8, 9) 등다양한시료로부터의감염보고가있으며, TRV를진단하기위한 RT-PCR (4, 6, 10), multiplex PCR (5), real-time RT-PCR (8, 11), real multiplex PCR (12) 그리고 immunocapture real-time RT-PCR (9) 검사법등다양한방법이개발되었다. 그러나여러연구자들에의해개발된 PCR 검사법은적용조건이서로상이하여여러병원체를동시에검사하는검역현장에서의활용이불편하였으며, 검역병원체의양성대조구를확보하기어려워, PCR 검사시의실험오차및증폭여부를정확히판정하기어려운한계점이발견되었다 (2). 따라서본연구에서는, TRV 를신속, 정확하게진단하기위하여, 검역현장요구에부응하는검사법이자검출감도가높고많은연구로안정성이뛰어난 2단계 PCR 방법 (RT- PCR, nested PCR) 을개발하였으며, 실험실오염으로인한거짓-양성반응을판단할수있는유전자변형-양성대조구를개발하였다. 또한본연구에서개발한방법을사용하여최근 6년 ( ) 동안검역현장에서실증된실험결과를보고하고자한다. MATERIALS AND METHODS 시료수집 TRV 종특이적 primer 선발에사용할 TRV 및 10개의 참고바이러스주 [Alfalfa mosaic virus (AMV), Arabis mosaic virus (ArMV), Cucumber mosaic virus (CMV), Pepper mottle virus (PepMoV), Potato virus Y (PVY), Ribgrass mosaic virus (RMV), Tobacco mild green mosaic virus (TMGMV), Tobacco mosaic virus (TMV), Tomato mosaic virus (ToMV) 및 Tomato spotted wilt virus (TSWV)] 이병시료, RNA 또는 cdna는금지품수입허가를통하여구매 (Adgen, England; Bione, Korea) 또는농촌진흥청농업과학원등의유관기관에서협조를받아서분석에사용하였다. Primer 설계 TRV 종특이적인진단용 primer 설계하기위하여, TRV RNA1을코딩하는염기서열 (AF314165, AF406990, AF , X06172, D00155, AF 및 AJ586803) 과참고바이러스주 Pepper ringspot virus strain CAM (L23972) 과 Pea early-browing virus strain SP5 (X14006) 의유전자염기서열을 National center for biotechnology information (NCBI) 로부터확보하였다. Primer 제작은이전에기술되었던방법 (3) 과동일하게 DNAMAN software package version 6.0 (Lynnon Biosoft, Canada) 을사용하여종특이적인염기서열을탐색하였다. 핵산추출및 primer 선발시료에서 RNA 추출, one step RT-PCR, nested PCR, 전기 Figure 1. Map of primer design for detection of TRV

3 56 S Lee, et al. Table 1. RT-PCR amplification sets and product size for the detection of TRV Set Forward primer (location) Reverse primer (location) Product size (bp) 1 TRV-N50 (6,233~6,257) TRV-C10 (6,572~6,593) TRV-N40 (4,998~5,021) TRV-C20 (5,246~5,270) TRV-N30 (4,540~4,561) TRV-C20 (5,246~5,270) TRV-N30 (4,540~4,561) TRV-C30 (4,995~5,019) TRV-N20 (2,782~2,805) TRV-C40 (3,857~3,877) 1,096 6 TRV-N10 (1,459~1,481) TRV-C50 (2,459~2,477) 1,019 7 TRV-N10 (1,459~1,481) TRV-C60 (2,314~2,338) 880 A B Figure 2. Results of selection of TRV RT-PCR primer sets. Panel (A), First selection of specific RT-PCR primer sets for the detection of TRV. M, 100 bp step DNA Ladder maker (Genepia, Korea); dot, selected PCR primer set; Lane number, primer set for detection of TRV. Panel (B), Second selection of specific RT-PCR primer sets for the detection of TRV. Lane M, 100 bp step DNA Ladder maker (Genepia); lane AM, Alfalfa mosaic virus; lane Ar, Arabis mosaic virus; lane CM, Cucumber mosaic virus; lane Pe, Pepper mottle virus; lane PY, Potato virus Y; lane RM, Ribgrass mosaic virus; lane TG, Tobacco mild-green mosaic virus; lane TM, Tobacco mosaic virus; lane To, Tomato mosaic virus; lane TS, Tomato spotted wilt virus.

primer of set 5 TR-N22 GTAAGTCGACAATGATTGTC TR-C45 GAAGGAAAGTTATGTACTGAG 543 Set 7 TRV-N10 GGCCGTGAAGAACAAGCAAAGTG TRV-C60 TTGTACCGCTTGTTTCCCCTCTT 880 Nested primer of set 7 TR-N11

4 Development of TRV Nested PCR Assay 57 Table 2. Final selection of RT-PCR and nested primer sets for the detection of TRV Primer Sequence (5' 3') Product size (bp) Set 5 TRV-N20 CGCGGTCGAAAGGATGAGTGATTA TRV-C40 TCCCGGAAACAAAGCGTCGTA 1,096 Nested primer of set 5 TR-N22 GTAAGTCGACAATGATTGTC TR-C45 GAAGGAAAGTTATGTACTGAG 543 Set 7 TRV-N10 GGCCGTGAAGAACAAGCAAAGTG TRV-C60 TTGTACCGCTTGTTTCCCCTCTT 880 Nested primer of set 7 TR-N11 GATTCTCGAGATTTACAGTTG TR-C62 TGCTCCATGATCTCCTCATC 760 Figure 3. RT-PCR sensitivity test on the selective primer sets for TRV. 영동및특이적 primer 선발방법은이전에수행했던방법과동일한방법을사용하였으며 (3), 검출감도를검정하기위하여 TRV RNA를 10-8 까지 10배단계희석하여분석에사용하였다. 유전자변형-양성대조구제작검역현장에서사용할수있는 PCR 진단시스템을개발을위한 TRV 유전자변형- 양성대조구플라스미드를제작하기위하여, pgem -T easy vector (Promega, USA) 와 sitedirected mutagenesis kit (Enzynomics, Korea) 를사용하였다 (13). 현장검증 본연구에서개발한 RT-PCR, nested PCR 및유전자변형 -양성대조구등의진단시스템을사용하여, TRV 와관련된수입작물 (14) 에서 2009년부터 2014년까지 6년간검사를수행하였다. 검사에대한기록은농림축산검역본부병해충정보시스템을통해확인하였다. Figure 4. Result of selected RT-PCR and nested-pcr products for the detection of TRV. Lane M, 100 bp step DNA Ladder; lane 1, final selected primer set #5 (1,096 bp); lane 2, nested-pcr product from primer set #5 (543 bp); lane 3, final selected primer set #7 (880 bp); lane 4, nested-pcr product from primer set #7 (760 bp).

58 S Lee, et al. RESULTS AND DISCUSSION TRV 를특이적으로검출하기위한 primer는총 12개 ( 정방향 7개, 역방향 8개 ) 를제작하였고 (Fig. 1), 제작된 primer 들을조합하여 273~1,096 bp 크기의 PCR 산물로증폭이가능한 7개의조합을구성하였다 (Table 1).

1차로선발된 6개 primer 조합으로 TRV 유연관계바이러스또는기주식물과관련된 10가지바이러스와의특이적반응을보이지않는조합 5 (1,096 bp) 와조합 7 (878 bp) (Fig. 2B) 을최종선발하였으며 (Table 2), 최종선발한두조합의검출감도를실험한결과각각 10-2 와 10-4 으로분석되어 (Fig.

5 58 S Lee, et al. RESULTS AND DISCUSSION TRV 를특이적으로검출하기위한 primer는총 12개 ( 정방향 7개, 역방향 8개 ) 를제작하였고 (Fig. 1), 제작된 primer 들을조합하여 273~1,096 bp 크기의 PCR 산물로증폭이가능한 7개의조합을구성하였다 (Table 1). TRV 주형 RNA 및참고바이러스주들의총핵산의최초농도는약 20~ 500 ng/μl였다. TRV 를주형으로한종특이적실험결과, 7개조합중반응강도가뛰어나고진단에장해가되는 비특이적반응을보이지않는 6개의조합을선발하였다 (Fig. 2A). 1차로선발된 6개 primer 조합으로 TRV 유연관계바이러스또는기주식물과관련된 10가지바이러스와의특이적반응을보이지않는조합 5 (1,096 bp) 와조합 7 (878 bp) (Fig. 2B) 을최종선발하였으며 (Table 2), 최종선발한두조합의검출감도를실험한결과각각 10-2 와 10-4 으로분석되어 (Fig. 3), TRV 를검출하기에적합한 primer 조합으로확인되었다. 또한, 최종선발된 TRV RT-PCR 조합 5의 nested PCR primer는 540 bp를조합 7의 nested PCR primer는 756 bp 크기의 PCR 산물을각각증 Figure 5. BamH I sequence insertion of the TRV genetically modified-positive control plasmids.

6 Development of TRV Nested PCR Assay 59 Table 3. Results of detection for TRV from plant quarantine sites in Year (number of detection) Item Total Bulb (119 cases) Gladiolus 5 5 Nectaroscordum 1 1 Dahlia 1 1 Leucocoryne Ranunculus 1 1 Garlic 1 1 Druce 1 1 Poison 1 1 Lily Narcissus Snowflake 1 1 Anemone Amaryllis 1 1 Iris 1 1 Alium Alstromeria 1 1 Ornithogalum 1 1 Orange Daylily 1 1 Calochortus 1 1 Crocus Tulip 3 3 Puschkinia 1 1 Ornamental Plants Etc Hemerocalis 1 1 Hyacinth Seed (16 cases) Hot pepper Iceland Poppy Tomato Paprika Etc. (1 case) Shallot 1 1 Total

7 60 S Lee, et al. 폭하였다 (Fig. 4 and Table 2). 본연구에서개발한 TRV 종특이적 primer 조합은 TRV strain ppk20 RNA1 (NCBI accession number AF314165) 을기준으로조합 5 (location 2,782~3,877) 와조합 7 (location 1,459~2,336) 로, 이것을증폭하는산물을얻기가어려워조합 5와 7에대한각각의유전자변형-양성대조구플라스미드를개발하였다. 그결과, 조합 5는염기서열 'GGA' 를, 조합 7은염기서열 'GG' 가삽입된것이분석되어 nested PCR 증폭산물부위에제한효소 site (BamH I; GGATCC) 를삽입이확인되었다 (Fig. 5). 따라서양성대조구로부터오염이있을경우다음의 2가지증상이나타날것이라고예상된다 ; i) 각각의 nested PCR 산물에서제한효소 BamH I가반응하면조합 5는 362와 561 bp 크기의, 조합 7은 364, 396 bp 크기의 PCR 산물이생산되어각각 2개씩의밴드가관찰될것이고, ii) nested PCR 산물의염기서열을 multiple sequence alignment하면조합 5와 7에서는삽입한각각 3개와 2개의염기서열이추가로분석될것이다 (Supplementary Fig. S4). TRV는국내에서는농림축산검역본부예규제 107호에의거하여다음의다양한수입종자및식물로부터검사를수행한다 ; 종자류 [ 감자 (Solanum tuberosum), 고추 (Capsicum annuum)( 파프리카포함 ), 사탕무 (Beta vulgaris var. saccharifera), 양귀비 (Papaver rhoeas), 토마토 (Lycopersicon esculentum), 팬지 (Viola tricolor var. hortensis)], 식물류 [ 감자 (Solanum tuberosum), 강낭콩 (Phaseolus vulgaris), 고추 (Capsicum annuum)( 파프리카포함 ), 글라디올러스속 (Gladiolus spp.), 다알리아속 (Dahlia spp.), 담배 (Nicotiana tabaccum), 라넌큘러스구근 (Ranunculus repens), 류코코리네속 (Leucocoryne spp.), 배추속 (Brassica spp.), 백합속 (Lilium spp.), 사탕무 (Beta vulgaris), 상추 (Lactuca sativa), 수선화속 (Narcissus spp.), 스노우드롭구근 (Galanthus nivalis), 시클라멘속 (Cyclamen spp.), 아네모네속 (Anemone spp.), 아이리스속 (Iris spp.), 아티초크 (Cynara cardunculus), 알리움속 (Allium spp.), 알스트로메리아속 (Alstromeria spp.), 옥잠화속 (Hosta spp.), 이키시아속 (Ixia spp.), 칼라속 (Zantedeschia spp.), 쿠르쿠마속 (Curcuma spp.), 크로커스속 (Crocus spp.), 토마토 (Lycopersicon esculentum), 튤립속 (Tulipa spp.), 팬지 (Viola tricolor), 풀협죽도속 (Phlox spp.), 프리지아속 (Freesia spp.), 호밀 (Secale cereale) 및히야신스구근 (Hyacinthus orientalis). 농림축산검역본부인트라넷인병해충정보시스템에의하면, TRV 는최근 6년 ( ) 동안약 133종류의작물 로부터약 23,000건의검사가수행되었다. 이중검출건수는총 83건으로, 우리나라식물검역바이러스 100종 (14) 중 Cucumber green mottle mosaic virus에이어 2번째로많은검출이분석되고있는것으로확인되었다. 연도별검출경향을살펴보면, TRV 는 2009년 9건, 2010년 19건, 2011년 3건, 2012년 14건, 2013년에 28건및 2014년 63건으로검출이증가하는추세가분석된다. 또한최근 6년간수선구근 (38건), 알리움구근 (18건), 아네모네구근 (15건) 및히야신스구근 (9건) 등구근류 119건으로 TRV 검출이높았으며, 종자 16건및기타 ( 종구용쪽파 1건 ) 으로총 136건이었다 (Table 3). 식물검역에사용하는검사법개발에는첨단검사법을활용한정밀성확보와함께검사의용이성과검사법개발의표준화가매우중요하며, 대량수입검역검사에반드시필요한편의성과검사결과에대한진위여부를검증할수있는시스템이포함하여야한다 (15). 본연구에서개발한 TRV 검역진단시스템은, 앞서보고된방법 (1~3, 16) 들과함께향후식물검역에기여할것이라고기대된다. REFERENCES 1) Lee S, Kang EH, Heo NY, Kim SM, Kim YJ, Shin YG. Detection of Carnation necrotic fleck virus and Carnation ringspot virus using RT-PCR. Res Plant Dis 2013;19: ) Lee S, Kang EH, Chu YM, Shin YG, Ahn TY. Development of PCR diagnosis system for plant quarantine seed-borne Wheat streak mosaic virus. Korean J Microbiol 2013;49: ) Lee S, Shin YG. Development and practical use of RT-PCR for seed-transmitted Prune dwarf virus in quarantine. Plant Pathol J 2014;30: ) Nicolaisen M, Bösze Z, Nielsen SL. Detection of Tobacco rattle virus in potato tubers using a simple RT-PCR procedure. Potato Research 1999;42: ) Wei T, Lu G, Clover GRG. A multiplex RT-PCR for the detection of Potato yellow vein virus, Tobacco rattle virus and Tomato infectious chlorosis virus in potato with a plant internal amplification control. Plant Pathology 2009;58: ) Pérez EE, Weingartner DP, Hiebert E, McSorley R. Tobacco rattle virus detection in potato tubers from northeast Florida by PCR and tissue blotting. Amer J of Potato Res 2012;77: ) Riga E, Larsen R, Eastwell K, Guerra N, Guerra L, Crosslin JM.

8 Development of TRV Nested PCR Assay 61 Rapid detection of Tobacco rattle tobravirus in Viruliferous paratrichodorus allius from greenhouse and field specimens. J Nematol 2009;41: ) Kenyon DM, Handy CL, Thomas JE. Detection of Tobacco rattle virus in soil using real-time PCR. Aspects of Applied Biology 2005;76: ) Yang JG, Wang FL, Chen DX, Shen LL, Qian YM, Liang ZY, et al. Development of a one-step immunocapture real-time RT-PCR assay for detection of Tobacco mosaic virus in soil. Sensors 2012;12: ) Xu H, Nie J. Molecular detection and identification of potato isolates of Tobacco rattle virus. Canadian J Plant Pathol 2006; 28: ) Holeva R, Phillips MS, Neilson R, Brown DJF, Young V, Boutsika K, et al. Real-time PCR detection and quantification of vector trichodorid nematodes and Tobacco rattle virus. Mol Cell Probes 2006;20: ) Mumford RA, Walsh K, Barker I, Boonham N. Detection of Potato mop top virus and Tobacco rattle virus using a multiplex real-time fluorescent reverse-transcription polymerase chain reaction assay. Phytopathology 2000;90: ) Shin YG, Rho JY. Development of a PCR diagnostic system for Iris yellow spot tospovirus in quarantine. Plant Pathol J 2014;30: ) Animal, Plant and Fisheries Quarantine and Inspection Agency. List of plant quarantine viruses in Korea newly revised in Res Plant Dis 2013;19: ) Shin YG. An advanced quarantine system for the inspection of seed-borne viruses in Korea ) Lee S, Kang EH, Shin YG, Lee SH. Development of RT-PCR and nested PCR for detecting four quarantine plant viruses belonging to Nepovirus. Res Plant Dis 2013;19:220-5.

66 Journal of Agriculture & Life Science 49(4) Ⅰ. 서론 Tomato ringspot virus(torsv) 는 Group IV (+) sense ssrna viruses, Nepovirus속으로분류되는식물병원성바이러스로, 북미,

66 Journal of Agriculture & Life Science 49(4) Ⅰ. 서론 Tomato ringspot virus(torsv) 는 Group IV (+) sense ssrna viruses, Nepovirus속으로분류되는식물병원성바이러스로, 북미, 농업생명과학연구 49(4) pp.65-72 Journal of Agriculture & Life Science 49(4) pp.65-72 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.65 Tomato ringspot virus 검역진단시스템개발 이시원