untitled

Size: px
Start display at page:

Download "untitled"

Transcription

1 210 Ji Youn Sung. PMQR Genes among CTX-M-14 Producing E. coli ORIGINAL ARTICLE Korean J Clin Lab Sci. 2016, 48(3): pissn eissn The Prevalence of Plasmid-Mediated Quinolone Resistance Genes among CTX-M-14 Producing Escherichia coli Strains Isolated from a University Hospital in the Chungcheong Province Ji Youn Sung Department of Biomedical Laboratory Science, Far East University, Eumseong 27601, Korea 충청지역에위치한일개의대학병원에서분리된 CTX-M-14 형 ESBL 생성대장균을대상으로 PMQR 유전자빈도조사 성지연 극동대학교임상병리학과 Recently, there has been a considerable increase in the prevalence of CTX-M type extended-spectrum -lactamase (ESBL)-producing E. coli isolates worldwide, including Korea. To investigate the ESBL genes in the E. coli strains isolated from a university hospital in the Chungcheong area, a study was conducted using PCR amplification and nucleotide sequence analysis of the amplified products to detect the plasmid mediated quinolone resistance (PMQR) genes in ESBL producing E. coli isolates. The number of CTX-M-14 producing isolates was 25 (16.0%) isolates, and of them, 9 (5.8%) isolates also produced CTX-M-15. All CTX-M type ESBL producing E. coli isolates showed resistance to cefotaxime. Twelve (48%) CTX-M type ESBL producing E. coli isolates contained the PMQR genes, 8 contained qnrs1, and 8 contained aac(6 )-Ib-cr. Four isolates harbored both qnrs1 and aac(6 )-Ib-cr genes. In our study, we confirmed that the plasmid mediated antimicrobial resistant determinants the ESBL and PMQR genes were distributed in the E. col isolates. To prevent further spreading of the resistant genes among the E. coli isolates, consistent effort is required to investigate and monitor the resistant genes. Key words: CTX-M type, Extended-spectrum -lactamase, Plasmid mediated quinolone resistance, E. coli Corresponding author: Ji Youn Sung Department of Biomedical Laboratory Science, Far East University, Wangjang-ri, Gamgok-myeon, Eumseong 27601, Korea Tel: Fax: azaza72@naver.com This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Copyright 2016 The Korean Society for Clinical Laboratory Science. All rights reserved. Received: July 30, 2016 Revised: August 29, 2016 Accepted: September 5, 2016 서론대부분의대장균 (Escherichia coli) 은사람과동물의장내에정상균무리로존재하지만때로는사람에게심한설사를동반한질환을일으키기도한다. 이러한대장균은병독성에따라크게 diffusely adherent E. coli (DAEC), enteroaggregative E. coli (EAEC), enterohemorrhagic E. coli (EHEC), enteroinvasive E. coli (EIEC), enteropathogenic E. coli (EPEC), 및 enterotoxigenic E. coli (ETEC) 등의 6개의그룹으로분류되는데이중 ETEC는개발도상국가의어린이와여행자에게설사를일으키며 EAEC는개발

2 Korean J Clin Lab Sci. Vol. 48, No. 3, September 도상국가및선진국가에서설사질환을일으키는원인균으로작용한다 [1]. 이러한대장균을포함한장내병원성세균에의한감염증치료를위해 3세대 cephalosporins 및 fluoroquinolones 이일반적으로사용되어왔다. 그러나대장균을비롯한장내세균과에속한세균들은빈번하게 extended-spectrum -lactamase (ESBL) 를생성하여 penicillins, cephalosporins, 및 monobactams 등 -lactam 계열의항균제에내성을나타내게되었다. 특히 Ambler class A에속하는 CTX-M형 ESBL은최근들어설사를유발하는대장균들사이에빠르게확산되었고전세계적으로대장균에서가장빈번하게검출되는 ESBL이되었다 [2]. CTX-M형 ESBL은최근까지약 50여종이상이보고되었는데아미노산서열에기초하여 CTX-M-1like (CTX-M-1, -3, -10, -11, -12, -15, -28, 및 FEC-1), CTX-M-2 like (CTX-M-2, -4, -5, -6, -7, -20, 및 TOHO-1), CTX-M-8 like (CTX-M-8), CTX-M-9 like (CTX-M-9, -13, -14,-16, -17, -19, -21, -24, -27 및 TOHO-2), 및 CTX-M-25 등크게 5개의그룹으로분류되고있다 [3]. 국내에서도 1990년대후반까지는장내세균에서분리되는주된 ESBL형은 TEM-52, SHV-2a, 및 SHV-12형이었으나최근들어 CTX-M 형이그리고그중에서도특히 CTX-M-14 및 CTX-M-15형이가장빈번하게분리되고있다 [4]. 한편 CTX-M형을포함한다양한 ESBL 유전자는플라스미드, transposons 및 integrons 같은 mobile genetic elements에의해세균사이에전파되는데이는 ESBL 생성세균의광범위한확산을유발하는원인이된다 [2]. 특히 mobile genetic elements는 ESBL 유전자뿐아니라다양한항균제내성유전자를운반할수있는데그대표적인것이 plasmid mediated quinolone resistance (PMQR) 유전자이다. 대장균이 PMQR 유전자를 mobile genetic elements 를통해획득할경우 quinolone 계열의항균제에도내성을나타낼수있게된다 [5]. Quinolone 계열의항균제는 1960년대부터세균감염을치료하기위해보편적으로사용되어온항균제이나최근 quinolone 계열의항균제에내성을나타내는장내세균이광범위하게확산되고있다. 세균이 quinolone 계열의항균제에내성을나타내는주된기전은염색에위치한 DNA gyrase 및 topoisomerase IV 유전자의돌연변이, 유출펌프의과량발현, 및외막포린단백감소등염색체상의돌연변이에의한다 [6]. 그러나최근 qnra, qnrb, qnrs, aac(6 )-Ib-cr, 및 qepa 등과같은 PMQR 유전자가장내세균과에속한세균들에서빈번하게검출되고있다 [7]. PMQR 유전자를획득한세균은 quinolone 계열의항균제가 DNA gyrase 및 topoisomerase IV의기능을억제하는것을방해하거나, quinolone 계열의항균제를변형시키거나세포밖으로능동적으로유출시킴으로써내성을나타내게된다 [8]. 세균간의 mobile genetic elements를매개로한 ESBL 및 PMQR 유전자들의수평적확산은다제내성세균의출현을야기할뿐아니라다제내성세균을빠르게확산시킬수있어문제가되고있다. 본연구에서는충청지역에위치한일개의대학병원에서분리된대장균을대상으로 ESBL의생성여부와그유전형을조사하였으며아울러 ESBL 생성대장균사이에확산되어있는 PMQR 유전자의빈도및그종류를확인하였다. 또한 repetitive extragenic palindromic sequence-based PCR (REP-PCR) 을이용하여 ESBL생성대장균의역학적연관성을조사하였다. REP-PCR은 pulsed-field gel electrophoresis (PFGE) 와같이세균감염확산의역학적연구를위해광범위하게사용되는분자생물학적방법이다. PFGE는고도의분별력을가지고있어일반적으로 gold standard 로불리지만시간과비용이많이소요되는단점이있으며고도의숙련도가필요하다. 이에비해 REP-PCR은아주간단하지만강력한 molecular typing 방법이어서최근많이이용되고있다 [9]. 본연구에서는 REP-PCR을이용하여 ESBL생성대장균의 clonality 를분석하였는데이결과는다제내성세균의출현및전파양상을제고하고확산방지책을마련하는데필요한기초자료가될것으로사료된다. 재료및방법 1. 균주의수집 2013년 8월부터 2014년 6월까지충청지역에위치한일개의대학병원에의뢰된임상검체로부터분리된대장균 156균주를대상으로하였다. 항균제내성에상관없이분리된순서대로균주를수집하였으며, 동일환자에서반복분리된균주는수집대상에서제외하였다. 분리된균주를 VITEK GNI card (biomerieux Vitek Inc., Hazelwood, MO, USA) 를이용하여생화학적방법으로동정하였다. 2. ESBL 생성확인시험및항균제감수성시험대장균이 ESBL을생성하는지알아보기위해 Clinical and Laboratory Standards Institute (CLSI) 지침에따라 ESBL 생성확인시험을시행하였다 [10]. Mueller-Hinton 한천배지 (Difco, Cockeysville, MD, USA) 에 McFarland 0.5 탁도의균액을바른후 cefotaxime (BBL, Cockeysville, MI, USA, 30 g) 과 cefotaxime/clavulanic acid (CTC) (BBL, 30/10 g), ceftazidime (BBL, 30 g) 과 ceftazidime/clavulanic acid (CZC) (BBL, 30/10 g) 디스크를놓고 35 o C에서 시간배양후억제대를측정하여 CTC 또는 CZC에의한억제대가 cefotaxime과 ceftazidime에의한억제대보다 5 mm 이상클경우 ESBL 생성양성균주로판정하

3 212 Ji Youn Sung. PMQR Genes among CTX-M-14 Producing E. coli 였다. ESBL 생성확인시험에서양성으로판정된균주를대상으로 CLSI 지침에따라 ampicillin cefotaxime, ceftazidime, tobramycin, amikacin, gentamicin, nalidixic acid, ciprofloxacin, 및 levofloxacin (BBL) 에대한감수성을 Mueller-Hinton 한천 (Difco) 을사용하여디스크확산법으로확인하였다 [8]. 정도관리를위해서 Escherichia coli ATCC 25922를동시에시험하여허용범위내에있는지를확인하였다. 3. 항균제내성유전자검출 ESBL 생성확인시험에서양성으로판정된균주를대상으로 ESBL 유전자의유전형확인과 PMQR 유전자의검출을위해기존의시발체 (Table 1) 를사용하여중합효소연쇄반응을수행하였다 [11-14]. 대상균주를 brain heart infusion broth (Difco) 에접종하여 37 o C에서하룻밤진탕배양한후배양액으로부터 DNA 추출시약 ( 솔젠트, 대전, 한국 ) 을사용하여 chromosomal DNA를추출하였다. DNA 추출액 (5 L), 10 Taq buffer (2.5 L), 10 mm dntp mix (0.5 L), primer 각 10 pmol, 0.7U Taq DNA 중합효소 ( 솔젠트 ) 및증류수를혼합하여총부피 25 ml의반응용액을만들었다. Gene Amp PCR System 9600 (Perkin-Elmer Cetus Corp., Norwalk, CT, USA) 으로 95 o C에서 5분간반응시킨후, 95 o C에서 20초, 59 o C에서 40초, 72 o C에서 30초씩 30회증폭반응시키고, 72 o C에서 5분간연장반응시켰다. 각각의 PCR 생산물을 ethidium bromide가포함된 1% agarose gel에서 40 분간전기영동하여 band를확인하였다. 증폭산물을 DNA 추출시약 ( 솔젠트 ) 로분리후, BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Foster City, CA, USA) 와 ABI PRISM 3730xl DNA analyzer (PE Applied Biosystems) 를이용하여염기서열을분석하였다. 4. Repetitive extragenic palindromic sequence-based PCR (REP-PCR) 을이용한 ESBL생성대장균의역학적연관성조사 ESBL 유전자를포함하고있는균주를대상으로 REP1 (5'- IIIGCGCCGICATCAGGC-3') 과 REP2 (5'-ACGTCTTATCAGG- CCTAC-3') 로명명된장내세균의반복서열을시발체로하여 REP-PCR을수행하였다 [15]. 증폭반응은 DNA 추출액 (5.0 L), 10 Taq buffer (5.0 L), 10 mm dntp mix (1.0 L), primer 각 20 pmol, 1.4 U Taq DNA polymerase ( 솔젠트 ) 및증류수를혼합하여 50 L의혼합액으로시행하였다. Gene Amp PCR System 9600 (Perkin-Elmer Centus) 으로 95 o C에서 5분간반응시킨후, 90 o C에서 40초, 42 o C에서 1분, 68 o C에서 7분씩 35회증폭반응시키고, 68 o C에서 15분간연장반응시켰다. 증폭산물 (10 L) 은 ethidium bromide가포함된 2% agarose gels에전기영동한후 Table 1. Oligonucleotides used in this study for detection of plasmid mediated antimicrobial resistant genes Group Primer Sequence (5' 3') Gene Reference ESBL genes TEM-F ATAAAATTCTTGAAGACGAAA bla TEM [11] TEM-R GACAGTTACCAATGCTTAATCA SHV-F GGGTTATTCTTATTTGTCGC bla SHV [11] SHV-R TTAGCGTTGCCAGTGCTC CTX-M-1F GACGATGTCACTGGCTGAGC bla CTX-M1-like [11] CTX-M-1R AGCCGCCGACGCTAATACA CTX-M-2F GCGACCTGGTTAACTACAATCC bla CTX-M2-like [11] CTX-M-2R CGGTAGTATTGCCCTTAAGCC CTX-M-8F AGACCTGATTAACTACAATCCCATTA bla CTX-M8-like [11] CTX-M-8R ACTTTCTGCCTTCTGCTCTGGC CTX-M-9F GCTGGAGAAAAGCAGCGGAG bla CTX-M9-like [11] CTX-M-9R GTAAGCTGACGCAACGTCTG Quinolone resistant genes QnrA-F AGAGGATTTCTCACGCCAGG qnra1 to qnra6 [12] QnrA-R TGCCAGGCACAGATCTTGAC QnrB-F GGMATHGAAATTCGCCACTG qnrb1 to qnrb6 [12] QnrB-R TTTGCYGYYCGCCAGTCGAA- QnrS-F GCAAGTTCATTGAACAGGGT qnrs1 to qnrs2 [12] QnrS-R TCTAAACCGTCGAGTTCGGCG AAC(6')-IbF TGACCAACAGCAACGATTCC aac(6')-ib cr [13] AAC(6')-IbR TTAGGCATCACTGCGTGTTC QepA-F GCAGGTCCAGCAGCGGGTAG qepa [14] QepA-R CTTCCTGCCCGAGTATCGTG Abbreviations: F, sense primer; R, antisense primer.

4 Korean J Clin Lab Sci. Vol. 48, No. 3, September BioDoc-14 Imagingsystem (UVP, Cambridge, UK) 을이용하여분석하였다. Band의강도와상관없이 band의분자량과개수로각균주를비교하며, 두개이상의밴드차이가있으면역학적상관관계가없는것으로판단하였다 [15]. 결과 1. ESBL 생성균주의분리및항균제감수성양상임상검체에서분리된대장균 156균주를대상으로 CLSI 디스크확산법에의한 ESBL 생성확인시험을시행한결과 20.5% 에해당하는 32균주가양성반응을보였다. 양성결과를보인 32균주를대상으로 Ambler class A에속하는 ESBL (bla TEM, bla SHV, 및 bla CTX-M) 유전자검출을위한중합효소연쇄반응을시행한결과 bla CTX-M9-like 를검출하기위한반응에서 25균주가양성반응을보였다. 그리고 25균주중 9균주는 bla CTX-M1-like 를검출하기위한반응에도동시에양성반응을나타냈다. 유전자의유전형을결정하기위해염기서열분석을실시한결과 bla CTX-M9-like 반응에서생성된 PCR 산물은모두 bla CTX-M-14 로, 그리고 bla CTX-M1-like 반응에서생성된 PCR 산물 은모두 bla CTX-M-15 로확인되었다 (Table 2). 한편 bla CTX-M1-like 및 bla CTX-M9-like 를제외한나머지 bla CTX-M2-like, bla CTX-M8-like, bla TEM, 및 bla SHV 를검출하기위한중합효소연쇄반응에서는 PCR 산물이하나도생성되지않았다. CTX-M-14 및 CTX-M-15 를생성하는대장균 25균주를대상으로항균제감수성시험을한결과 ceftazidime에대한감수성이 76.0% 로가장높았고 gentamicin (48.0%) 이그다음으로높았다. 한편본연구에서검사한 9종류의항균제중 ceftazidime 및 gentamicin을제외한 7종류의항균제에대해서는모든균주가 40% 이하의낮은감수성률을보였다 (Table 3). 2. PMQR 내성유전자검출 CTX-M형 ESBL 유전자를포함하고있는대장균 25균주를대상으로 PMQR 유전자 (qnra, qnrb, qnrs, aac(6 )-Ib-cr, 및 qepa) 의빈도를조사하기위해중합효소연쇄반응을수행한결과 12균주 (48%) 가 PMQR 유전자를가지고있는것으로나타났다. qnrs 유전자를검출하기위한반응에서 8균주 (32%) 그리고 aac(6 )-Ib-cr 유전자를검출하기위한반응에서 8균주 (32%) 가각각양성반응을 Table 2. Characterizations of 25 CTX-M type ESBL producing Escherichia coli Isolates Specimens Antimicrobial resistance genes Antimicrobial susceptibilities ESBL genes PMQR gens AM CTX CAZ NN AK CN NA CIP LEV CD1 Urine bla CTX-M14 qnrs1 R R S R R I R R R CD2 Urine bla CTX-M14 qnrs1 R R S S S S R R R CD3 Urine bla CTX-M14 bla CTX-M15 aac6-1b-cr qnrs1 R R R R R I R R R CD5 Body Fluid bla CTX-M14 R R R S S S R R R CD7 Urine bla CTX-M14 qnrs1 R R S S I S R S S CD9 Urine bla CTX-M14 bla CTX-M15 aac6-1b-cr qnrs1 R R S S S S I R I CD11 Sputum bla CTX-M14 bla CTX-M15 aac6-1b-cr R R R R I R R R R CD17 Urine bla CTX-M14 bla CTX-M15 R R S R I R I S S CD19 Urine bla CTX-M14 aac6-1b-cr qnrs1 R R S S I S R R R CD20 Urine bla CTX-M14 bla CTX-M15 aac6-1b-cr R R S R I R S S S CD24 Blood bla CTX-M14 aac6-1b-cr qnrs1 R R R S S S I R I CD27 Blood bla CTX-M14 R R S S I S R R R CD33 Urine bla CTX-M14 R R S R R S S S S CD34 Urine bla CTX-M14 bla CTX-M15 R R S S I S R I I CD35 Urine bla CTX-M14 R R S I I R R S S CD36 Urine bla CTX-M14 qnrs1 R R S R I R R R R CD37 Urine bla CTX-M14 bla CTX-M15 R R I R I R R R R CD38 Urine bla CTX-M14 bla CTX-M15 R R S R I R R R R CD39 Urine bla CTX-M14 R R S R I R S S S CD42 Urine bla CTX-M14 R R S R I R R R R CD46 Urine bla CTX-M14 bla CTX-M15 R R I I I S R R R CD49 Urine bla CTX-M14 R R S S I S R S S CD50 Urine bla CTX-M14 R R S R S R S S S CD53 Urine bla CTX-M14 aac6-1b-cr R R S R I R R R R CD55 Urine bla CTX-M14 aac6-1b-cr R R S S I S S S S Abbreviations: ESBL, extended-spectrum β-lactamase PMQR, plasmid-mediated quinolone resistance; AM, ampicillin; CTX, cefotaxime; CAZ, ceftazidime; NN, tobramycin; AK, amikacin; CN, gentamicin; NA, nalidixic acid; CIP, ciprofloxacin; LEV, levofloxacin; S, susceptible; I, intermediate resistant, R, resistant.

5 214 Ji Youn Sung. PMQR Genes among CTX-M-14 Producing E. coli Table 3. Antimicrobial susceptibilities of 25 CTX-M type ESBL producing Escherichia coli Numbers (%) of isolates Agent E. coli containing PMQR genes (n=12) E. coli not containing PMQR genes (n=13) Total E. coli (n=25) S I R S I R S I R AM 0 (0.0) 0 (0.0) 12 (100.0) 0 (0.0) 0 (0.0) 13 (100.0) 0 (0.0) 0 (0.0) 25 (100.0) CTX 0 (0.0) 0 (0.0) 12 (100.0) 0 (0.0) 0 (0.0) 13 (100.0) 0 (0.0) 0 (0.0) 25 (100.0) CAZ 9 (75.0) 0 (0.0) 3 (25.0) 10 (76.9) 2 (15.4) 1 (7.7) 19 (76.0) 2 (8.0) 4 (16.0) NN 6 (50.0) 0 (0.0) 6 (50.0) 4 (30.8) 2 (15.4) 7 (53.8) 10 (40.0) 2 (8.0) 13 (52.0) AK 3 (25.0) 7 (58.3) 2 (16.7) 2 (15.4) 10 (76.9) 1 (7.7) 5 (20.0) 17 (68.0) 3 (12.0) CN 6 (50.0) 2 (16.7) 4 (33.3) 6 (46.2) 0 (0.0) 7 (53.8) 12 (48.0) 2 (8.0) 11 (44.0) NA 2 (16.7) 1 (8.3) 9 (75.0) 3 (23.1) 1 (7.7) 9 (69.2) 5 (20.0) 3 (12.0) 17 (68.0) CIP 3 (25.0) 0 (0.0) 9 (75..0) 6 (46.2) 1 (7.7) 6 (46.2) 9 (36.0) 1 (4.0) 15 (60.0) LEV 3 (25.0) 2 (16.7) 7 (58.3) 6 (46.2) 1 (7.7) 6 (46.2) 9 (36.0) 3 (12.0) 13 (52.0) Abbreviations: PMQR, plasmid-mediated quinolone resistance; AM, ampicillin; CTX, cefotaxime; CAZ, ceftazidime; NN, tobramycin; AK, amikacin; CN, gentamicin; NA, nalidixic acid; CIP, ciprofloxacin; LEV, levofloxacin; S, susceptible; I, intermediate resistant, R, resistant. Fig. 1. Repetitive element sequence-based (REP)-PCR patterns of genomic DNA from twenty-five CTX-M type ESBL producing Escherichia coli isolates. Lane M is 1 kb DNA size marker. 보였으며그중 4균주는두개의반응모두에서양성결과를나타냈다. 생성된 PCR 산물을대상으로유전형을결정하기위해염기서열분석을실시한결과 qnrs와 aac(6 )-Ib-cr 유전자증폭산물은각각 qnrs1와 aac(6 )-Ib-cr 유전자로확인되었다. 본연구에서는 qnra, qnrb, 및 qepa 유전자는검출되지않았다 (Table 2). 3. CTX-M 형 ESBL 생성대장균의유전형분석시험기간중분리된 25균주의 CTX-M형 ESBL 생성대장균이같은클론에서유래되었는지를확인하기위하여 REP-PCR 을수행한결과총 9개의 band 패턴 (A I 형 ) 이확인되었다 (Fig. 1). 그중 A 형 band 패턴을보인균주가 12균주로가장많았으며, A형을제외한나머지 8개의 band 패턴 (B I 형 ) 을나타낸균주는각각 3균주이하였다. 고찰최근들어 CTX-M형 ESBL의종류가급격하게증가하고있으며 CTX-M형 ESBL을생성하는세균또한전세계적을빠르게확산되고있는추세에있다. 국내에서도 CTX-M 형 ESBL을생성하는대장균이빈번하게분리되고있는데그중에서도 CTX-M-14 또는 CTX-M-15 생성대장균이가장많이보고되고있다 [4,16]. 본연구에서도수집된대장균 156균주중약 16.0% 에해당하는 25균주가 CTX-M형 ESBL을생성하는것으로나타났다. 이수치는최근국내에서보고되고있는 CTX-M형 ESBL을생성하는대장균의비율과유사한것으로 CTX-M형 ESBL이국내에서분리되는대장균에서가장빈번하게검출되고있는 ESBL형임을의미한다 [17]. 한편, 일반적으로 CTX-M 형 ESBL 은 ceftazidime 보다는 cefotaxime 을더효과적으로분해하는것으로알려져있다. 본연구에서도 CTX-M형 ESBL을생성하는대장균 25균주가 cefotaxime 에는모두내성을보인반면 ceftazidime 에는 76.0% 가감수성을나타냈다. PMQR 유전자는 quinolone 계열의항균제에대해낮은수준의내성을나타냄에도불구하고 ESBL 유전자와마찬가지로 mobile genetic elements를통해다른세균으로전파될수있어내성확산의우려가있다. 본연구에서도 CTX-M 형 ESBL을생성하는대장균중 48% (12균주) 가 PMQR 유전자를가지고있는것으로나타났다. 특히 DNA gyrase를보호하는단백을암호화하는 qnrs1 유전자를포함하는대장균이 32% (8균주) 나되었다. 이전의중국과국내에서분리된 ciprofloxacin 내성대장균을대상으로한연구에서는각각 7.5% 와 5.6% 에해당하는대장균만이 qnr 유전자를가지고있는것으로보고한바있다 [7]. 본연구에서 qnr 유전자의분리빈도

6 Korean J Clin Lab Sci. Vol. 48, No. 3, September 가월등하게높았던것은 CTX-M형 ESBL을생성하는대장균을대상으로조사했기때문인것으로사료되며이는 qnr 유전자가 CTX-M형 ESBL 유전자와연관되어있음을시사한다. 한편, 이전의연구자들은대장균에서 aac(6 )-Ib-cr 유전자의검출빈도는높은편으로미국의경우 32% 의대장균이그리고국내의경우 ESBL 생성대장균의 34.1% 가 aac(6 )-Ib-cr 유전자를포함하고있다고하였다 [7]. 본연구에서도 quinolone 계열의항균제를변형시켜항균제의기능을못하게하는 aac(6 )-Ib-cr 유전자를포함하는대장균이 32% (8균주) 로이전의보고와유사한결과를나타냈다. PMQR 유전자는 fluoroquinolone 항균제에비록낮은수준의내성을나타내지만치료를위한항균제의선택압력에놓일경우높은농도에도내성을유발할수있다고보고되고있다 [18,19]. 본연구에서는충청지역에위치한일개의대학병원에서분리된대장균을대상으로 ESBL 및 PMQR 유전자의빈도와유전형을조사하였다. 충청지역에서분리된대장균은상당히높은빈도로 ESBL 및 PMQR 유전자를포함하고있었다. ESBL 및 PMQR 유전자는빈번하게 mobile genetic elements를통해세균간에확산되어다재내성세균의출현을야기할수있다. 게다가 CTX-M형 ESBL 생성대장균의 48% (12균주) 가같은클론에서유래되었음을 REP-PCR을통해확인할수있었는데이는 CTX-M형 ESBL 생성대장균이수평확산되었음을의미한다. 따라서다제내성세균의출현및확산을방지하기위해서는지속적인항균제내성유전자에대한조사와모니터링이필요할것으로사료된다. 요약최근들어 CTX-M형 extended-spectrum -lactamase (ESBL) 생성대장균이국내는물론전세계적으로빠르게증가하고있다. 본연구에서는충청지역에위치한일개의대학병원에서분리된대장균을대상으로 ESBL 유전자를중합효소연쇄반응및염기서열분석방법을통해확인하였으며, 같은방법으로 ESBL 생성대장균으로부터 plasmid mediated quinolone resistance (PMQR) 유전자의빈도를조사하였다. 16.0% 에해당하는 25 균주가 CTX-M-14 를생성하였으며이중 9균주는 CTX-M-15도동시에생성하는것으로나타났다. 항균제감수성시험결과 CTX-M형 ESBL을생성하는대장균은모두 cefotaxime에내성을보였다. 한편 CTX-M형 ESBL을생성하는대장균의 48% (12균주) 가 PMQR 유전자를포함하고있음이확인되었는데 8균주가 qnrs1유전자를그리고 8균주가 aac(6 )-Ib-cr 유전자를포함하고있었다. 그중 4균주는두개의유전자를모두가지고있는것으로나타났다. 본연구에서는플라스미드를통해확산될수있는 ESBL 및 PMQR 유전자가대장균 사이에확산되어있음을확인하였다. 항균제내성유전자들의확산을막기위해서는지속적인내성유전자의모니터링과감시가필요할것으로사료된다. Acknowledgements: None Funding: None Conflict of interest: None References 1. Qadri F, Svennerholm AM, Faruque AS, Sack RB. Enterotoxigenic Escherichia coli in developing countries: epidemiology, microbiology, clinical features, treatment, and prevention. Clin Microbiol Rev. 2005;18: Canton R, Gonzalez-Alba JM, Galan JC. CTX-M enzymes: origin and diffusion. Front Microbiol. 2012;3: Poirel L, Kampfer P, Nordmann P. Chromosome-encoded Ambler class A beta-lactamase of Kluyvera georgiana, a probable progenitor of a subgroup of CTX-M extended-spectrum beta-lactamases. Antimicrob Agents Chemother. 2002;46: Song W, Lee H, Lee K, Jeong SH, Bae IK, Kim JS, et al. CTX-M-14 and CTX-M-15 enzymes are the dominant type of extended-spectrum beta-lactamase in clinical isolates of Escherichia coli from Korea. J Med Microbiol. 2009;58: Seo MR, Park YS, Pai H. Characteristics of plasmid mediated quinolone resistance genes in extended-spectrum cephalosporin-resistant isolates of Klebsiella pneumoniae and Escherichia col in Korea. Chemotherapy. 2010;56: Ruiz J. Mechanisms of resistance to quinolones: Target alterations, decreased accumulation and DNA gyrase protection. J Antimicrob Chemother. 2003;51: Yang HY, Nam YS, Lee HJ. Prevalence of plasmid-mediated quinolone resistance genes among ciprofloxacin-nonsusceptible Escherichia coli and Klebsiella pneumoniae isolated from blood cultures in Korea. Can J Infect Dis Med Microbiol. 2014;25: Robicsek A, Strahilevitz J, Jacoby GA. Fluoroquinolone modifying enzyme: A new adaptation of a common aminoglycoside acetyltransferase. Nat Med. 2006;12: Bae IK, Kim J, Sun JY, Jeong SH, Kim YR, Wang KK, et al. Comparison of pulsed-field gel electrophoresis & repetitive sequence-based PCR methods for molecular epidemiological studies of Escherichia coli clinical isolates. Indian J Med Res. 2014;140: CLSI. Performance standards for antimicrobial susceptibility testing; sixteenth informational supplement. CLSI document M100-S20. Wayne, PA: Clinical and Laboratory Standards Institute; 2010, p Lewis JS, Herrera M, Wickes B, Patterson JE, Jorgensen JH. First report of the emergence of CTX-M-type extended-spectrum beta-lactamases (ESBLs) as the predominant ESBL isolated in a

7 216 Ji Youn Sung. PMQR Genes among CTX-M-14 Producing E. coli U.S. health care system. Antimicrob Agents Chemother. 2007; 51: Cattoir V, Poirel L, Rotimi V, Soussy CJ, Nordmann P. Multiplex PCR for detection of plasmid-mediated quinolone resistance qnr genes in ESBL-producing enterobacterial isolates. J Antimicrob Chemother. 2007;60: Song S, Lee EY, Koh EM, Ha HS, Jeong HJ, Bae IK, et al. Antibiotic resistance mechanisms of Escherichia coli isolates from urinary specimens. Korean J Lab Med. 2009;29: Yamane K, Wachino J, Suzuki S, Arakawa Y. Plasmid-mediated qepa gene among Escherichia coli clinical isolates from Japan. Antimicrob Agents Chemother. 2008;52: Bou G, Cerveró G, Domínguez MA, Quereda C, Martínez- Beltrán J. PCR-based DNA fingerprinting (REP-PCR, AP-PCR) and pulsed-field gel electrophoresis characterization of a nosocomial outbreak caused by imipenem- and meropenem-resistant Acinetobacter baumannii. Clin Microbiol Infect. 2000; 6: Sung JY, Oh JE, Kim ES, Son JM, Kim HY, Lim DY. Spread of CTX-M Extended-spectrum -lactamase Producing Escherichia coli in the Community in Chungcheong Area, Korea. Korean J Clin Lab Sci. 2013;45: Kim JS, Kim J, Kim SJ, Jeon SE, Oh KH, Cho SH, et al. Characterization of CTX-M-type extended-spectrum beta-lactamase-producing diarrheagenic Escherichia coli isolates in the Republic of Korea during J Microbiol Biotechnol. 2014;24: Nordmann P. In vivo selection of fluoroquinolone-resistant Escherichia coli isolates expressing plasmid-mediated quinolone resistance and expanded-spectrum beta-lactamase. Antimicrob Agents Chemother. 2006;50: Kim S, Sung JY, Choi SG. Molecular Characterization of Escherichia coli Isolates from Humans and Chickens in the Chungcheong Area Using MLST Analysis. Korean J Clin Lab Sci. 2015;47:71-77.

untitled

untitled ORIGINAL ARTICLE Korean J Clin Lab Sci. 2017;49(4):427-434 https://doi.org/10.15324/kjcls.2017.49.4.427 pissn 1738-3544 eissn 2288-1662 Korean J Clin Lab Sci. Vol. 49, No. 4, December 2017 427 Distribution

More information

untitled

untitled ORIGINAL ARTICLE Korean J Clin Lab Sci. Vol. 45, No. 1, Mar. 2013 21 Korean J Clin Lab Sci. 2013, 45(1):21-25 ISSN 1738-3544 Errors of Antibiotic Susceptibility Testing from Automated and Manual Systems

More information

< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770>

< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770> 대한임상검사학회지 : 40권제2호, 75-79, 2008 ISSN 1738-3544 대구지역병원에서분리된 Acinetobacter baumannii와 Pseudomonas aeruginosa의항생제내성현황 대구보건대학임상병리과 1, 세명대학교임상병리학과 2 김수정 1 이재식 2 Antibiotic Resistance Patterns of Acinetobacter

More information

<5BC0FAC0DABCF6C1A430355D434D30362D313320BEE7BAB4BCB12D E687770>

<5BC0FAC0DABCF6C1A430355D434D30362D313320BEE7BAB4BCB12D E687770> 대한임상검사학회지 : 38 권제 3 호, 173-178, 2006 Multiplex Polymerase Chain Reaction 을이용한 Extended-Spectrum β-lactamase 생성 Klebsiella pneumoniae 균주의검출 진주보건대학임상병리과 양병선 Detection of Extended-Spectrum β-lactamase Producing

More information

296 Korean J Lab Med 2010;30: S. maltophila 감염증치료에는낮은항균제내성률을보이는 trimethoprim/sulfamethoxazole (TMP/SMX) 이일차치료제로사용되고있으며, quinolone, moxalactam,

296 Korean J Lab Med 2010;30: S. maltophila 감염증치료에는낮은항균제내성률을보이는 trimethoprim/sulfamethoxazole (TMP/SMX) 이일차치료제로사용되고있으며, quinolone, moxalactam, Korean J Lab Med 2010;30:295-300 DOI 10.3343/kjlm.2010.30.3.295 Original Article Clinical Microbiology Analysis of Acquired Resistance Genes in Stenotrophomonas maltophilia Jeong Hoon Song, M.D. 1, Ji

More information

22 신경섭 손보라 oxyimino-cephalosporin은물론 monobactam계항생제도분해하는효소이다 [1-3]. 장내세균에서 ESBL 생성균주의증가에대한여러보고가있는데 [4-6], Escherichia coli와 Klebsiella pneumoniae는임상에서

22 신경섭 손보라 oxyimino-cephalosporin은물론 monobactam계항생제도분해하는효소이다 [1-3]. 장내세균에서 ESBL 생성균주의증가에대한여러보고가있는데 [4-6], Escherichia coli와 Klebsiella pneumoniae는임상에서 대한임상병리학회지 : 제 22 권제 1 호 2002 Korean J Clin Pathol 2002; 22: 21-6 임상미생물학 Escherichia coli와 Klebsiella Species에서 Extended-Spectrum -Lactamase 검출을위한 Vitek ESBL Test와그외방법의비교 신경섭 손보라 충북대학교의과대학임상병리학교실 Comparison

More information

untitled

untitled Korean J Clin Microbiol Vol. 12, No. 1, March, 2009 Characterization of Class 1 Integrons in Metallo-βlactamase-producing Pseudomonas aeruginosa Ji Youn Sung, Sun Hoe Koo, Kye Chul Kwon, Jong Woo Park,

More information

untitled

untitled Korean J Clin Microbiol Vol., No., December, 20 http://dx.doi.org/0.55/kjcm.20...3 Chromosomal Mutations in oprd, gyra, and parc in Carbapenem Resistant Pseudomonas aeruginosa Ji Youn Sung, Hye Hyun Cho

More information

< D34312D303628BEE7BAB4BCB12CC0B0B1D9B5B9292E687770>

< D34312D303628BEE7BAB4BCB12CC0B0B1D9B5B9292E687770> 대한임상검사학회지 : 41권제4호, 153-157, 2009 ISSN 1738-3544 SHV ESBL 생성 Klebsiella pneumoniae 균주의실시간중합효소반응분석 진주보건대학임상병리과 1, 대전보건대학임상병리과 2 양병선 1 육근돌 2 Real-Time PCR Analysis of SHV Extended-Spectrum beta-lactamases

More information

2101

2101 대한진단검사의학회지제 28 권제 3 호 2008 Korean J Lab Med 2008;28:185-90 DOI 10.3343/kjlm.2008.28.3.185 원저 임상미생물학 Escherichia coli, Klebsiella spp., Proteus mirabilis에서 Phoenix Automated Microbiology System의 Extended-Spectrum

More information

Microsoft Word - 15-홍승복.doc

Microsoft Word - 15-홍승복.doc J. Exp. Biomed. Sci. 2012, 18(3): 299~306 pissn : 1738-3226 Original Article Molecular Characterization and Prevalence of 16S Ribosomal RNA Methylase Producing Bacteria in Amikacin Resistant Gram-negative

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

A. baumannii 와 P. aeruginosa 의 ESBL 생성현황 15 인하여광범위 -lactam 제제일부를포함한여러항균제에내재적내성이지만, ceftazidime, piperacillin, ticarcillin 등은이들세균에비교적강한항균력을지닌다 [3]. Cla

A. baumannii 와 P. aeruginosa 의 ESBL 생성현황 15 인하여광범위 -lactam 제제일부를포함한여러항균제에내재적내성이지만, ceftazidime, piperacillin, ticarcillin 등은이들세균에비교적강한항균력을지닌다 [3]. Cla 대한진단검사의학회지제 26 권제 1 호 2006 Korean J Lab Med 2006;26:14-20 원저 임상미생물학 임상검체에서분리된 Acinetobacter baumannii와 Pseudomonas aeruginosa의 Class A Extended-Spectrum -Lactamase 생성현황 오세진 이상욱 황현용 1 배일권 1 조현수 1 이병호 1

More information

ORIGINAL ARTICLE Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist

ORIGINAL ARTICLE   Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist ORIGINAL ARTICLE http://dx.doi.org/10.15263/jlmqa.2015.37.4.209 Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resistance: MicroScan versus Etest Goeun Kang, Hyun Soo Kim,

More information

1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus

More information

untitled

untitled Korean J Clin Microbiol Vol. 11, No. 2, October, 2008 Detection of CTX-M-Type Extended-Spectrum β-lactamase in Clinical Isolates of Chromosomal AmpC β-lactamase-producing Enterobacteriaceae from Korea

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

Microsoft PowerPoint - PDFCoTemp.PPT

Microsoft PowerPoint - PDFCoTemp.PPT 주요유방염세균의검출및 항생제감수성검사 임숙경 1. 검사시료 1. 시료채취 유방염우유 2. 체세포수측정 3. 대상세균 - Staphylococcus aureus - Coagulase negative staphylococci -Escherichia coli 3. 균분리방법 E. coli CHEC Agar 직접도말 (37 18-24h) 보라색집락 EMB Agar

More information

untitled

untitled Korean J Clin Microbiol Vol. 11, No. 2, October, 2008 Characteristics of Acquired β-lactamase Gene in Clinical solates of Multidrug-resistant Pseudomonas aeruginosa un Yang Chung 1, Ji Youn ung 2, Kye

More information

<37375FB1E8C0E7C1DF2DC7F7BED7B9E8BEE7BFA1BCAD20BAD0B8AEB5C820C0D3BBF3C0FB2E687770>

<37375FB1E8C0E7C1DF2DC7F7BED7B9E8BEE7BFA1BCAD20BAD0B8AEB5C820C0D3BBF3C0FB2E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 17, No. 5 pp. 653-659, 2016 http://dx.doi.org/10.5762/kais.2016.17.5.653 ISSN 1975-4701 / eissn 2288-4688 혈액배양에서분리된임상적주요균주의항균제사용량에따른내성률변화

More information

6 JH Byun, et al. IRS-PCR on E. coli 성을나타낸다. CTX-M ESBL 유전자는 mobile genetic element 와연관되어지역사회에서 ESBL 이쉽게전파할수있다 [5, 6]. 병원균의역학적분석을하기위

6 JH Byun, et al. IRS-PCR on E. coli   성을나타낸다. CTX-M ESBL 유전자는 mobile genetic element 와연관되어지역사회에서 ESBL 이쉽게전파할수있다 [5, 6]. 병원균의역학적분석을하기위 Original Article http://dx.doi.org/10.3947/ic.2012.44.1.5 Infect Chemother 2012;44(1):5-10 pissn 2093-2340 eissn 2092-6448 Infection & Chemotherapy Infrequent-Restriction-Site 중합효소연쇄반응 (ISR-PCR) 을사용한지역사회발생

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

04_이근원_21~27.hwp

04_이근원_21~27.hwp 1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일

More information

KJFP Jeongsook Yoon. bla VIM-2 of Pseudomonas aeruginosa in primary hospitals in Korea Vitek(Biomerieux, Marcy 1 Etoile, France) 으로균을동정하였다. 항균제감수성검사는디

KJFP Jeongsook Yoon. bla VIM-2 of Pseudomonas aeruginosa in primary hospitals in Korea Vitek(Biomerieux, Marcy 1 Etoile, France) 으로균을동정하였다. 항균제감수성검사는디 KJFPpISSN 2233-9019 eissn 2233-9116 Original Article 한국 1 차병원의 Pseudomonas aeruginosa 에서 blavim-2 유전자관찰 윤정숙 서울베스티안병원 bla VIM-2 of Pseudomonas aeruginosa in primary hospitals in Korea Jeong-sook Yoon Director

More information

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770> Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한

More information

untitled

untitled ORIGINAL ARTICLE Korean J Clin Lab Sci. 2016, 48(3):217-224 http://dx.doi.org/10.15324/kjcls.2016.48.3.217 pissn 1738-3544 eissn 2288-1662 Korean J Clin Lab Sci. Vol. 48, No. 3, September 2016 217 An Analysis

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

12_HM hwp

12_HM hwp The Korean Journal of Microbiology (2010) Vol. 46, No. 3, pp. 303-307 Copyright c 2010, The Microbiological Society of Korea 단보 국내에서분리된 Acinetobacter baumannii 의 Integron 과연관된다제내성분석 김성환 최지혜 박은진 서인원 손승렬

More information

한수지 49(5), , 2016 Original Article Korean J Fish Aquat Sci 49(5), ,2016 창선해역의지중해담치 (Mytilus galloprovincialis) 양식장및육상오염원에서분리한대장균 (Escheri

한수지 49(5), , 2016 Original Article Korean J Fish Aquat Sci 49(5), ,2016 창선해역의지중해담치 (Mytilus galloprovincialis) 양식장및육상오염원에서분리한대장균 (Escheri 한수지 49(5), 564-572, 2016 Original Article Korean J Fish Aquat Sci 49(5),564-572,2016 창선해역의지중해담치 (Mytilus galloprovincialis) 양식장및육상오염원에서분리한대장균 (Escherichia coli) 의항생제내성 권순재 이가정 * 정연중 박상기 고경리 양지혜 목종수 국립수산과학원남동해수산연구소

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

untitled

untitled Ann Clin Microbiol Vol. 16, No. 1, March, 1 http://dx.doi.org/1.5145/acm.1.16.1.45 ISSN 88-585 Trends in Isolation and Antimicrobial Susceptibility of Enteropathogenic Bacteria in 1-1 at a Korean Tertiary

More information

2 - ceftazidime-clavulanate 디스크를이용하여 ESBL 생성균주를확인하였다. 또한 2009년도에수집된균주인 P. aeruginosa(386주 ), A. baumannii(349주 ) 를대상으로 imipenem에대한감수성을확인하였고 imipenem-h

2 - ceftazidime-clavulanate 디스크를이용하여 ESBL 생성균주를확인하였다. 또한 2009년도에수집된균주인 P. aeruginosa(386주 ), A. baumannii(349주 ) 를대상으로 imipenem에대한감수성을확인하였고 imipenem-h 1 - 국내종합병원을대상으로한항균제내성모니터링 Monitoring of antimicrobial resistance on general hospitals in Korea 질병관리본부국립보건연구원감염병센터약제내성과 연세대학교의과대학진단검사의학교실, 세균내성연구소 Ⅰ. 들어가는말 항균제내성세균의출현과확산으로인하여세균감염증치료는점점어려워지고있다 [1-4]. 항균제내성률은흔히국가간,

More information

untitled

untitled Korean J Clin Microbiol Vol. 13, No. 1, March, 2010 DOI: 10.5145/KJCM.2010.13.1.27 Carbapenem Resistance Mechanisms and Molecular Epidemiology of Acinetobacter spp. from Four Hospitals in Seoul and Gyeonggi

More information

400 김정민 신경섭 집락을쉽게형성하여장기입원환자나비뇨기계질환이있는노인에서흔히감염을일으킬수있다 [2, 3]. P. rettgeri는 P. stuartii보다 aminoglycoside, cephalosporin 및페니실린계항균제에대한내성률이낮으며, 다제내성인경우도드물다

400 김정민 신경섭 집락을쉽게형성하여장기입원환자나비뇨기계질환이있는노인에서흔히감염을일으킬수있다 [2, 3]. P. rettgeri는 P. stuartii보다 aminoglycoside, cephalosporin 및페니실린계항균제에대한내성률이낮으며, 다제내성인경우도드물다 대한진단검사의학회지 : 제 25 권제 6 호 2005 Korean J Lab Med 2005; 25: 399-405 임상미생물학 요검체에서분리된 Providencia rettgeri 에서 VIM-2형 Metallo- -Lactamase의생성 김정민 신경섭 1 경북대학교의과대학미생물학교실, 충북대학교의과대학진단검사의학교실 1 Production of VIM-2

More information

untitled

untitled 대한내과학회지 : 제 72 권제 1 호 27 Streptococcus pneumoniae와 Haemophilus influenzae 임상분리주에대한 Cefditoren의시험관내항균력 인제대학교의과대학일산백병원감염내과, 울산대학교의과대학서울아산병원감염내과 2, 울산대학교항균제내성ㆍ미생물유전학연구센터 3 곽이경 추은주 2, 3 박수진 3 이정은 3 정진용 2,

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

(59-69)Kjcm13.hwp

(59-69)Kjcm13.hwp Korean J Clin Microbiol Vol. 10, No. 1, April, 2007 Antimicrobial Resistance of Clinically Important Bacteria Isolated from 12 Hospitals in Korea in 2005 and 2006 Hyukmin Lee 1, Chang Ki Kim 2, Jongwook

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

<303120C6AFC1FD20B9E8C7F6C1D62E687770>

<303120C6AFC1FD20B9E8C7F6C1D62E687770> 대한내과학회지: 제 81 권 제 6 호 2011 특 집(Special Review) - 흔한 감염질환에서의 항생제 내성 및 최신 치료 지역사회 단순 요로감염에서의 항생제 내성 및 최신 치료 한양대학교병원 감염내과 배 현 주 Treatment of Community-Acquired Uncomplicated Urinary Tract Infection Hyunjoo

More information

2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285

2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285 13 2 ( 25 ) 2004 12 Korean J Med Hist 13 284 296 Dec 2004 ISSN 1225 505X 1) * ** ** 1 1920 1930 40 ( 1896-1973) 80 * ** 1) 2003 284 2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914

More information

Microsoft Word - 20-김윤태.doc

Microsoft Word - 20-김윤태.doc J. Exp. Biomed. Sci. 12 (2006) 267 274 Random mplified Polymorphic DN (RPD) nalysis for Extended Spectrum β-lactamase Producing Klebsiella pneumonia Isolated from Clinical Specimens in Korea Yun-Tae Kim

More information

12(2) fm

12(2) fm Journal of Dental Hygiene Science Vol. 12, No. 2, pp. 109~113 (2012) 임상에서분리한 Streptococcus pneumoniae 에서 Levofloxacin 내성유전자의비교연구 최재민 1 박선희 1 윤지아 1 한양금 2 이인수 1 1 한남대학교생명공학과, 2 대전보건대학교치위생 ( 학 ) 과 Comparative

More information

( )Kju225.hwp

( )Kju225.hwp 비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin

More information

대한진단검사의학회지제 26 권제 3 호 2006 Korean J Lab Med 2006;26: 원저 임상미생물학 충주지역에서집단발생한 Extended-spectrum -lactamase 생성 Shigella sonnei 감염의임상적특성 홍성진 1 이창훈 2

대한진단검사의학회지제 26 권제 3 호 2006 Korean J Lab Med 2006;26: 원저 임상미생물학 충주지역에서집단발생한 Extended-spectrum -lactamase 생성 Shigella sonnei 감염의임상적특성 홍성진 1 이창훈 2 대한진단검사의학회지제 26 권제 3 호 2006 Korean J Lab Med 2006;26:168-73 원저 임상미생물학 충주지역에서집단발생한 Extended-spectrum -lactamase 생성 Shigella sonnei 감염의임상적특성 홍성진 1 이창훈 2 왕준호 3 송원근 4 정석훈 5 건국대학교의과대학소아과학교실 1, 진단검사의학교실 2, 내과학교실

More information

untitled

untitled Ann Clin Microbiol Vol. 16, No. 3, September, 213 http://dx.doi.org/1.5145/acm.213.16.3.126 ISSN 2288-585 Molecular Characteristics of bla OXA-23 -Producing Acinetobacter baumannii Isolated from a University

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를 Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는

More information

K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis

More information

03(12-65)p fm

03(12-65)p fm 한국임상약학회지제 23 권제 1 호 Kor. J. Clin. Pharm., Vol. 23, No. 1. 2013 화상감염소아환자에서분리된주요균종에대한항생제의내성률 강주연 신혜순 * 덕성여자대학교약학대학 (2012 년 12 월 28 일접수 2013 년 3 월 2 일수정 2013 년 3 월 4 일승인 ) Antimicrobial Resistance of Clinically

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)

More information

Çмúº¸°í6ÇÏÇý¹Î

Çмúº¸°í6ÇÏÇý¹Î 병원약사회지 (27), 제 34 권제 4 호 J. Kor. Soc. Health-syst. Pharm., Vol. 34, No. 4, 433 ~ 442 (27) Original Article 국내지역사회획득폐렴원인균의경험적항균제에대한내성현황 하혜민 a, 김윤숙 b, 안정미 c, 천부순 a, 인제대학교약학대학 a, 인제대학교해운대백병원약제부 b, 인제대학교상계백병원약제부

More information

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타 RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of

More information

???? 1

???? 1 The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1

More information

<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>

<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770> J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2

More information

674 권순재ㆍ정연중ㆍ윤현진ㆍ목종수ㆍ권지영,.., (Watts et al., 2017)., 70% (Kummerer, 2009). (Witte, 2000)., (Souli et al., 2008)., % ,113 (NIFS, 2017

674 권순재ㆍ정연중ㆍ윤현진ㆍ목종수ㆍ권지영,.., (Watts et al., 2017)., 70% (Kummerer, 2009). (Witte, 2000)., (Souli et al., 2008)., % ,113 (NIFS, 2017 한수지 51(6), 673-681, 2018 Original Article Korean J Fish Aquat Sci 51(6),673-681,2018 용남광도해역의굴 (Crassostrea gigas) 및육상오염원에서분리한대장균 (Escherichia coli) 의항생제내성 권순재 정연중 윤현진 목종수 1 권지영 * 국립수산과학원남동해수산연구소, 1 국립수산과학원식품위생가공과

More information

Kor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의

Kor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의 RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on

More information

안도희외 6 인 : ESBL 생성균주와비생성균주에의한지역사회획득요로감염비교 감염에서균주의항생제감수성에변화를가져왔고특히광범위세팔로스포린에대한내성균의감염이증가하고있다 2). 이러한내성균에의한요로감염은치료실패, 합병증증가및치료기간의연장등과의연관성이제기되고있어관심이증가하고있다

안도희외 6 인 : ESBL 생성균주와비생성균주에의한지역사회획득요로감염비교 감염에서균주의항생제감수성에변화를가져왔고특히광범위세팔로스포린에대한내성균의감염이증가하고있다 2). 이러한내성균에의한요로감염은치료실패, 합병증증가및치료기간의연장등과의연관성이제기되고있어관심이증가하고있다 ORIGINAL ARTICLE pissn 2384-1079 eissn 2384-1087 Pediatr Infect Vaccine 2015;22:29-35 DOI: http://dx.doi.org/10.14776/piv.2015.22.1.29 Extended-Spectrum β-lactamase 생성균주와비생성균주에의한지역사회획득요로감염비교 안도희ㆍ김규원ㆍ조혜경ㆍ차한ㆍ전인상ㆍ류일ㆍ선용한

More information

February 2007

February 2007 Nov 2008 Vol. 16 No. 4 Ser. No. 63 Quarterly ISSN 1226-1734 www.whonetkorea.org Antimicrobial resistance of bacteria isolated during July to September in 2008 at a KONSAR program participating hospital

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic

More information

한국성인에서초기황반변성질환과 연관된위험요인연구

한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -

More information

(

( 317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,

More information

09권오설_ok.hwp

09권오설_ok.hwp (JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4) THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method

More information

untitled

untitled Ann Clin Microbiol Vol., No., September, http://dx.doi.org/./acm... ISSN - Loss of bla and bla IMP- during the Storage of Gram- Bacilli, Antimicrobial Susceptibility of the Gene-Lost Strain, and Location

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

대한한의학원전학회지24권6호-전체최종.hwp

대한한의학원전학회지24권6호-전체최종.hwp 小兒藥證直訣 의 五臟辨證에 대한 小考 - 病證과 處方을 중심으로 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 ㆍ 韓醫學古典硏究所 白裕相1,2*1)2) A study on The Diagnosis and Treatment Using The Theory of Five Organs in Soayakjeungjikgyeol(小兒藥證直訣) 1 Dept. of Oriental

More information

Kang CI 문제가되고있는주요병원균으로는소위 ESKAPE 균주들 이있는데, 이는 Enterococci, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aerugino

Kang CI 문제가되고있는주요병원균으로는소위 ESKAPE 균주들 이있는데, 이는 Enterococci, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aerugino DOI: 10.5124/jkma.2011.54.3.325 pissn: 1975-8456 eissn: 2093-5951 http://jkma.org Pharmacotherapeutics 다제내성그람음성균감염의치료전략 강철인 * 성균관대학교의과대학삼성서울병원감염내과 Therapeutic strategy for the management of multidrug-resistant

More information

..........5-45..

..........5-45.. K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing

More information

KJFP Jeongsook Yoon. Bacterial Strains and Antimicrobial Resistance in Burn Patients 심부화상인경우 Clostridium, Bacteroides 등을감별하기위해무산소성배양을시행해야한다고권장하고있다. 6)

KJFP Jeongsook Yoon. Bacterial Strains and Antimicrobial Resistance in Burn Patients 심부화상인경우 Clostridium, Bacteroides 등을감별하기위해무산소성배양을시행해야한다고권장하고있다. 6) KJFP Original Article http://dx.doi.org/10.21215/kjfp.2016.6.3.179 pissn 2233-9019 eissn 2233-9116 화상창 감염의 균종 및 항균제 감수성률 윤정숙* 서울베스티안병원 진단검사의학과 Bacterial Strains and Antimicrobial Resistance of Wound Infection

More information

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770> 대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실

More information

( )Kju269.hwp

( )Kju269.hwp 만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   * A Research Trend Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities

More information

04조남훈

04조남훈 Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache

More information

지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., KOSPI200.,. * 지능정보연구제 16 권제 1 호 2010 년 3 월

지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., KOSPI200.,. * 지능정보연구제 16 권제 1 호 2010 년 3 월 지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., 2004 5 2009 12 KOSPI200.,. * 2009. 지능정보연구제 16 권제 1 호 2010 년 3 월 김선웅 안현철 社 1), 28 1, 2009, 4. 1. 지능정보연구제 16 권제 1 호 2010 년 3 월 Support

More information

14.531~539(08-037).fm

14.531~539(08-037).fm G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Feb.; 29(2), 93 98. http://dx.doi.org/10.5515/kjkiees.2018.29.2.93 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) UHF-HF

More information

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 16 Jul.; 27(7), 64662. http://dx.doi.org/./kjkiees.16.27.7.646 ISSN 1226-3133 (Print)ISSN 2288-226 (Online) 2D Microwave Image

More information

< BFEBBFAAB0E1B0FABAB8B0EDBCAD2DBCF6C1A42028BCADBFEFB4EB292E687770>

< BFEBBFAAB0E1B0FABAB8B0EDBCAD2DBCF6C1A42028BCADBFEFB4EB292E687770> 제출문 질병관리본부장 귀하 이보고서를 균혈증과요로감염원인균의내성실태및내성기전연구 ( 서울대학교의과대 학 / 김의종 ) 과제의연구결과보고서로제출합니다. 2006. 1. 25 주관연구기관명 : 서울대학교의과대학 주관연구책임자 : 김의종 제 1세부과제명 : 균혈증및요로감염을일으키는주요원인균의내성실태 ( 제1세부연구기관 / 세부과제책임자 ): 서울대학교의과대학 /

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 28(3),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 28(3), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2017 Mar.; 28(3), 163 169. http://dx.doi.org/10.5515/kjkiees.2017.28.3.163 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) PCB

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Sep.; 30(9), 712 717. http://dx.doi.org/10.5515/kjkiees.2019.30.9.712 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) MOS

More information

- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -

More information

<B8F1C2F72E687770>

<B8F1C2F72E687770> 제1장 제17장 성홍열 및 사슬알균 감염증 사슬알균 (Streptococci)은 증식 중의 특징적으로 쌍 또는 사슬모양의 그람양성 알균 으로 catalase 음성, 통성혐기성균이며, 보통 한천배지에서는 발육이 어렵고 혈액이나 혈청 등을 첨가한 배지에서 잘 발육한다. 포도당이나 다른 탄수화물을 분해하나 포도당 을 분해하여 가스를 생성하지 않는다. 이들은 최소

More information

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF. 1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -

More information

Çмúº¸°í5¿À´ÙÇö

Çмúº¸°í5¿À´ÙÇö 병원약사회지 (28), 제 35 권제 호 J. Kor. Soc. Health-syst. Pharm., Vol. 35, No., 48 ~ 58 (28) Original Article 국내병원획득폐렴원인균의경험적항균제에대한내성현황 오다현 a, 김윤숙 a, 천부순 b, 인제대학교해운대백병원약제부 a, 인제대학교약학대학 b The Status of Resistance

More information

untitled

untitled Ann Clin Microbiol Vol. 19, No. 2, June, 2016 http://dx.doi.org/10.5145/acm.2016.19.2.48 pissn 2288-0585 eissn 2288-6850 Distribution and Antimicrobial Resistance of Streptococcus pneumoniae at Four University

More information

10(3)-09.fm

10(3)-09.fm w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½

More information

Æ÷Àå½Ã¼³94š

Æ÷Àå½Ã¼³94š Cho, Mun Jin (E-mail: mjcho@ex.co.kr) ABSTRACT PURPOSES : The performance of tack coat, commonly used for layer interface bonding, is affected by application rate and curing time. In this study, bonding

More information

°Ç°�°úÁúº´5-44È£ÃÖÁ¾

°Ç°�°úÁúº´5-44È£ÃÖÁ¾ K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis

More information

< BFF8C0FA2D B9E8C7F6C1D62E687770>

< BFF8C0FA2D B9E8C7F6C1D62E687770> 대한내과학회지 : 제 권제 호 다약제내성 Pseudomonas aeruginosa 에대한항생제병합효과 한양대학교의과대학감염내과학교실 배현주 In Vitro Effects of Combined Antibiotics against Multidrug-resistant Pseudomonas aeruginosa HyunJoo Pai, M.D. Infectious Diseases,

More information

(웹용)대한가정의학회지-5월호.indd

(웹용)대한가정의학회지-5월호.indd Korean J Fam Med. 2010;31:384-389 doi:10.4082/kjfm.2010.31.5.384 Extended-Spectrum β-lactamase 을생성하는 Escherichia Coli 감염에의한패혈증 1 예 Case Report 이승범, 김춘옥, 강희철 * 연세대학교의과대학가정의학교실 A Case Report of Sepsis by

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jun.; 27(6),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jun.; 27(6), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Jun.; 27(6), 495 503. http://dx.doi.org/10.5515/kjkiees.2016.27.6.495 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Design

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 901 무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 (A Effective Sinkhole Attack Detection Mechanism for LQI based Routing in WSN) 최병구 조응준 (Byung

More information

84 계명의대학술지제 31 권 1 호 2012 μg /ml). Isolation frequency of MDRAB strains was 97.7% (172 strains) and was highly prevalent. Fifty eight (33.0%) strains

84 계명의대학술지제 31 권 1 호 2012 μg /ml). Isolation frequency of MDRAB strains was 97.7% (172 strains) and was highly prevalent. Fifty eight (33.0%) strains 계명의대학술지제 31 권 1 호 Keimyung Med J Vol. 31, No. 1, June, 2012 다약제내성 Acinetobacter baumannii 의 유병율과항균제감수성 계명대학교의과대학미생물학교실, 의과학연구소 서성일 백원기 서민호 High Prevalence and Antimicrobial Drug Susceptibility of Multidrug

More information

untitled

untitled 82 Myungsook Kim, et al. bft Gene Isotypes of Enterotoxigenic Bacteroides fragilis ORIGINAL ARTICLE Korean J Clin Lab Sci. 2016, 48(2):82-87 http://dx.doi.org/10.15324/kjcls.2016.48.2.82 pissn 1738-3544

More information

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract

More information