untitled

Size: px
Start display at page:

Download "untitled"

Transcription

1 Korean J Clin Microbiol Vol. 12, No. 1, March, 2009 Characterization of Class 1 Integrons in Metallo-βlactamase-producing Pseudomonas aeruginosa Ji Youn Sung, Sun Hoe Koo, Kye Chul Kwon, Jong Woo Park, Chi Seon Ko, So Youn Shin, Jeong Hoon Song Department of Laboratory Medicine, College of Medicine, Chungnam National University, Daejeon, Korea Background: The genes of metallo-β-lactamase (MBL), a powerful carbapenemase, are carried as a part of the mobile gene cassettes inserted into integrons playing an important role in rapid dissemination of antibiotic resistance genes among bacterial isolates. In this study, we investigated carbapenemase genes and class 1 integrons integrated into the gene cassettes in imipenem-non susceptible P. aeruginosa. Methods: From July 2006 to March 2008, 81 consecutive, non-duplicate, imipenem-non susceptible P. aeruginosa were isolated at Chungnam National University Hospital in Chungcheong province of Korea. The modified Hodge and double disk synergy tests were conducted for the screening of carbapenemase and MBL production, respectively, and PCR and DNA sequencing were performed for the detection of carbapenemase genes and class 1 integron gene cassettes. We also employed the repetitive element sequence-based (Rep)-PCR method for an epidemiologic study. Results: MBLs were detected in 13.6% (11/81) of imipenem-non susceptible P. aeruginosa. Ten isolates were found to carry bla IMP-1, whereas 1 isolate was found to carry a bla VIM-2. All of the IMP-1-producing strains harbored 4.0 kb class 1 integron containing chloramphenicol, aminoglycoside, and β-lactamresistant genes. However, bla IMP-1 was not detected at class 1 integron. A 2.5 kb class 1 integron harboring bla VIM-2 was detected in a VIIM-2- producing strain. One identical pattern was observed in ten IMP-1 producing strains. Conclusion: IMP-1 producing P. aeruginosa strains are currently distributed throughout Chungcheong province of Korea. In particular, all of the strains harbored class 1 integrons containing variant antibiotic resistance gene cassettes. (Korean J Clin Microbiol 2009;12:17-23) Key Words: Metallo-β-lactamase (MBL), Class 1 integron, Multidrug resistance Pseudomonas aeruginosa 서 녹농균 (Pseudomonas aeruginosa) 은호기성포도당비발효그람음성간균으로병원감염의주요원인균이다. 녹농균에의한감염은대부분기회감염이며, 외이도염, 골수염, 뇌수막염, 심내막염, 폐렴, 요로감염, 균혈증등다양한유형의감염증을유발한다 [1]. 녹농균에의한감염증치료에는 carbapenem계항균제가많이사용되어왔는데이는이항균제가작용범위가넓고, extended spectrum β-lactamase (ESBL) 을포함한대부분의 β-lactamase에의한가수분해에저항성을보여그람음성균의치료에매우효과적이기때문이다 [2]. 그러나최근 carbapenem에내성을보이는녹농균의감염이 Received 3 July, 2008, Revised 13 August, 2008 Accepted 20 October, 2008 Correspondence: Sun Hoe Koo, Department of Laboratory Medicine, College of Medicine, Chungnam National University, 640, Daesadong, Jung-gu, Daejeon , Korea. (Tel) , (Fax) , ( ) shkoo@cnu.ac.kr 론 증가하고있어심각한문제가되고있다 [3]. 녹농균은 carbapenemase의생성, 염색체성 AmpC cephalosporinase의과량생성및 porin 변이, penicillin-binding protein의변화등에의해 carbapenem에대한내성을보인다 [4,5]. 특히획득성 carbapenemase에의한내성은다른균에그내성유전자를전달할수있다는점에서내성확산의우려를낳고있다 [6]. 녹농균이생성하는대표적인 carbapenemase로는 class A의 GES형 β-lactamase[7], class B의 VIM, IMP, SIM, GIM 및 SPM형 metallo-β-lactamase (MBL)[8-12], class D의 OXA-23, OXA-24, OXA-25, OXA-26, OXA-27, OXA-40, OXA-51 및 OXA-58형 β-lactamase[13,14] 등이있다. 이중 MBL은가수분해범위가가장넓으며 bla IMP 및 bla VIM 과같은내성유전자의경우대개 integron 내에위치하는특징이있다 [15,16]. Integron은장소-특이적인재조합기전에의해유전자카세트를인지하고포획하여이동시킬수있는구성요소를가진효율적인유전적기구로많은항균제내성유전자카세트들을종합적으로축적할수있다. 특히 integron에위치한내성유전자 17

2 18 Korean J Clin Microbiol 2009;12(1):17-23 들은발현되거나전파되기가쉬우므로 integron을가지고있는감염균들은항균제에더욱강한내성을보이게된다 [17,18]. 이러한 integron 은 integrase 단백질의상동성에근거를두어최소한 6종류의클래스로분류된다. 그중 class 1은가장흔한구조로 2개의보존적분절인 5 -보존영역 (5 -CS) 과 3 -보존영역 (3 -CS) 을가지고있다 [19]. 본연구에서는충청지역의한대학병원에서분리된 imipenem 비감수성녹농균을대상으로이들이생성하는 carbapenemase의유전형을분석하였다. 또한이유전자들이 class 1 integron에위치하는지를확인하여내성세균의확산방지책을마련하는데필요한기초자료를제공하고자하였다. 재료및방법 1. 균주의수집 2006년 7월부터 2008년 3월까지충남대학교병원진단검사의학과에의뢰된임상검체로부터분리된녹농균중 imipenem 에비감수성을보인 81주를대상으로하였다. 항균제내성에상관없이분리된순서대로균주를수집하였으며, 동일환자에서반복분리된균주는수집대상에서제외하였다. 분리된균주의균종은전통적인생화학적방법및 Vitek II GNI card (biomerieux Vitek Inc., Hazelwood, MO, USA) 로확인하였다. 2. 항균제감수성시험 Clinical and Laboratory Standards Institute (CLSI) 지침에따라 [20] amikacin, gentamicin, netilmicin, tobramycin, ceftazidime, imipenem, piperacillin, ticarcillin 및 ciprofloxacin (BBL Microbiology Systems, Cockeysville, MD, USA) 과 aztreonam, cefepime 및 meropenem (Oxoid, Cambridge, UK) 에대한감수성을 Mueller-Hinton 한천 (Difco, Cockeysville, MD, USA) 을사용하여디스크확산법으로확인하였다. 정도관리를위해서 Escherichia coli ATCC 25922와 P. aeruginosa ATCC 27853을동시에시험하여허용범위에드는지를확인하였다. 3. β-lactamase 생성검사 1) Carbapenemase 생성선별검사 : Hodge 변법을이용하여 carbapenemase 생성균주를선별하였다 [21]. E. coli ATCC 25922의탁도를 0.5 McFarland로맞춘후멸균된면봉을이용하여 Mueller-Hinton 한천 (Difco) 에고르게접종하였다. 그위에시험균주를백금이로평판의가운데로부터가장자리로향하여한줄로굵게접종한다음배지의중앙에 imipenem 디스크 (10μg, BBL) 를놓고 35 o C에서 18시간배양하였다. 시험균주를접종한선의중앙쪽말단부에생기는억제영역이다른부위에비해서더넓게생기면양성으로판정하였다. 2) Metallo-β-lactamase 생성선별검사 : Carbapenemase 생성균주를대상으로 double disk synergy시험 [21] 을이용하여 MBL 생성균주를선별하였다. 먼저대상균주의탁도를 0.5 McFarland 로맞춘후멸균된면봉을이용하여 Mueller-Hinton 한천 (Difco) 에고르게접종하였다. Imipenem 디스크 (10μg, BBL) 와 EDTA (750μg, Sigma Chemical Co., St. Louis, MO. USA) 및 sodium mercaptoacetic acid (2 mg, Sigma Chemical Co.) 가포함되어있는디스크를간격이 10 mm가되도록하여놓은후 35 o C 항온기에 18시간배양하였다. 두디스크사이에서상승효과에의한억제대의확장현상이관찰되면양성으로판정하였다. 4. β-lactamase 유전형확인 β-lactamase의유전형을분석하기위해이미보고된바있는기존의시발체를사용하여중합효소연쇄반응 (Polymerase Chain Reaction, PCR) 을시행하였다 (Table 1). 대상균주를 brain heart infusion broth (Difco) 에접종하여 37 o C에서하룻밤진탕배양한후 DNA purification kit (Promega, Madison, WI, USA) 을사용하여배양액으로부터 DNA를추출하였다. DNA 추출액 (5μL), 10 Taq buffer (2.5μL), 10 mm dntp mix (0.5 μl), primer 각 10 pmol, 0.7 U Taq DNA polymerase ( 바이오니아, 대전, 한국 ) 및증류수를혼합하여 25μL 의반응용액을만들었다. Gene Amp PCR System 9600 (Perkin-Elmer Cetus Corp., Norwalk, CT, USA) 으로 95 o C에서 5분간반응시킨후, 95 o C에서 20초, 59 o C에서 40초, 72 o C에서 30초씩 30회증폭반응시키고, 72 o C에서 5분간연장반응시켰다. 각각의 PCR 생산물을 ethidium bromide가포함된 1% agarose gel에서 40분간전기영동하여밴드를확인하였다. 증폭산물을 DNA extraction kit (Qiagen, Hilden, Germany) 로분리후, BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Foster City, CA, USA) 와 ABI PRISM 3730xl DNA analyzer (PE Applied Biosystems) 를이용하여염기서열을분석하였다. 5. Class 1 integron 의검출과유전자카세트의유전형확인 Class 1 integron을검출하기위해이미보고된바있는기존의 5 보존영역 (GGCATCCAAGCAGCAAG) 과 3 보존영역 (A- AGCAGACTTGACCTGA) 의분절을시발체로하여 PCR을수행하였다 [30]. β-lactamase 유전형을분석할때와같은조성의반응용액 25μL 를 95 o C에서 5분간반응시킨후, 94 o C에서 1분, 55 o C에서 1분, 72 o C에서 4분씩 30회증폭반응시키고, 72 o C에서 10분간연장반응시켰다. Class 1 integron 내에존재하는유전자카세트의유전형은 primer walking 방법으로확인하였다. 5 보존영역과 3 보존영역의분절을시발체로하여얻어진각각의 PCR 산물을염기서열분석한뒤, 말단부분에서다시새로운시발체를디자인하

3 Ji Youn Sung, et al. : Class 1 Integrons in MBL-producing Pseudomonas aeruginosa 19 여 PCR을수행하고염기서열분석을하는일련의과정을되풀이하여전체염기서열을분석하였다. 6. Repetitive element sequence-based (Rep)-PCR 에의한역학적연관성조사 DNA purification kit (Promega) 로대상균주의염색체 DNA 를추출하여주형 DNA로사용하였다. Primer 로는 ERIC2 (5'- AAGTAAGTGACTGGGGTGAGCG-3') 와 REP2-Dt (5'-NCGN- CTTATCNGGCCTAC-3') 로명명된장내세균의반복서열을이용하였다 [31]. 증폭반응은 DNA 추출액 (5.0μL), 10 Taq buffer (5.0μL), 10 mm dntp mix (1.0μL), primer 각 20 pmol, 1.4 U Taq DNA polymerase ( 바이오니아 ) 및증류수를혼합하 Table 1. Oligonucleotide primers for amplification and sequencing Enzyme Primer Amplicon Target Sequence (5-3 ) Reference class pairs size (bp) Class A PER1 F bla PER1 GTTAATTTGGGCTTAGGGCAGA PER1 R CAGCGCAATCCCCACTGT PSE F bla PSE AATGGCAATCAGCGCTTC PSE R GCGCGACTGTGATGTATA VEB F bla VEB CGACTTCCATTTCCCGATGC VEB R GGACTCTGCAACAAATACGC GES F bla GES, bla IBC GTTAGACGGGCGTACAAAGATAAT GES R TGTCCGTGCTCAGGATGAGT Class B IMP F bla IMP CATGGTTTGGTGGTTCTTGT IMP R ATAATTTGGCGGACTTTGGC VIM F bla VIM ATTGGTCTATTTGACCGCGTC VIM R TGCTACTCAACGACTGAGCG SIM F bla SIM GTACAAGGGATTCGGCATCG SIM R TGGCCTGTTCCCATGTGAG SPM F bla SPM CTAAATCGAGAGCCCTGCTTG SPM R CCTTTTCCGCGACCTTGATC GIM F bla GIM TCAATTAGCTCTTGGGCTGAC GIM R CGGAACGACCATTTGAATGG Class D OXA-23F bla OXA-23, 27, 49 GATGTGTCATAGTATTCGTCG 1, OXA-23R TCACAACAACTAAAAGCACTG OXA-24F bla OXA-24, 25, 26, 40, 72 GTACTAATCAAA GTTGTGAA OXA-24R TTCCCCTAACATGAATTTGT OXA-51F bla OXA-51like TGAACATTAAAICACTCTT OXA-51R CTATAAAATACCTAATTGTT OXA-58F bla OXA-58 CGATCAGAATGTTCAAGCGC OXA-58R ACGATTCTCCCCTCTGCGC Abbreviations: F, forward; R, reverse. Table 2. Antimicrobial susceptibilities of Pseudomonas aeruginosa isolates % susceptibility Antimicrobial agents Total isolated P. aeruginosa (n=81) IMP-1 producing P. aeruginosa (n=10) Intermediate Resistant Intermediate Resistant Amikacin Gentamicin Netilmicin Tobramycin Aztreonam Ceftazidime Cefepime Imipenem Meropenem Piperacillin Ticarcillin Ciprofloxacin

4 20 Korean J Clin Microbiol 2009;12(1):17-23 여 50μL 의혼합액으로시행하였다. 95 o C에서 5분간반응시킨후, 90 o C에서 40초, 42 o C에서 1분, 68 o C에서 7분씩 35회증폭반응시키고, 70 o C에서 15분간연장반응시켰다. 증폭산물 (10 μl) 은 ethidium bromide 가포함된 2% agarose gels에전기영동한후 BioDoc-14 TM Imaging system (UVP, Cambridge, UK) 을이용하여분석하였다. 결과 1. 항균제감수성양상시험기간중총 81주의 imipenem 비감수성녹농균이의뢰된임상검체에서분리되었다. 이균주들을대상으로항균제감수성시험을한결과 imipenem과 ciprofloxacin에대한내성률이각각 76.5% 로가장높았으며그다음으로 gentamicin (70.4%) 이높았다. 반면에 aztreonam은 42.0% 로가장낮은내성률을보였다 (Table 2). 2. β-lactamase 생성검사대상균주 81주중 11주 (13.6%) 가 carbapenemase 생성선별검사 (cloverleaf test) 에서양성반응을보였으며이균주들을대상으로 double disk synergy 시험을수행한결과 11주모두에서상승효과가관찰되었다. 따라서대상균주가생성하는 carbapenemase 는모두 MBL인것으로확인되었다. 3. β-lactamase 유전형확인 MBL 생성선별검사에서양성반응을나타낸 11주를대상으로 β-lactamase 유전자검출을위한 PCR을수행한결과 1주만이 VIM형이었고그외 10주는모두 IMP형이었다. 이들을대상으로염기서열을분석한결과 bla VIM 에대한증폭산물은 bla VIM-2 의염기서열과일치하였으며 bla IMP 에대한증폭산물은 bla IMP-1 의염기서열과일치하였다. 한편 81주의 imipenem 비감수성녹농균에서 Ambler class A 와 D에속하는 carbapenemase 유전자는검출되지않았다. 4. Class 1 integron 의검출과유전자카세트의유전형확인 MBL을생성하는 11주모두에서 2.5 kb 또는 4.0 kb 크기의 class 1 integron이검출되었다. VIM-2 생성균주는 2.5 kb 크기의 integron을, IMP-1 생성균주는 4.0 kb 크기의 integron을각각가지고있었다. 검출된 integron의염기서열분석결과 VIM-2 생성균주에서검출된 2.5 kb 크기의 integron 내에는 VIM-2 유전자가위치해있었으나 IMP-1 생성균주에서검출된 4.0 kb 크기의 integron 내에는 IMP-1 유전자가위치해있지않았다 (Fig. 1). 5. Repetitive element sequence-based PCR (Rep-PCR) 에의한역학적연관성조사 11주의 MBL 생성균주를대상으로 Rep-PCR을수행한결과 10주의 IMP-1 생성균주는모두동일한밴드패턴을보였으나 VIM-2 생성균주는 (P28) IMP-1 생성균주와는다른밴드패턴을보였다 (Fig. 2). 고찰최근 carbapenem에도내성을보이는다제내성녹농균의감염이증가하고있어임상적으로많은문제가되고있다 년 KONSAR surveillance 조사에의하면 imipenem 내성인녹농균의비율이 20% 로높았고그중대부분은다제내성이었다 [32]. 이와같이 carbapenem 내성녹농균의분리율이점차증가하고있으나, carbapenem 내성에관여하는유전자의국내보유현황에대한정보는아직많이부족하다. 본연구에서는 imipenem 비감수성녹농균을대상으로 carbapenem 내성획득에중요한역할을하는 carbapenemase의유전형을조사하였다. 대상균주 81주중총 11주 (13.6%) 가 carbapenemase 유전자를가지고있었고그중 10주가 IMP-1을생성하였다. 반면, VIM-2 를생성하는균주는한주뿐이었다. VIM-2 생성녹농균은 1998년국내에처음으로보고되었으며 [33] 2003년국내에서분리된 carbapenem 비감수성녹농균중 Fig. 1. Schematic representation of gene cassette structure located in the class 1 integron isolated from Pseudomonas aeruginosa. The horizontal arrows indicate the translation orientation of the genes. Fig. 2. Repetitive element sequence-based (Rep)-PCR patterns of genomic DNA from eleven MBL producing Pseudomonas aeruginosa. Lane M is 1 kb DNA size marker.

5 Ji Youn Sung, et al. : Class 1 Integrons in MBL-producing Pseudomonas aeruginosa % 를차지하였다 [34]. 2005년의보고에서도 [35] 18.1% 에해당하는 carbapenem 비감수성녹농균이 VIM-2를생성하는것으로나타나국내에는 VIM-2가흔한것임이밝혀졌다. 이에반해 IMP-1 생성균주의분리는드물었다. 그러나 2005년 Yoon 등에의해 IMP-1형이 imipenem내성녹농균사이에서확산되고있음이보여졌다 [14]. 본연구에서도 IMP-1형의검출률이 12.3% 로나타나전체검출된 MBL 중 90.9% 를차지한반면 VIM-2를생성하는균주는단한주뿐이었다. 이는국내에서 IMP-1형 MBL을생성하는녹농균이빠르게확산되고있음을시사한다. IMP-1 및 VIM-2 등의 MBL 유전자는대부분은 class 1 integron에유전자카세트로존재하는데이런특징은이들내성유전자가다른균종으로쉽게전달될수있음을뜻한다. 특히 MBL 유전자카세트를가진 integron은 aminoglycoside 내성유전자등다양한내성유전자카세트도함께가진것이많아 integron 보유가다제내성의원인이된다 [36]. 본연구에서도 MBL 생성균주모두가 class 1 integron을가지고있는것으로나타나 integron이녹농균사이에광범위하게확산되어있음을확인할수있었다. VIM-2 를생성하는균주는 2.5 kb 크기의 class 1 integron을가지고있었는데이 integron은 VIM-2 유전자외에도 aminoglycoside 내성유전자인 aada1을가지고있었다. 이러한 integron의구조는 2006년러시아에서분리된녹농균에서처음보고되었으며국내에서도유사한구조가 Enterobacter cloacae에서보고된바있다 [37,38]. 한편 IMP-1을생성하는균주는모두동일한 4.0 kb 크기의 class 1 integron을가지고있었는데이 integron에는 IMP-1 유전자가위치해있지않았다. 지금까지보고된 IMP-1 생성녹농균에서 IMP-1 유전자는대부분 class 1 integron에위치해있었으나 [39] 본연구에서는 IMP-1 유전자를증폭된 class 1 integron에서찾을수없었다. 반면 OXA형 β-lactamase 유전자인 bla oxa-10, aminoglycoside 내성유전자인 aaca2 및 aadb, 그리고 chloramphenicol 내성유전자인 cmla1 등이 integron에위치해있었다. 이러한내성유전자들은녹농균이다양한항균제에대해내성을갖게하는요인이된다. 본연구에서도 IMP-1 을생성하는녹농균의항균제내성률이 aztreonam과 piperacillin을제외한모든시험대상항균제에대해 100% 인것으로나타나이를뒷받침하였다 (Table 2). MBL 생성균주를대상으로 Rep-PCR을시행한결과, IMP-1 을생성하는 10개의균주가유사한패턴을보였다. 이는 IMP-1 생성균주들이유전적으로매우유사하며이균주들에의해돌발감염이일어났음을의미한다. 본연구에서 imipenem 비감수성녹농균을대상으로 carbapenemase 유전형을분석하였으나실제로 carbapenemase를가지고있었던균주는총 81주중 11주 (13.6%) 뿐이었다. 이는 carbapenem내성원인이 MBL 생성에이외의다른요인들, 즉염 색체성 cephalosporinase를과량생성또는항균제의유출, 세포막의투과성감소등에의한것임을추측하게한다 [4,5]. 따라서내성기전을정확히밝히려면이들에관한추가적인연구가필요하다하겠다. 이상의결과에서충청지역의한대학병원에서분리된 imipenem 비감수성녹농균에확산되어있는 carbapenemase 는주로 IMP-1형 MBL로과거에비하여분리율이증가되고있는것으로나타났다. 또한 IMP-1 생성녹농균은다양한항균제내성유전자카세트가포함된 integron의보유를통해많은항균제에대해내성을나타낼수있음이확인되었다. 감사의글 본연구는 2007 충남대학교학술연구비지원에의하여수행되었음. 참고문헌 1. Bergogne-Berezin E. Pseudomonas and miscellaneous gram-negative bacilli. In: Cohen J and Powerly WG, eds. Infectious Diseases. New York; Mosby, 2004: Jacoby GA and Medeiros AA. More extended-spectrum β-lactamases. Antimicrob Agents Chemother 1991;35: Song W, Woo HJ, Kim JS, Lee KM. In vitro activity of β-lactams in combination with other antimicrobial agents against resistant strains of Pseudomonas aeruginosa. Int J Antimicrob Agents 2003; 21: Fernańdez-Cuenca F, Martinez-Martinez L, Conejo MC, Ayala JA, Perea EJ, Pascual A. Relationship between β-lactamase production, outer membrane protein and penicillin-binding protein profiles on the activity of carbapenems against clinical isolates of Acinetobacter baumannii. J Antimicrob Chemother 2003;51: Clark RB. Imipenem resistance among Acinetobacter baumannii: association with reduced expression of a kda outer membrane protein. J Antimicrob Chemother 1996;38: Yu YS, Yang Q, Xu XW, Kong HS, Xu GY, Zhong BY. Typing and characterization of carbapenem-resistant Acinetobacter calcoaceticus-baumannii complex in a Chinese hospital. J Med Microbiol 2004;53: Poirel L, Weldhagen GF, Naas T, De Champs C, Dove MG, Nordmann P. GES-2, a class A β-lactamase from Pseudomonas aeruginosa with increased hydrolysis of imipenem. Antimicrob Agents Chemother 2001;45: Watanabe M, Iyobe S, Inoue M, Mitsuhashi S. Transferable imipenem resistance in Pseudomonas aeruginosa. Antimicrob Agents Chemother 1991;35: Lee K, Lim JB, Yum JH, Yong D, Chong Y, Kim JM, et al. bla VIM-2 cassette-containing novel integrons in metallo-β-lactamase-producing Pseudomonas aeruginosa and Pseudomonas putida isolates disseminated in a Korean hospital. Antimicrob Agents Chemother 2002;46: Toleman MA, Simm AM, Murphy TA, Gales AC, Biedenbach DJ, Jones RN, et al. Molecular characterization of SPM-1, a novel metallo-β-lactamase isolated in Latin America: report from the

6 22 Korean J Clin Microbiol 2009;12(1):17-23 SENTRY antimicrobial surveillance programme. J Antimicrob Chemother 2002;50: Castanheira M, Toleman MA, Jones RN, Schmidt FJ, Walsh TR. Molecular characterization of a β-lactamase gene, bla GIM-1, encoding a new subclass of metallo-β-lactamase. Antimicrob Agents Chemother 2004;48: Lee K, Yum JH, Yong D, Lee HM, Kim HD, Docquier JD, et al. Novel acquired metallo-β-lactamase gene, bla SIM-1, in a class 1 integron from Acinetobacter baumannii clinical isolates from Korea. Antimicrob Agents Chemother 2005;49: Bou G, Oliver A, Martinez-Beltrań J. OXA-24, a novel class D β- lactamase with carbapenemase activity in an Acinetobacter baumannii clinical strain. Antimicrob Agents Chemother 2000;44: Yoon WS, Lee BY, Bae IK, Kwon SB, Jeong SH, Jeong TJ, et al. Prevalence of imipenem-resistant Pseudomonas aeruginosa isolates and mechanisms of resistance. Korean J Clin Microbiol 2005; 8: Kim IS, Oh WI, Song JH, Lee NY. Screening and identification of metallo-β-lactamase gene in clinical isolates of imipenem-resistant Pseudomonas aeruginosa. Korean J Lab Med 2004;24: Poirel L, Naas T, Nicolas D, Collet L, Bellais S, Cavallo JD, et al. Characterization of VIM-2, a carbapenem-hydrolyzing metallo-βlactamase and its plasmid- and integron-borne gene from a Pseudomonas aeruginosa clinical isolate in France. Antimicrob Agents Chemother 2000;44: Recchia GD and Hall RM. Gene cassettes: a new class of mobile element. Microbiology 1995;141: Richet HM, Mohammed J, McDonald LC, Jarvis WR. Building communication networks: international network for the study and prevention of emerging antimicrobial resistance. Emerg Infect Dis 2001;7: Ploy MC, Lambert T, Couty JP, Denis F. Integrons: an antibiotic resistance gene capture and expression system. Clin Chem Lab Med 2000;38: Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; sixteenth informational supplement. M100-S10(M2). Wayne, Pensylvania: CLSI, Lee K, Lim YS, Yong D, Yum JH, Chong Y. Evaluation of the Hodge test and the imipenem-edta double-disk synergy test for differentiating metallo-β-lactamase-producing isolates of Pseudomonas spp. and Acinetobacter spp. J Clin Microbiol 2003;41: Kim JM, Kang HK, Jeong SH, Bae IK, Kwon SB, Cho BK, et al. Prevalence of PER-1 extended-spectrum β-lactamase-clinical isolates of Acinetobacter baumannii in a university hospital, Busan, Korea. Korean J Clin Microbiol 2004;7: De Champs C, Poirel L, Bonnet R, Sirot D, Chanal C, Sirot J, et al. Prospective survey of β-lactamases produced by ceftazidimeresistant Pseudomonas aeruginosa isolated in a French hospital in Antimicrob Agents Chemother 2002;46: Naas T, Benaoudia F, Massuard S, Nordmann P. Integron-located VEB-1 extended-spectrum β-lactamase gene in a Proteus mirabilis clinical isolate from Vietnam. J Antimicrob Chemother 2000;46: Park JH, Lee SH, Jeong SH, Kim BN, Kim KB, Yoon JD, et al. Characterization and prevalence of Escherichia coli and Klebsiella pneumoniae isolates producing an extended spectrum β-lactamase from Korean hospitals. Korean J Lab Med 2003;23: Jeon BC, Jeong SH, Bae IK, Kwon SB, Lee K, Young D, et al. Investigation of a nosocomial outbreak of imipenem-resistant Acinetobacter baumannii producing the OXA-23-β-lactamase in Korea. J Clin Microbiol 2005;43: Mendes RE, Kiyota KA, Monteiro J, Castanheira M, Andrade SS, Gales AC, et al. Rapid detection and identification of metallo-βlactamase-encoding genes by multiplex real-time PCR assay and melt curve analysis. J Clin Microbiol 2007;45: Pournaras S, Markogiannakis A, Ikonomidis A, Kondyli L, Bethimouti K, Maniatis AN, et al. Outbreak of multiple clones of imipenem-resistant Acinetobacter baumannii isolates expressing OXA-58 carbapenemase in an intensive care unit. J Antimicrob Chemother 2006;57: Heritier C, Dubouix A, Poirel L, Marty N, Nordmann P. A nosocomial outbreak of Acinetobacter baumannii isolates expressing the carbapenem-hydrolysing oxacillinase OXA-58. J Antimicrob Chemother 2005;55: Le vesque C, Piche L, Larose C, Roy PH. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob Agents Chemother 1995;39: Shannon KP and French GL. Increasing resistance to antimicrobial agents of Gram-negative organisms isolated at a London teaching hospital, J Antimicrob Chemother 2004;53: Lee K, Park KH, Jeong SH, Lim HS, Shin JH, Yong D, et al. KONSAR group. Further increase of vancomycin-resistant Enterococcus faecium, amikacin- and fluroquinolone-resistant Klebsiella pneumoniae, and imipenem-resistant Acinetobacter spp. in Korea: 2003 KONSAR surveillance. Yonsei Med J 2006;47: Lee K, Chong Y, Shin HB, Yong D. Rapid increase of imipenemhydrolyzing Pseudomonas aeruginosa in a Korean hospital. Abstr E-85, 38th ICAAC, Lee K, Lee WG, Uh Y, Ha GY, Cho J, Chong Y, et al. VIM- and IMP-type metallo-β-lactamase-producing Pseudomonas spp. and Acinetobacter spp. in Korean hospitals. Emerg Infect Dis 2003; 9: Kim IS, Lee NY, Ki CS, Oh WS, Peck KR, Song JH. Increasing prevalence of imipenem-resistant Pseudomonas aeruginosa and molecular typing of metallo-β-lactamase producers in a Korean hospital. Microb Drug Resist 2005;11: Jang SJ. The role of integrons in the spread of multi-drug resistance. Korean J Clin Microbiol 2005;8: Shevchenko O, Edelstein M, Kretchikov V, Stratchounski L. Characterization of class 1 integrons carrying the genes for VIMand IMP-type metallo-β-lactamases in Pseudomonas aeruginosa strains from Russia. Abstr P-1407, 16th ESCMID, Jeong SH, Lee K, Chong Y, Yum JH, Lee SH, Choi HJ, et al. Characterization of a new integron containing VIM-2, a metallobeta-lactamase gene cassette, in a clinical isolate of Enterobacter cloacae. J Antimicrob Chemother 2003;51: Ozgumus OB, Caylan R, Tosun I, Sandalli C, Aydin K, Koksal I. Molecular epidemiology of clinical Pseudomonas aeruginosa isolates carrying IMP-1 metallo-β-lactamase gene in a University Hospital in Turkey. Microb Drug Resist 2007;13:191-8.

7 Ji Youn Sung, et al. : Class 1 Integrons in MBL-producing Pseudomonas aeruginosa 23 = 국문초록 = Metallo-β-lactamase 생성녹농균에서 Class 1 Integron 의유전형분석 충남대학교의과대학진단검사의학교실성지연, 구선회, 권계철, 박종우, 고지선, 신소연, 송정훈 배경 : 강력한 carbapenemase인 metallo-β-lactamase (MBL) 유전자는세균간의내성유전자확산에중요한역할을하는 integron에존재하는경우가많다. 본연구에서는 imipenem 비감수성녹농균을대상으로 carbaepenmase의유전형을분석하고이유전자들이 class 1 integron에위치하는지를확인하였다. 방법 : 2006년 7월부터 2008년 3월까지충남대학교병원에서분리된 imipenem 비감수성녹농균 81주를대상으로하였다. Hodge 변법과 double disk synergy 시험을이용하여각각 carbapenemase와 MBL의생성여부를결정하였고 PCR과염기서열분석을통하여 carbapenemase 유전자와 class 1 integron의유전형을분석하였다. 역학연구는 repetitive element sequence-based (Rep)-PCR로하였다. 결과 : Imipenem 비감수성녹농균 81주중 13.6% 에해당하는 11주가 MBL을생성하는것으로나타났다. 이들중 10주가 bla IMP-1 을가지고있던반면 bla VIM-2 를가지고있던균주는단한주뿐이었다. IMP-1 생성주의경우모두 4.0 kb의 integron을가지고있는것으로나타났으며이 integron에는 chloramphenicol, aminoglycoside 및 β-lactam 항균제내성유전자가위치해있었다. 그러나 bla IMP-1 은 integron 상에위치해있지않았다. 반면 VIM-2 생성균주에서는 bla VIM-2 가 2.5 kb의 integron 상에위치해있었다. 10주의 IMP-1 생성균주는 Rep-PCR에서한가지의동일한밴드패턴을보였다. 결론 : IMP-1 β-lactamase를생성하는녹농균이충청지역에확산되어있으며특히이균주들은모두다양한항균제내성유전자카세트가포함된 class 1 integron을가지고있었다. [ 대한임상미생물학회지 2009;12:17-23] 교신저자 : 구선회, , 대전시중구대사동 640 충남대학교병원진단검사의학과 Tel: , Fax: shkoo@cnu.ac.kr

untitled

untitled Korean J Clin Microbiol Vol. 11, No. 2, October, 2008 Characteristics of Acquired β-lactamase Gene in Clinical solates of Multidrug-resistant Pseudomonas aeruginosa un Yang Chung 1, Ji Youn ung 2, Kye

More information

12_HM hwp

12_HM hwp The Korean Journal of Microbiology (2010) Vol. 46, No. 3, pp. 303-307 Copyright c 2010, The Microbiological Society of Korea 단보 국내에서분리된 Acinetobacter baumannii 의 Integron 과연관된다제내성분석 김성환 최지혜 박은진 서인원 손승렬

More information

< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770>

< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770> 대한임상검사학회지 : 40권제2호, 75-79, 2008 ISSN 1738-3544 대구지역병원에서분리된 Acinetobacter baumannii와 Pseudomonas aeruginosa의항생제내성현황 대구보건대학임상병리과 1, 세명대학교임상병리학과 2 김수정 1 이재식 2 Antibiotic Resistance Patterns of Acinetobacter

More information

untitled

untitled ORIGINAL ARTICLE Korean J Clin Lab Sci. Vol. 45, No. 1, Mar. 2013 21 Korean J Clin Lab Sci. 2013, 45(1):21-25 ISSN 1738-3544 Errors of Antibiotic Susceptibility Testing from Automated and Manual Systems

More information

untitled

untitled Ann Clin Microbiol Vol., No., September, http://dx.doi.org/./acm... ISSN - Loss of bla and bla IMP- during the Storage of Gram- Bacilli, Antimicrobial Susceptibility of the Gene-Lost Strain, and Location

More information

296 Korean J Lab Med 2010;30: S. maltophila 감염증치료에는낮은항균제내성률을보이는 trimethoprim/sulfamethoxazole (TMP/SMX) 이일차치료제로사용되고있으며, quinolone, moxalactam,

296 Korean J Lab Med 2010;30: S. maltophila 감염증치료에는낮은항균제내성률을보이는 trimethoprim/sulfamethoxazole (TMP/SMX) 이일차치료제로사용되고있으며, quinolone, moxalactam, Korean J Lab Med 2010;30:295-300 DOI 10.3343/kjlm.2010.30.3.295 Original Article Clinical Microbiology Analysis of Acquired Resistance Genes in Stenotrophomonas maltophilia Jeong Hoon Song, M.D. 1, Ji

More information

untitled

untitled Korean J Clin Microbiol Vol. 13, No. 1, March, 2010 DOI: 10.5145/KJCM.2010.13.1.27 Carbapenem Resistance Mechanisms and Molecular Epidemiology of Acinetobacter spp. from Four Hospitals in Seoul and Gyeonggi

More information

untitled

untitled 210 Ji Youn Sung. PMQR Genes among CTX-M-14 Producing E. coli ORIGINAL ARTICLE Korean J Clin Lab Sci. 2016, 48(3):210-216 http://dx.doi.org/10.15324/kjcls.2016.48.3.210 pissn 1738-3544 eissn 2288-1662

More information

KJFP Jeongsook Yoon. bla VIM-2 of Pseudomonas aeruginosa in primary hospitals in Korea Vitek(Biomerieux, Marcy 1 Etoile, France) 으로균을동정하였다. 항균제감수성검사는디

KJFP Jeongsook Yoon. bla VIM-2 of Pseudomonas aeruginosa in primary hospitals in Korea Vitek(Biomerieux, Marcy 1 Etoile, France) 으로균을동정하였다. 항균제감수성검사는디 KJFPpISSN 2233-9019 eissn 2233-9116 Original Article 한국 1 차병원의 Pseudomonas aeruginosa 에서 blavim-2 유전자관찰 윤정숙 서울베스티안병원 bla VIM-2 of Pseudomonas aeruginosa in primary hospitals in Korea Jeong-sook Yoon Director

More information

untitled

untitled Korean J Clin Microbiol Vol., No., December, 20 http://dx.doi.org/0.55/kjcm.20...3 Chromosomal Mutations in oprd, gyra, and parc in Carbapenem Resistant Pseudomonas aeruginosa Ji Youn Sung, Hye Hyun Cho

More information

2 - ceftazidime-clavulanate 디스크를이용하여 ESBL 생성균주를확인하였다. 또한 2009년도에수집된균주인 P. aeruginosa(386주 ), A. baumannii(349주 ) 를대상으로 imipenem에대한감수성을확인하였고 imipenem-h

2 - ceftazidime-clavulanate 디스크를이용하여 ESBL 생성균주를확인하였다. 또한 2009년도에수집된균주인 P. aeruginosa(386주 ), A. baumannii(349주 ) 를대상으로 imipenem에대한감수성을확인하였고 imipenem-h 1 - 국내종합병원을대상으로한항균제내성모니터링 Monitoring of antimicrobial resistance on general hospitals in Korea 질병관리본부국립보건연구원감염병센터약제내성과 연세대학교의과대학진단검사의학교실, 세균내성연구소 Ⅰ. 들어가는말 항균제내성세균의출현과확산으로인하여세균감염증치료는점점어려워지고있다 [1-4]. 항균제내성률은흔히국가간,

More information

ORIGINAL ARTICLE Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist

ORIGINAL ARTICLE   Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist ORIGINAL ARTICLE http://dx.doi.org/10.15263/jlmqa.2015.37.4.209 Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resistance: MicroScan versus Etest Goeun Kang, Hyun Soo Kim,

More information

400 김정민 신경섭 집락을쉽게형성하여장기입원환자나비뇨기계질환이있는노인에서흔히감염을일으킬수있다 [2, 3]. P. rettgeri는 P. stuartii보다 aminoglycoside, cephalosporin 및페니실린계항균제에대한내성률이낮으며, 다제내성인경우도드물다

400 김정민 신경섭 집락을쉽게형성하여장기입원환자나비뇨기계질환이있는노인에서흔히감염을일으킬수있다 [2, 3]. P. rettgeri는 P. stuartii보다 aminoglycoside, cephalosporin 및페니실린계항균제에대한내성률이낮으며, 다제내성인경우도드물다 대한진단검사의학회지 : 제 25 권제 6 호 2005 Korean J Lab Med 2005; 25: 399-405 임상미생물학 요검체에서분리된 Providencia rettgeri 에서 VIM-2형 Metallo- -Lactamase의생성 김정민 신경섭 1 경북대학교의과대학미생물학교실, 충북대학교의과대학진단검사의학교실 1 Production of VIM-2

More information

A. baumannii 와 P. aeruginosa 의 ESBL 생성현황 15 인하여광범위 -lactam 제제일부를포함한여러항균제에내재적내성이지만, ceftazidime, piperacillin, ticarcillin 등은이들세균에비교적강한항균력을지닌다 [3]. Cla

A. baumannii 와 P. aeruginosa 의 ESBL 생성현황 15 인하여광범위 -lactam 제제일부를포함한여러항균제에내재적내성이지만, ceftazidime, piperacillin, ticarcillin 등은이들세균에비교적강한항균력을지닌다 [3]. Cla 대한진단검사의학회지제 26 권제 1 호 2006 Korean J Lab Med 2006;26:14-20 원저 임상미생물학 임상검체에서분리된 Acinetobacter baumannii와 Pseudomonas aeruginosa의 Class A Extended-Spectrum -Lactamase 생성현황 오세진 이상욱 황현용 1 배일권 1 조현수 1 이병호 1

More information

untitled

untitled ORIGINAL ARTICLE Korean J Clin Lab Sci. 2016, 48(3):217-224 http://dx.doi.org/10.15324/kjcls.2016.48.3.217 pissn 1738-3544 eissn 2288-1662 Korean J Clin Lab Sci. Vol. 48, No. 3, September 2016 217 An Analysis

More information

Kang CI 문제가되고있는주요병원균으로는소위 ESKAPE 균주들 이있는데, 이는 Enterococci, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aerugino

Kang CI 문제가되고있는주요병원균으로는소위 ESKAPE 균주들 이있는데, 이는 Enterococci, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aerugino DOI: 10.5124/jkma.2011.54.3.325 pissn: 1975-8456 eissn: 2093-5951 http://jkma.org Pharmacotherapeutics 다제내성그람음성균감염의치료전략 강철인 * 성균관대학교의과대학삼성서울병원감염내과 Therapeutic strategy for the management of multidrug-resistant

More information

untitled

untitled ORIGINAL ARTICLE Korean J Clin Lab Sci. 2017;49(4):427-434 https://doi.org/10.15324/kjcls.2017.49.4.427 pissn 1738-3544 eissn 2288-1662 Korean J Clin Lab Sci. Vol. 49, No. 4, December 2017 427 Distribution

More information

untitled

untitled Korean J Clin Microbiol Vol. 12, No. 3, September, 2009 Metallo-β-lactamase Producing Gram-negative Bacilli Dongeun Yong Department of Laboratory Medicine and Research Institute of Bacterial Resistance,

More information

<5BC0FAC0DABCF6C1A430355D434D30362D313320BEE7BAB4BCB12D E687770>

<5BC0FAC0DABCF6C1A430355D434D30362D313320BEE7BAB4BCB12D E687770> 대한임상검사학회지 : 38 권제 3 호, 173-178, 2006 Multiplex Polymerase Chain Reaction 을이용한 Extended-Spectrum β-lactamase 생성 Klebsiella pneumoniae 균주의검출 진주보건대학임상병리과 양병선 Detection of Extended-Spectrum β-lactamase Producing

More information

03(12-65)p fm

03(12-65)p fm 한국임상약학회지제 23 권제 1 호 Kor. J. Clin. Pharm., Vol. 23, No. 1. 2013 화상감염소아환자에서분리된주요균종에대한항생제의내성률 강주연 신혜순 * 덕성여자대학교약학대학 (2012 년 12 월 28 일접수 2013 년 3 월 2 일수정 2013 년 3 월 4 일승인 ) Antimicrobial Resistance of Clinically

More information

Microsoft Word - 15-홍승복.doc

Microsoft Word - 15-홍승복.doc J. Exp. Biomed. Sci. 2012, 18(3): 299~306 pissn : 1738-3226 Original Article Molecular Characterization and Prevalence of 16S Ribosomal RNA Methylase Producing Bacteria in Amikacin Resistant Gram-negative

More information

1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus

More information

February 2007

February 2007 November 2009 Vol. 17 No. 4 Ser. No. 67 Quarterly ISSN 1226-1734 www.whonetkorea.org Antimicrobial resistance of bacteria isolated during July to September in 2009 at a KONSAR program participating hospital

More information

(59-69)Kjcm13.hwp

(59-69)Kjcm13.hwp Korean J Clin Microbiol Vol. 10, No. 1, April, 2007 Antimicrobial Resistance of Clinically Important Bacteria Isolated from 12 Hospitals in Korea in 2005 and 2006 Hyukmin Lee 1, Chang Ki Kim 2, Jongwook

More information

untitled

untitled 병원감염관리 : 제19권제1호 2014 Korean J Nosocomial Infect Control 2014;19(1):29-36 http://dx.doi.org/10.14192/kjnic.2014.19.1.29 원저 국내중환자실환자에서분리된세균의항균제내성 이양순 1 ㆍ김영아 2 ㆍ송원근 3 ㆍ이혁민 4 ㆍ이혜수 5 ㆍ장숙진 6 ㆍ정석훈 1 ㆍ홍성근 7 용동은

More information

<5BC0FAC0DABCF6C1A430345D434D30362D313220C8ABBDC2BAB92D E687770>

<5BC0FAC0DABCF6C1A430345D434D30362D313220C8ABBDC2BAB92D E687770> 대한임상검사학회지 : 38 권제 3 호, 166-172, 2006 Metallo-β-lactamase 생성 Pseudomonas aeruginosa의시험관내항균제병합요법에대한연구 분당제생병원진단검사의학과 홍승복 In vitro Antimicrobial Combination Therapy in Metallo-β-lactamase Producing Pseudomonas

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

< D34312D303628BEE7BAB4BCB12CC0B0B1D9B5B9292E687770>

< D34312D303628BEE7BAB4BCB12CC0B0B1D9B5B9292E687770> 대한임상검사학회지 : 41권제4호, 153-157, 2009 ISSN 1738-3544 SHV ESBL 생성 Klebsiella pneumoniae 균주의실시간중합효소반응분석 진주보건대학임상병리과 1, 대전보건대학임상병리과 2 양병선 1 육근돌 2 Real-Time PCR Analysis of SHV Extended-Spectrum beta-lactamases

More information

Microsoft PowerPoint - PDFCoTemp.PPT

Microsoft PowerPoint - PDFCoTemp.PPT 주요유방염세균의검출및 항생제감수성검사 임숙경 1. 검사시료 1. 시료채취 유방염우유 2. 체세포수측정 3. 대상세균 - Staphylococcus aureus - Coagulase negative staphylococci -Escherichia coli 3. 균분리방법 E. coli CHEC Agar 직접도말 (37 18-24h) 보라색집락 EMB Agar

More information

2101

2101 대한진단검사의학회지제 28 권제 3 호 2008 Korean J Lab Med 2008;28:185-90 DOI 10.3343/kjlm.2008.28.3.185 원저 임상미생물학 Escherichia coli, Klebsiella spp., Proteus mirabilis에서 Phoenix Automated Microbiology System의 Extended-Spectrum

More information

untitled

untitled Korean J Clin Microbiol Vol. 5, No., March, http://dx.doi.org/.545/kjcm..5.. Carbapenem-Resistant Acinetobacter baumannii Il Kwon Bae, Seok Hoon Jeong, Kyungwon Lee Department of Laboratory Medicine and

More information

<303220C6AFC1FD303220B0ADC3B6C0CE2E687770>

<303220C6AFC1FD303220B0ADC3B6C0CE2E687770> 대한내과학회지 : 제 88 권제 5 호 2015 http://dx.doi.org/10.3904/kjm.2015.88.5.502 특집 (Special Review) - 다제내성균감염의위협 다제내성그람음성균감염의항생제치료 성균관대학교의과대학삼성서울병원감염내과 강철인 Antimicrobial Therapy for Infections Caused by Multidrug-Resistant

More information

untitled

untitled ORIGINAL ARTICLE Korean J Clin Lab Sci. 017;9():13-19 https://doi.org/10.153/kjcls.017.9..13 pissn 173-35 eissn -6 Korean J Clin Lab Sci. Vol. 9, No., December 017 13 The Characteristics of Imipenem-Resistant

More information

Microsoft Word - 3-김정민.doc

Microsoft Word - 3-김정민.doc Journal of Bacteriology and Virology 2006. Vol. 36, No. 1 p.21 30 다약제내성 Acinetobacter 균의유전종결정및항균제내성의특성규명 경북대학교의과대학미생물학교실, 단국대학교의과대학미생물학교실 1 임유미 최태생 1 김정민 * Determination of Genomospecies and Characterization

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

22 신경섭 손보라 oxyimino-cephalosporin은물론 monobactam계항생제도분해하는효소이다 [1-3]. 장내세균에서 ESBL 생성균주의증가에대한여러보고가있는데 [4-6], Escherichia coli와 Klebsiella pneumoniae는임상에서

22 신경섭 손보라 oxyimino-cephalosporin은물론 monobactam계항생제도분해하는효소이다 [1-3]. 장내세균에서 ESBL 생성균주의증가에대한여러보고가있는데 [4-6], Escherichia coli와 Klebsiella pneumoniae는임상에서 대한임상병리학회지 : 제 22 권제 1 호 2002 Korean J Clin Pathol 2002; 22: 21-6 임상미생물학 Escherichia coli와 Klebsiella Species에서 Extended-Spectrum -Lactamase 검출을위한 Vitek ESBL Test와그외방법의비교 신경섭 손보라 충북대학교의과대학임상병리학교실 Comparison

More information

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를 Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는

More information

untitled

untitled Ann Clin Microbiol Vol. 16, No. 3, September, 213 http://dx.doi.org/1.5145/acm.213.16.3.126 ISSN 2288-585 Molecular Characteristics of bla OXA-23 -Producing Acinetobacter baumannii Isolated from a University

More information

( )Kju225.hwp

( )Kju225.hwp 비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

Çмúº¸°í5¿À´ÙÇö

Çмúº¸°í5¿À´ÙÇö 병원약사회지 (28), 제 35 권제 호 J. Kor. Soc. Health-syst. Pharm., Vol. 35, No., 48 ~ 58 (28) Original Article 국내병원획득폐렴원인균의경험적항균제에대한내성현황 오다현 a, 김윤숙 a, 천부순 b, 인제대학교해운대백병원약제부 a, 인제대학교약학대학 b The Status of Resistance

More information

84 계명의대학술지제 31 권 1 호 2012 μg /ml). Isolation frequency of MDRAB strains was 97.7% (172 strains) and was highly prevalent. Fifty eight (33.0%) strains

84 계명의대학술지제 31 권 1 호 2012 μg /ml). Isolation frequency of MDRAB strains was 97.7% (172 strains) and was highly prevalent. Fifty eight (33.0%) strains 계명의대학술지제 31 권 1 호 Keimyung Med J Vol. 31, No. 1, June, 2012 다약제내성 Acinetobacter baumannii 의 유병율과항균제감수성 계명대학교의과대학미생물학교실, 의과학연구소 서성일 백원기 서민호 High Prevalence and Antimicrobial Drug Susceptibility of Multidrug

More information

Aug 2012 Vol. 20, No. 3 Ser. No. 78, Quarterly ISSN Antimicrobial resistance of clinical isolates of bacteria during Apri

Aug 2012 Vol. 20, No. 3 Ser. No. 78, Quarterly ISSN Antimicrobial resistance of clinical isolates of bacteria during Apri Aug 2012 Vol. 20, No. 3 Ser. No. 78, Quarterly ISSN1226-1734 www.whonetkorea.org Antimicrobial resistance of clinical isolates of bacteria during April to June, 2012 Antimicrobial resistance rates in April-June,

More information

<37375FB1E8C0E7C1DF2DC7F7BED7B9E8BEE7BFA1BCAD20BAD0B8AEB5C820C0D3BBF3C0FB2E687770>

<37375FB1E8C0E7C1DF2DC7F7BED7B9E8BEE7BFA1BCAD20BAD0B8AEB5C820C0D3BBF3C0FB2E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 17, No. 5 pp. 653-659, 2016 http://dx.doi.org/10.5762/kais.2016.17.5.653 ISSN 1975-4701 / eissn 2288-4688 혈액배양에서분리된임상적주요균주의항균제사용량에따른내성률변화

More information

Çмúº¸°í6ÇÏÇý¹Î

Çмúº¸°í6ÇÏÇý¹Î 병원약사회지 (27), 제 34 권제 4 호 J. Kor. Soc. Health-syst. Pharm., Vol. 34, No. 4, 433 ~ 442 (27) Original Article 국내지역사회획득폐렴원인균의경험적항균제에대한내성현황 하혜민 a, 김윤숙 b, 안정미 c, 천부순 a, 인제대학교약학대학 a, 인제대학교해운대백병원약제부 b, 인제대학교상계백병원약제부

More information

Microsoft Word - 20-김윤태.doc

Microsoft Word - 20-김윤태.doc J. Exp. Biomed. Sci. 12 (2006) 267 274 Random mplified Polymorphic DN (RPD) nalysis for Extended Spectrum β-lactamase Producing Klebsiella pneumonia Isolated from Clinical Specimens in Korea Yun-Tae Kim

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

KJFP Jeongsook Yoon. Bacterial Strains and Antimicrobial Resistance in Burn Patients 심부화상인경우 Clostridium, Bacteroides 등을감별하기위해무산소성배양을시행해야한다고권장하고있다. 6)

KJFP Jeongsook Yoon. Bacterial Strains and Antimicrobial Resistance in Burn Patients 심부화상인경우 Clostridium, Bacteroides 등을감별하기위해무산소성배양을시행해야한다고권장하고있다. 6) KJFP Original Article http://dx.doi.org/10.21215/kjfp.2016.6.3.179 pissn 2233-9019 eissn 2233-9116 화상창 감염의 균종 및 항균제 감수성률 윤정숙* 서울베스티안병원 진단검사의학과 Bacterial Strains and Antimicrobial Resistance of Wound Infection

More information

< BFF8C0FA2D B9E8C7F6C1D62E687770>

< BFF8C0FA2D B9E8C7F6C1D62E687770> 대한내과학회지 : 제 권제 호 다약제내성 Pseudomonas aeruginosa 에대한항생제병합효과 한양대학교의과대학감염내과학교실 배현주 In Vitro Effects of Combined Antibiotics against Multidrug-resistant Pseudomonas aeruginosa HyunJoo Pai, M.D. Infectious Diseases,

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

..........5-45..

..........5-45.. K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

February 2007

February 2007 May 2008 Vol. 16 No. 2 Ser. No. 61 Quarterly ISSN 1226-1734 www.whonet.org Antimicrobial resistance of bacteria isolated during January to March in 2008 at a KONSAR program participating hospital Antimicrobial

More information

10 원저 hwp

10 원저 hwp 대한내과학회지 : 제 94 권제 1 호 2019 https://doi.org/10.3904/kjm.2019.94.1.107 비병원장기요양기관에서입원하는노인의다제내성그람음성균보유 서울특별시서울의료원내과 김민성ㆍ신진호ㆍ정연상ㆍ조진경ㆍ최재필 Multidrug-Resistant, Gram-Negative Bacteria in Hospitalized Elderly Patients

More information

untitled

untitled 대한내과학회지 : 제 72 권제 1 호 27 Streptococcus pneumoniae와 Haemophilus influenzae 임상분리주에대한 Cefditoren의시험관내항균력 인제대학교의과대학일산백병원감염내과, 울산대학교의과대학서울아산병원감염내과 2, 울산대학교항균제내성ㆍ미생물유전학연구센터 3 곽이경 추은주 2, 3 박수진 3 이정은 3 정진용 2,

More information

Table 2. Antimicrobial susceptibility (%) of P. aeruginosa a Antimicrobial agents Resistant Intermediate Susceptible Piperacillin 45/27 b 0/0 55/73 Pi

Table 2. Antimicrobial susceptibility (%) of P. aeruginosa a Antimicrobial agents Resistant Intermediate Susceptible Piperacillin 45/27 b 0/0 55/73 Pi May 2012 Vol. 20, No. 2 Ser. No. 77, Quarterly ISSN1226-1734 www.whonetkorea.org Antimicrobial resistance of clinical isolates of bacteria during January to March, 2012 Antimicrobial resistance rates determined

More information

Table 2. Antimicrobial susceptibility (%) of P. aeruginosa a Antimicrobial agents Resistant Intermediate Susceptible Piperacillin 44/25 b 12/11 44/64

Table 2. Antimicrobial susceptibility (%) of P. aeruginosa a Antimicrobial agents Resistant Intermediate Susceptible Piperacillin 44/25 b 12/11 44/64 Nov 2012 Vol. 20, No. 4 Ser. No. 79, Quarterly ISSN1226-1734 www.whonetkorea.org Antimicrobial resistance of clinical isolates of bacteria during July to September, 2012 Antimicrobial resistance rates

More information

Drug-Resistant Bacteria: Tertiary Hospitals versus Smaller Medical Institutions resistant Pseudomonas aeruginosa (CRPA), carbapenem resistant Acinetob

Drug-Resistant Bacteria: Tertiary Hospitals versus Smaller Medical Institutions resistant Pseudomonas aeruginosa (CRPA), carbapenem resistant Acinetob Original Article Ewha Med J 2013;36(2):126-131 http://dx.doi.org/10.12771/emj.2013.36.2.126 pissn 2234-3180 eissn 2234-2591 전원온환자의의료기관별호흡기검체에서의균종류비교 김태형, 조경표, 이재성, 우용문, 성지석, 노창석 1 서울적십자병원내과, 1 서울특별시서남병원호흡기내과

More information

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF. 1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -

More information

한국성인에서초기황반변성질환과 연관된위험요인연구

한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract

More information

February 2007

February 2007 Nov 2008 Vol. 16 No. 4 Ser. No. 63 Quarterly ISSN 1226-1734 www.whonetkorea.org Antimicrobial resistance of bacteria isolated during July to September in 2008 at a KONSAR program participating hospital

More information

Microsoft PowerPoint - 4.조지현 [호환 모드]

Microsoft PowerPoint - 4.조지현 [호환 모드] 감염관리를위한진단검사 다제내성균감시검사 (MULTIDRUG RESISTANT ORGANISMS) 조지현원광의대진단검사의학과 다제내성균감시검사 1. MDRO 정의 (multidrug resistant organisms) 2. MDRO 중요성과국내 MDRO 현황 3. MDRO 검사 (screen, confirm) 1) MRSA, VRSA/VISA, CNS 2)

More information

135 Jeong Ji-yeon 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 머리말 협저불상( 夾 紵 佛 像 )이라는 것은 불상을 제작하는 기법의 하나로써 삼베( 麻 ), 모시( 苧 ), 갈포( 葛 ) 등의 인피섬유( 靭 皮 纖 維 )와 칠( 漆 )을 주된 재료

135 Jeong Ji-yeon 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 머리말 협저불상( 夾 紵 佛 像 )이라는 것은 불상을 제작하는 기법의 하나로써 삼베( 麻 ), 모시( 苧 ), 갈포( 葛 ) 등의 인피섬유( 靭 皮 纖 維 )와 칠( 漆 )을 주된 재료 MUNHWAJAE Korean Journal of Cultural Heritage Studies Vol. 47. No. 1, March 2014, pp.134~151. Copyright 2014, National Research Institute of Cultural Heritage 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 정지연 a 明 珍 素 也

More information

A 617

A 617 Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R

More information

(

( 317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,

More information

6 JH Byun, et al. IRS-PCR on E. coli 성을나타낸다. CTX-M ESBL 유전자는 mobile genetic element 와연관되어지역사회에서 ESBL 이쉽게전파할수있다 [5, 6]. 병원균의역학적분석을하기위

6 JH Byun, et al. IRS-PCR on E. coli   성을나타낸다. CTX-M ESBL 유전자는 mobile genetic element 와연관되어지역사회에서 ESBL 이쉽게전파할수있다 [5, 6]. 병원균의역학적분석을하기위 Original Article http://dx.doi.org/10.3947/ic.2012.44.1.5 Infect Chemother 2012;44(1):5-10 pissn 2093-2340 eissn 2092-6448 Infection & Chemotherapy Infrequent-Restriction-Site 중합효소연쇄반응 (ISR-PCR) 을사용한지역사회발생

More information

untitled

untitled Korean J Clin Microbiol Vol. 11, No. 2, October, 2008 Detection of CTX-M-Type Extended-Spectrum β-lactamase in Clinical Isolates of Chromosomal AmpC β-lactamase-producing Enterobacteriaceae from Korea

More information

±èÇ¥³â

±èÇ¥³â 533 Fig. 1. Dead zone. Nine echoes are positioned 2-10 mm below the scan surface with 1 mm distance. All nine echoes are clearly visualized. 534 Fig. 2. Vertical and horizontal measurement. 10 cm distance

More information

( ) 이남용.hwp

( ) 이남용.hwp 임상검사와정도관리 : 제 32 권제 12 호 2010 J Lab Med Qual Assur 2010; 32:11-24 11 임상미생물학검사신빙도조사결과보고 (2009) 이남용 ( 집필대표 ) 김명숙 김미나 김민중 김선주 김성일 김의종 김재석 용동은 윤남섭 이장호 주세익 대한임상검사정도관리협회임상미생물학분과위원회 Annual Report on External

More information

112 성흥섭 최수진 유수진외 1 인 균제에내성이며다른여러항균제에도내재성혹은획득내성을지니고있기때문에치료항균제선택범위가매우좁다 [3, 4]. Imipenem은세포외막의 porin을잘투과하고, penicillin-binding protein (PBP) 과의친화도와 -lac

112 성흥섭 최수진 유수진외 1 인 균제에내성이며다른여러항균제에도내재성혹은획득내성을지니고있기때문에치료항균제선택범위가매우좁다 [3, 4]. Imipenem은세포외막의 porin을잘투과하고, penicillin-binding protein (PBP) 과의친화도와 -lac 대한진단검사의학회지제 27 권제 2 호 2007 Korean J Lab Med 2007;27:111-7 원저 임상미생물학 Imipenem 내성 Acinetobacter baumannii에서항균제병합요법의시험관내상승작용검사 성흥섭 최수진 유수진 김미나 울산의대서울아산병원진단검사의학과 In vitro Antimicrobial Synergy against Imipenem-Resistant

More information

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]

More information

< BFEBBFAAB0E1B0FABAB8B0EDBCAD2DBCF6C1A42028BCADBFEFB4EB292E687770>

< BFEBBFAAB0E1B0FABAB8B0EDBCAD2DBCF6C1A42028BCADBFEFB4EB292E687770> 제출문 질병관리본부장 귀하 이보고서를 균혈증과요로감염원인균의내성실태및내성기전연구 ( 서울대학교의과대 학 / 김의종 ) 과제의연구결과보고서로제출합니다. 2006. 1. 25 주관연구기관명 : 서울대학교의과대학 주관연구책임자 : 김의종 제 1세부과제명 : 균혈증및요로감염을일으키는주요원인균의내성실태 ( 제1세부연구기관 / 세부과제책임자 ): 서울대학교의과대학 /

More information

untitled

untitled 대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran

More information

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770> 대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실

More information

untitled

untitled J Korean Soc Transplant 2013;27:81-86 http://dx.doi.org/10.4285/jkstn.2013.27.3.81 Review Article 다제내성세균의시대에세균성감염질환에대한항생제치료의최근발전들 성균관대학교의과대학삼성서울병원감염내과 강철인 What s New in the Management of Bacterial Infections

More information

K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis

More information

14.531~539(08-037).fm

14.531~539(08-037).fm G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked

More information

February 2007

February 2007 Aug 2011 Vol. 19 No. 3 Ser. No. 74 Quarterly ISSN 1226-1734 www.whonetkorea.org Antimicrobial resistance of bacteria isolated during April to June in 2011 at a KONSAR program participating hospital Antimicrobial

More information

untitled

untitled DOI: 10.4046/trd.2009.67.3.212 ISSN: 1738-3536(Print)/2005-6184(Online) Tuberc Respir Dis 2009;67:212-220 CopyrightC2009. The Korean Academy of Tuberculosis and Respiratory Diseases. All rights reserved.

More information

歯1.PDF

歯1.PDF 200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)

More information

Trd022.hwp

Trd022.hwp 김신태, 이선녕, 이석정, 정필문, 박홍준, 신명상, 김종환, 이부길, 김상하, 리원연, 신계철, 용석중 Shin-Tae Kim, M.D., Shun Nyung Lee, M.D., Seok Jeong Lee, M.D., Pil Moon Jung, M.D., Hong Jun Park, M.D., Myung Sang Shin, M.D., Chong Whan Kim,

More information

- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol

More information

04_이근원_21~27.hwp

04_이근원_21~27.hwp 1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일

More information

- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -

More information

1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,

More information

untitled

untitled 한국가축위생학회지제 36 권제 3 호 (2013) Korean J Vet Serv, 2013, 36(3), 171-180 ISSN 1225-6552, eissn 2287-7630 http://dx.doi.org/10.7853/kjvs.2013.36.3.171 Korean Journal of Veterinary Service

More information

안도희외 6 인 : ESBL 생성균주와비생성균주에의한지역사회획득요로감염비교 감염에서균주의항생제감수성에변화를가져왔고특히광범위세팔로스포린에대한내성균의감염이증가하고있다 2). 이러한내성균에의한요로감염은치료실패, 합병증증가및치료기간의연장등과의연관성이제기되고있어관심이증가하고있다

안도희외 6 인 : ESBL 생성균주와비생성균주에의한지역사회획득요로감염비교 감염에서균주의항생제감수성에변화를가져왔고특히광범위세팔로스포린에대한내성균의감염이증가하고있다 2). 이러한내성균에의한요로감염은치료실패, 합병증증가및치료기간의연장등과의연관성이제기되고있어관심이증가하고있다 ORIGINAL ARTICLE pissn 2384-1079 eissn 2384-1087 Pediatr Infect Vaccine 2015;22:29-35 DOI: http://dx.doi.org/10.14776/piv.2015.22.1.29 Extended-Spectrum β-lactamase 생성균주와비생성균주에의한지역사회획득요로감염비교 안도희ㆍ김규원ㆍ조혜경ㆍ차한ㆍ전인상ㆍ류일ㆍ선용한

More information

16(1)-3(국문)(p.40-45).fm

16(1)-3(국문)(p.40-45).fm w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University

More information

17(2)-8.fm

17(2)-8.fm 한국임상약학회지제 17 권제 2 호 Kor. J. Clin. Pharm., Vol. 17, No. 2. 2007 지방대학병원사례평가 : 국내입원환자에있어 Carbapenem 계약물사용평가 김수진 a 임성실 b 황방연 b 이종길 b 이준섭 a 박선영 a 한송이 b 이명구 b# a 충북대학병원약제부, b 충북대학교약학대학 Drug Use Evaluation of

More information

Table 2. Antimicrobial susceptibility (%) of P. aeruginosa a Antimicrobial agents Resistant Intermediate Susceptible Piperacillin 37/21 b 14/12 49/67

Table 2. Antimicrobial susceptibility (%) of P. aeruginosa a Antimicrobial agents Resistant Intermediate Susceptible Piperacillin 37/21 b 14/12 49/67 Aug 2014 Vol. 22, No. 3 Ser No. 86 Quarterly ISSN1226-1734 www.whonetkorea.org Antimicrobial resistance of clinical isolates of bacteria in April to June, 2014 Antimicrobial resistance rates determined

More information

A Case of Acute Cholecystitis Caused by Stenotrophomonas maltophilia Bacteremia,. 5,6 B S. maltophilia. 증례 B,, 3 2 (entecavir 0.5 mg) 7. 3,.

A Case of Acute Cholecystitis Caused by Stenotrophomonas maltophilia Bacteremia,. 5,6 B S. maltophilia. 증례 B,, 3 2 (entecavir 0.5 mg) 7. 3,. Case Report The Korean Journal of Pancreas and Biliary Tract 2014;19:189-193 http://dx.doi.org/10.15279/kpba.2014.19.4.189 pissn 1976-3573 eissn 2288-0941 Stenotrophomonas maltophilia 균혈증에의해발생한급성담낭염 1

More information

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling

More information

대한진단검사의학회지제 26 권제 3 호 2006 Korean J Lab Med 2006;26: 원저 임상미생물학 충주지역에서집단발생한 Extended-spectrum -lactamase 생성 Shigella sonnei 감염의임상적특성 홍성진 1 이창훈 2

대한진단검사의학회지제 26 권제 3 호 2006 Korean J Lab Med 2006;26: 원저 임상미생물학 충주지역에서집단발생한 Extended-spectrum -lactamase 생성 Shigella sonnei 감염의임상적특성 홍성진 1 이창훈 2 대한진단검사의학회지제 26 권제 3 호 2006 Korean J Lab Med 2006;26:168-73 원저 임상미생물학 충주지역에서집단발생한 Extended-spectrum -lactamase 생성 Shigella sonnei 감염의임상적특성 홍성진 1 이창훈 2 왕준호 3 송원근 4 정석훈 5 건국대학교의과대학소아과학교실 1, 진단검사의학교실 2, 내과학교실

More information

- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -

More information

°Ç°�°úÁúº´5-44È£ÃÖÁ¾

°Ç°�°úÁúº´5-44È£ÃÖÁ¾ K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis

More information

주간건강과질병 제 12 권제 16 호 연구단신, Brief report 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : s

주간건강과질병 제 12 권제 16 호 연구단신, Brief report 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : s 연구단신, Brief report 2 2013 2017 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : sea2sky@korea.kr, 043-719-7580 Results of healthcare-associated infection

More information