untitled

Transcription

1 한국가축위생학회지제 36 권제 3 호 (2013) Korean J Vet Serv, 2013, 36(3), ISSN , eissn <Original Article> Korean Journal of Veterinary Service Available online at 개와고양이에서분리된 Enterobacteriaceae 와 Pseudomonas aeruginosa 의항균제내성및내성유전자의분포 조재근 1 ㆍ김진현 2 ㆍ김정미 3 ㆍ박최규 4 ㆍ김기석 4 * 대구광역시보건환경연구원 1, 경상북도가축위생시험소 2, 효목동물병원 3, 경북대학교수의과대학 4 Antimicrobial resistance and distribution of resistance gene in Enterobacteriaceae and Pseudomonas aeruginosa isolated from dogs and cats Jae-Keun Cho 1, Jin-Hyun Kim 2, Jeong-Mi Kim 3, Choi-Kyu Park 4, Ki-Seuk Kim 4 * 1 Metropolitan Health & Enviornmental Research Institute, Daegu , Korea 2 Gyeongbuk Veterinary Service Laboratory, Daegu , Korea 3 Hyomok Animal Hospital, Daegu , Korea 4 College of Veterinary Medicine, Kyungpook National University, Daegu , Korea (Received 8 August 2013; revised 2 September 2013; accepted 10 September 2013) Abstract This study was carried out to investigate the antimicrobial resistance pattern and distribution of resistance gene in 44 Enterobacteriaceae and 21 Pseudomonas (P) aeruginosa isolated from hospitalized dogs and cats in animal hospital from 2010 to 2011 in Daegu. Among Enterobacteriaceae, Escherichia (E) coli was highly resistant to ampicillin (56.7%), followed by tetracycline (53.3%), cephalothin, streptomycine, sulfamethoxazole/trimethoprim, gentamicin and norfloxacin ( %). The remaining isolates of Enterobacteriaceae had high resistance to ampicillin (64.3%) and streptomycin (42.9%). Whereas, P. aeruginosa was low resistant to all antimicrobials tested (less than 15%). int I 1 gene was detected in 20 (57.1%) of 35 antimicrobial resistant Enterobacteriaceae and 2 (9.5%) of 21 P. aeruginosa., but int I 2 gene was not detected in all isolates. The eight resistance genes were found either alone or combination with other gene (s): bla TEM, aada, stra-strb, clma, teta, tetb, sul I and sul II. About 78% of integron-positive isolates were resistance to more than four antimicrobial agents. The findings suggest that class I integrons are widely distributed in E. coli among Enterobacteriaceae from dogs and cats and multi-drug resistance related to the presence of class I integrons. The prudent use of antimicrobials and continuous monitoring for companion animals are required. Key words : Enterobacteriaceae, E. coli, P. aeruginosa, Resistance gene 서 항생제는동물의세균감염증치료에널리사용되고있고이로인한항생제내성균의출현이라는필연 론 *Corresponding author: Ki-Seuk Kim, Tel , Fax , . kimkiseuk@knu.ac.kr 적인결과를가져왔다. 특히여러가지항생제에내성을갖는다제내성균의출현및증가로인한항생제내성문제는전세계적으로중대한공중보건학적위협이되고있다 (Normand 등, 2000). 그람음성세균에서 integron 내 gene cassettes 에는여러가지내성유전자들을가지고있다. Plasmid 와 transposon Copyright 2013, The Korean Society of Veterinary Service. All Rights Reserved. 171

2 172 조재근ㆍ김진현ㆍ김정미ㆍ박최규ㆍ김기석 을통한 integron 의수평전파는내성유전자의전파와다제내성균의출현에중요한역할을하며, 특히이들내성유전자는주로 Enterobacteriaceae와 Pseudomonas (P) aeruginosa에서흔히보고되고있다 (Hall과 Collis, 1998; Goldstein 등, 2001). 개와고양이는예전부터인간과매우밀접한관계에있어이들동물에서항생제내성균의출현은동물과사람사이내성균또는내성유전자의전파를가능하게한다 (Guardabassi 등, 2004). 최근까지개와고양이에서분리된 Enterobacteriaceae 에서항생제내성유전자의검출에관한보고는주로 Escherichia (E) coli 에서만이루어지고있을뿐 (Sidjabat 등, 2006; Cocchi 등, 2007; Kadlec와 Schwarz, 2008; Shaheen 등, 2010), 다른균종의 Enterobacteriaceae와 P. aeruginosa에서이들내성유전자에관한보고는드물다 (Rubin 등, 2008). 따라서이번연구에서는대구지역동물병원에입원치료중인개와고양이에서분리한 Enterobacteriaceae와 P. aeruginosa를대상으로각종항균제에대한내성유형을분석하고, 한가지이상의약제에내성을보인균주에대해서는항생제내성유전자의보유유무를조사하기위해시험하였다. 재료및방법공시재료 2009년 8월부터 2011년 12월까지대구지역동물병원 23개소를대상으로입원ㆍ치료중인개 (n=349) 와고양이 (n=14) 의귀 (n=263), 피부 (n=57), 뇨 (n=20), 생식기 (n=11), 눈 (n=6), 비강 (n=2), 혈액 (n=2) 및유두 (n=2) 에서그람음성균을분리ㆍ동정하여, 본실험실에보관중인 E. coli 30주, P. aeruginosa 21주, Klebsiella (K) pneumoniae 5주, Enterobacter (E) cloacae, Citrobacter (C) koseri 및 Proteus (P) mirabilis 각각 2주, Morganella (M) morganii, Acinetobacter (A) baumannii 및 Serratia (S) marcescenns 각각 1주등총 65주를실험에사용하였다 (Table 1). 균분리및동정은채취한시료를 Blood agar plate ( 아산제약, Korea) 와 MacConkey agar (Oxoid, UK) 에접종하여 37 o C에서 24시간배양후, 의심되는집락에대해서는순수분리후 VITECK 2 compac (BioMerieux, France) 를이용하여동정하였다. Table 1. Isolated bacteria by the sampling sites Isolates Ear Skin Urine Vagina Eye Others* Escherichia. coli Pseudomonas aeruginosa 19 2 Klebsiella pneumoniae 5 Enterobacter cloacae 1 1 Citrobacter koseri 1 1 Proteus mirabilis 1 1 Morganella morganii 1 Acinetobacter baumannii 1 Serratia marcescenns 1 Total *Blood, nasal cavity, udder. 항생제감수성시험 항생제감수성시험은 Bauer 등 (1996) 의디스크확산법을이용하여실시하였다. 사용한항생제디스크 (Oxoid, UK) 는 ampicillin (AM), ticarcillin (TIC), ticarcillin/clavulanic acid (TIM), cephalothin (CF), cefepime (FEP), ceftazidime (CAZ), cefotaxime (CTX), imipenem (IPM), aztreonam (ATM), gentamicin (GM), amikacin (AN), tetracycline (TC), ciprofloxacin (CIP), norfloxacin (NOR), streptomycin (SM), sulfamethoxazole/trimethoprim (SXT) 및 chloramphenicol (CM) 등 17종이었다. 공시균을 Mueller-hinton broth (Oxoid, UK) 에접종하여 37 o C에서 2 4시간배양하여균농도를 McFarland No. 0.5로조정한후멸균면봉을이용하여 Mueller- Hinton agar (Oxoid, UK) 평판배지에고르게도포한다음항생제디스크를 dispenser (Oxoid, UK) 로접종하였다. 35±2 o C에서 16 18시간배양후균억제대의크기를측정하여 Clinical and Laboratory Standards Institute (CLSI, 2012) 에근거하여내성여부를판정하였다. 항생제감수성시험을위한표준균주로 E. coli ATCC 25922를사용하였다. DNA 추출 공시균에대한 genomic DNA 추출은 Mazel 등 (2000) 의방법에따라 boiling법으로실시하였다. 즉 tryptic soy broth (Oxoid, UK) 에접종하여 37 o C에서 18 24시간진탕배양하여얻은균부유액 1.0 ml를 13,000 rpm에서 2분간원심분리한후상층액을제거한다음멸균증류수 0.5 ml로재부유하였다. 균부유액은끓는물에 10분간가열한다음 13,000 rpm에서 10 분간원심분리한후상층액을취하여 template DNA

3 개와고양이에서분리된 Enterobacteriaceae 와 Pseudomonas aeruginosa 의항균제내성및내성유전자의분포 173 로사용하였다. 결 과 약제내성관련유전자의검출 TEM, SHV, CTX, OXA, int I, int I2, aada, stra-strb, clma, teta, tetb, sul I 및 sul II 등약제내성관련유전자의검출을위한 primer는 Table 2와같다. PCR 반응은 2X TOPsimple DyeMix (aliquot)-hot (Enzynomics, Korea) 에각각의 10 pmol primer 1 μl와 template DNA 1 μl를넣은후, 멸균된증류수를첨가하여최종반응량이 20 μl 되게하여 Tprofessional Thermal Cycler (Biometra, Germany) 를이용하여수행하였다. PCR 반응조건은이전연구자들 (Table 2) 의방법에따랐으며, 초기 denaturation 후, denaturation, annealing, extension 과정을반복하고최종 extension을실시하였다. 증폭된산물은 1.2% agarose gel에서 100 V로 30분간전기영동을실시한후 UV transilluminator (Biometra, Germany) 를이용하여확인하였다. 항균제감수성 Enterobacteriaceae 44주와 P. aeruginosa 21주에대한항생제감수성시험결과는 Table 3과같다. Enterobacteriaceae 중 E. coli (30주) 는 AM과 TC에각각 56.7% 와 53.3% 로높은내성률을나타내었고, CF, SXT, SM, GM, NOR, CIP, CIP 및 CTX에는 % 의내성률을나타내었다. 그리고 AN, IPM, CM, TIM, CAZ 및 FEP에는 % 의비교적낮은내성률을보였다. E. coli를제외한나머지 Enterobacteriaceae 14주의경우 AM에대하여는 64.3% 의높은내성률을나타내었나, SM, CF, STX, TIM, IPM, TC, CM, ATM 및 CTX에는 % 의낮은내성률을나타내었다. 반면 TIC, FEP, CAZ, AN, CIP 및 NOR에내성인균주는한주도없었다. 반면 P. aeruginosa에서는 IPM, NOR, GM, TIC, TIM, FEP, AN, CIP에 % 의내성률을나타내었고, CAZ과 ATM에는전균주가 Table 2. Primers used for PCR amplification in this study Primer name Sequence ('5 to'3) Amplicon size (bp) Reference TEM-F ATTCTTGAAGACGAAAGGGC 1,150 Belaaouaj et al (1994) TEM-R ACGCTCAGTGGAACGAAAAC SHV-F CACTCAAGGATGTATTGTG 885 Pitout et al (1998) SHV-R TTAGCGTTGCCAGTGCTCG CTX-M-9-F GTGACAAAGAGAGTGCAACGG 857 Coque et al (2002) CTX-M-9-R ATGATTCTCGCCGCTGAAGCC CTX-M-10-F CCGCGCTACACTTTGTGGC 944 Coqueet al (2002) CTX-M-10-R TTACAAACCGTTGGTGACG OXA-F TTCAAGCCAAAGGCACGATAG 813 Steward et al (2001) OXA-R TCCGAGTTGACTGCCGGGTTG int I 1-F GGGTCAAGGATCTGGATTTCG 483 Mazel et al (2000) int I 1-R ACATGCGTGTAAATCATCGTCG int I 2-F CACGGATATGCGACAAAAAGGT 788 Mazel et al (2000) int I 2-R GTAGCAAACGAGTGACGAAATG stra-strb-f TATCTGCGATTGGACCCTCTG 538 Sunde and Norström (2005) stra-strb-b CATTGCTCATCATTTGATCGGCT aada-f GAGAACATAGCGTTGCCTTGG 198 Sunde and Norström (2005) aada-r TCGGCGCGATTTTGCCGGTTAC teta-f GTAATTCTGAGCACTGTCGC 937 Guardabassi et al (2000) teta-r CTGCCTGGACAACATTGCTT tetb-f CTCAGTATTCCAAGCCTTTG 416 Guardabassi et al (2000) tetb-r CTAAGCACTTGTCTCCTGTT sul I-F TTCGGCATTCTGAATCTCAC 822 Maynard et al (2003) sul I-R ATGATCTAACCCTCGGTCTC sul II-F CGGCATCGTCAACATAACC 722 Maynard et al (2003) sul II-R GTGTGCGGATGAAGTCAG cmla-f TGTCATTTACGGCATACTCG 455 Sáenz et al (2004) cmla-r ATCAGGCATCCCATTCCCAT

4 174 조재근ㆍ김진현ㆍ김정미ㆍ박최규ㆍ김기석 Table 3. Antimicrobial resistance of 44 Enterobacteriaceae and 21 P. aeruginosa isolates Antimicrobial agents Enterobacteriaceae Resistant breakpoint (mm) Acinetobac-ter spp. P. aeruginosa No. (%) of resistant strains Enterobacteriaceae E. coli (n=30) Others* (n=14) P. aeruginosa (n=21) Ampicillin (56.7) 9 (64.3) - Ticarcillin (0.0) 1 (4.8) Ticarcillin/ (10.0) 3 (21.4) 1 (4.8) clavulanic acid Cephalothin (43.3) 4 (30.7) - Cefepime (6.7) 0 (0.0) 1 (4.8) Ceftazidime (10.0) 0 (0.0) 0 (0.0) Cefotaxime (30.0) 1 (7.1) - Imipenem (20.0) 3 (21.4) 3 (14.3) Aztreonam (13.0) 2 (14.3) 0 (0.0) Gentamicin (40.0) 1 (7.1) 2 (9.5) Amikacin (26.7) 0 (0.0) 1 (4.8) Tetracycline (53.3) 3 (21.4) - Ciprofloxacin (33.3) 0 (0.0) 1 (4.8) Norfloxacin (40.0) 0 (0.0) 3 (14.3) Streptomycin (40.0) 5 (38.5) - Sulfamethoxazole/ (43.3) 4 (28.6) - trimethoprim Chloramphenicol (16.7) 3 (21.4) - *Klebsiella pneumoniae, Enterobacter cloacae, Citrobacter koseri, Proteus mirabilis, Morganella morganii, Acinetobacter baumannii, Serratia marcescenns. 감수성이었다. 약제내성관련유전자한종류이상의약제에내성을나타낸 Enterobacteriaceae 36주및 P. aeruginosa 21주모두를대상으로약제내성관련유전자의검출을실시한결과는 Table 4와같다. int I 1유전자는공시균 57주중 22주 (38.6%) 에서검출되었으며, 이중 E. coli에서는 18주에서분리되어검출률이가장높았고, 다음 P. aeruginosa는 2주에서, E. cloacae와 K. pneumoniae는각각 1 주에서검출되었다. int I 2 유전자는모든균주에서검출되지않았다. int I 1 유전자가검출된 22주중 17 주 (77.3%) 는 4종이상의약제에내성을가진다제내성균이었다. Enterobacteriaceae 44주중 AM에내성인 26주를대상으로 β-lactamase 유전자의검출을시도한결과 TEM 유전자는 11주 (42.3%) 에서검출되었으나, OXA, SHV 및 CTX 유전자는한주에서도검출되지않았다. 특히 TEM 유전자는 E. coli에서는 9주에서분리되어검출률이가장높았고, E. cloacae와 M. morganii 는각각 1주에서검출되었다. SM에내성인 17주중 aada 유전자는 E. coli에서만 3주에서검출되었으며, stra-strb 유전자는 E. coli에서는 10주에서, E. cloacae 와 K. pneumoniae는각각 1주에서검출되었다. TC에내성을보인 19주중 teta 유전자는 3주 (15.8%), tetb 유전자는 13주 (68.4%) 에서검출되었으며, 이들유전자모두는 E. coli에서검출되었다. 한편 teta 유전자를가진 3주중 2주는 tetb 유전자를동시에가지고있었다. CM에내성인 8주중 cmla 유전자는 E. coli 에서만 1주에서검출되었다. SXT에내성인 17주중 sul I 유전자는 5주 (29.4%) 에서검출되었으며, 이중 E. coli에서는 3주에서, E. cloacae와 M. morganii는각각 1주에서검출되었고, sul II 유전자는 M. morganii에서만 1주에서검출되었다. 한편 P. aeruginosa의경우 AM, CM, SM, SXT 및 TC에대하여 CLSI (2012) 내성기준이명시되어있지않아항생제감수성시험을실시하지아니하였다. 따라서공시균 21주모두를대상으로 TEM, OXA, SHV, stra-strb, aada, teta 및 tetb 유전자의검출을실시한결과 stra-strb 유전자는 4주 (19.0%), sul I 유전자는 2주 (9.5%), cmla와 aada 유전자는각각 1주 (4.8%)

5 개와고양이에서분리된 Enterobacteriaceae 와 Pseudomonas aeruginosa 의항균제내성및내성유전자의분포 175 Table 4. Phenotypes of antimicrobial resistance and resistance genes detected in antimicrobial resistant Enterobacteriaceae and P. aeruginosa isolates Isolates Origin Antimicrobial resistance pattern Resistance genes detected A. baumannii Dog ATM, IPM - C. koseri 1 Dog AM, ATM - C. koseri 2 Dog AM, IPM - E. coli 1 Dog AM, AN, CAZ, CF, CIP, CM, CTX, GM, NOR, SM, SXT, TC int I 1, bla TEM, teta, tetb, sul I, stra-strb E. coli 2 Dog AM, AN, CF, CIP, CM, CTX, GM, NOR, SM, SXT, TC int I 1, bla TEM, teta, tetb, sul, stra-strb E. coli 3 Dog AM, CIP, CM, NOR, SXT, TC int I 1, bla TEM, tetb E. coli 5 Dog AM, GM, SM, TC int I 1, bla TEM, tetb, stra-strb E. coli 6 Dog AM, CF, CIP, CTX, NOR, SM, TC int I 1, tetb, stra-strb E. coli 8 Dog AM, AN, CAZ, CF, CTX, GM, IPM, SM, SXT, TC, TIM int I 1, bla TEM, tetb, sul I, aada, stra-strb E. coli 9 Dog AM, AN, SM int I 1, bla TEM, aada E. coli 10 Dog AN - E. coli 11 Dog AN, GM - E. coli 13 Dog CF E. coli 14 Dog ATM, ATM, TIM - E. coli 15 Dog AM, ATM, CF, CTX, GM, TC int I 1, tetb E. coli 16 Dog AN, ATM, IPM - E. coli 18 Dog AM, IPM, SM, SXT, TC int I 1, aada, tetb, stra-strb E. coli 19 Dog AM, ATM, CTX, GM, NOR, SM, SXT, TC int I 1, bla TEM, tetb, stra-strb E. coli 20 Dog CF, FEP, SM, TC int I 1, tetb, stra-strb E. coli 21 Dog AM, CF, CTX, SXT - E. coli 22 Dog IPM, TC int I 1, tetb E. coli 23 Dog AM, CAZ, CF, CM, CTX, FEP, GM, IPM, NOR, SXT, TC - E. coli 24 Dog CIP, NOR, SXT, TC int I 1, bla TEM E. coli 26 Dog AM, CF, CIP, GM, NOR, SM, SXT, TC int I 1, tetb, stra-strb E. coli 27 Dog AM, CF, CIP, GM, NOR, SM, SXT, TC int I 1, tetb E. coli 28 Dog AM, AN, CF, CIP, CM, CTX, IPM, GM, NOR, SXT int I 1, clma, stra-strb E. coli 29 Dog AM, CIP, GM, NOR, SM, SXT, TC int I 1, teta, stra-strb E. coli 30 Dog AM, CF, CIP, NOR, TIM int I 1, bla TEM E. cloacae 1 Dog AM, CF, CM, CTX, SXT, TC - E. cloacae 2 Dog AM, CF, GM, IPM, SM, SXT, TC, TIM int I 1, bla TEM, sul I, stra-strb K. pneumoniae 1 Dog AM - K. pneumoniae 2 Dog AM, CF, SM, TIM int I, stra-strb K. pneumoniae 3 Dog AM, TIM - M. morganii Dog AM, CF, CM, SM, SXT bla TEM, sul I, sul II P. mirabilis 1 Dog SM - P. mirabilis 2 Dog AM, CM, SM, SXT, TC - 에서검출되었으나, TEM, OXA, SHV, CTX 및 sul II 유전자는모든균주에서검출되지않았다. 고찰반려동물은오래전부터사람과밀접한관계를가져왔고, 특히개와고양이에서항생제내성균의출현은감염증의치료를어렵게할뿐만아니라사람에게전파될수있어공중보건학적으로중요하다 (van den Bogaard and Stobberingh, 2000). 개와고양이로부터분리된 E. coli에서 AM, CF, GM, NOR, SXT 및 TC에 대한높은내성은이미국내여러연구자들에의해보고가되고있다 (Kim 등, 2004; Park 등, 2004; Kim 등, 2011). 이번연구에서도내성률에서는다소차이가있었지만유사한경향을나타내었다. 이들약제외에개와고양이로부터분리된 E. coli는 CIP, CM, enrofloxacin, cefazolin (CZ), erythromycin, oxacillin, penicillin 및 lincomycine 등과같은항생제에대하여도높은내성률이보고되고있어 (Choi 등, 2010; Kim 등, 2004), 국내개와고양이에서항생제내성문제는심각한수준에도달하였음을알수있었다. 이번연구에서 TIM, AN, IPM, ATM, FEP 및 CAZ과 CTX 같은항생제의경우 30% 이하의내성률을나타내었다.

6 176 조재근ㆍ김진현ㆍ김정미ㆍ박최규ㆍ김기석 Table 4. Continued Isolates Origin Antimicrobial resistance pattern* Resistance genes detected P. aeruginosa 1 Dog - - P. aeruginosa 2 Dog - stra-strb P. aeruginosa 3 Dog AN, IPM - P. aeruginosa 4 Dog - - P. aeruginosa 5 Dog CIP, GM, NOR int I 1, clma, stra-strb P. aeruginosa 6 Dog TIM - P. aeruginosa 7 Dog - - P. aeruginosa 8 Cat IPM stra-strb P. aeruginosa 9 Cat - - P. aeruginosa 10 Dog NOR - P. aeruginosa 11 Dog - - P. aeruginosa 12 Dog IPM - P. aeruginosa 13 Dog NOR - P. aeruginosa 14 Dog - - P. aeruginosa 15 Dog - stra-strb P. aeruginosa 16 Dog TIM sul I P. aeruginosa 17 Dog - int I 1, sul I, aada P. aeruginosa 18 Dog - - P. aeruginosa 19 Dog TIM - P. aeruginosa 20 Dog FEP, GM - P. aeruginosa 21 Dog - - *ATM: aztreonam, IPM: imipenem, AM: ampicillin, AN: amikacin, CAZ: ceftazidime, CIP: ciprofloxacin, CM: chloramphenicol, CTX: cefotaxime, GM: gentamicin, NOR: norfloxacin, SM: streptomycin, SXT: sulfamethoxazole/trimethoprim, TC: tetracycline, CF: cephalothin, TIM: ticarcillin/clavulanic acid, FEP: cefepime. 이러한결과는이전연구자들의성적과유사하였으며 (Choi 등, 2010; Yoo 등, 2002), 아직까지이들항생제는세균감염증의치료제로서효과가있는것으로생각된다. 한편 E. coli를제외한나머지 Enterobacteriaceae (K. pneumoniae, A. baumannii, E. cloacae, C. koseri, M. morganii 및 P. mirabilis) 의경우공시균수가적어다른연구자들의성적과비교하기는어려우나 AM과 SM에대하여높은내성을나타내었다. 더욱이이번성적에는제시하지않았지만 K. pneumoniae의경우 AM, CF, SM 및 TIM을제외한나머지항생제에대하여내성을보인균주는없었다. 이는국내개와고양이에서분리된 K. pneumoniae는사용된대부분의약제에대하여높은내성을나타내었다고보고한다른연구자들의성적과는차이가있었다 (Kim 등, 2011; Park 등, 2004). 최근까지국내개와고양이에서분리된 A. baumannii, E. cloacae, C. koseri 및 M. morganii 에서항생제내성에관한보고는전무하다. 또한 K. pneumoniae 와 P. mirabilis의경우이번연구뿐만아니라다른연구에서도이들세균의분리균주수가적고, 사용된항생제의종류가이번연구에서사용된것과일치하 지않아단순한내성률의비교는어려웠으며. 향후보다많은수의균주를이용한추가적인연구가필요할것으로생각된다. P. aeruginosa는기회감염균으로 β-lactam 제제의일부를포함한여러항균제에자연내성이지만 CAZ, piperacillin 및 TIC 등에는비교적강한항균력을지닌다 (Chamberland 등, 1992). Yoo 등 (2002) 은개에서분리된 P. aeruginosa는 AM, CZ 및 SXT에대하여높은내성을보고하였고, Rubin 등 (2008) 은사용된대부분의항생제에높은내성을보고하였다. 그러나이번연구에서 P. aeruginosa는사용된모든약제에대해서낮은내성률을나타내어다소차이가있었다. 반면 Hirsh와 Jang(1994) 및 Pedersen 등 (2007) 은개에서분리된 P. aeruginosa는 AN, GM 및 TIC에높은감수성을보고하여이번연구의결과와유사하였다. 이번연구에서 class 1 integron은공시균의 38.6% 에서검출되었다. 이러한결과는이전연구자들이개와고양이에서보고한성적과는유사하였으나, 식용동물과사람에서보고한성적보다는낮았다 (Van Duijkeren 등, 2005; Kang 등, 2005b; Cocchi 등, 2007; Shaheen 등, 2010), 이는축종간항생제사용에따른선택적

7 개와고양이에서분리된 Enterobacteriaceae 와 Pseudomonas aeruginosa 의항균제내성및내성유전자의분포 177 압력 (selection pressure) 의차이에기인한것으로생각된다 (Rosser와 Young, 1999; Cocchi 등, 2007). 이번연구에서 class 2 integron은모든균주에서검출되지않았지만, 개와고양이유래대장균에서 class 2 integron 의존재는이전연구자들에의해보고가되고있다 (Goldstein 등, 2001; Yu 등, 2003; Shaheen 등, 2010). 이번연구에서 class 1 intgron이검출된공시균의대부분이 4종류이상의약제에다제내성을보여 class 1 integron의존재는다제내성의출현과관련이있음을확인하였다 (Goldstein 등, 2001; Shaheen 등, 2010). AM에내성을전달하는 TEM형 β-lactamase는 E. coli에서가장흔히검출되어이전연구자들의결과와유사하였다 (Sáenz 등, 2004; Carattoli 등, 2005). 또한 TEM형 β-lactamase는 E. cloacae와 M. morganii에서도각각 1주씩에서검출되었다. A. baumannii와 P. aeruginosa의경우 TEM형 β-lactamase를드물게생성하는것으로알려져있다 (Weldhagen, 2003). 이번연구에서도이들두균주에서 TEM형 β-lactamase는검출되지않았다. 한편외국의경우개와고양이유래 E. coli에서 SHV, OXA 및 CTX형 β-lactamase의검출에관한보고 (Teshager 등, 2000; Carattoli 등, 2005; Costa 등, 2008) 는있으나, 이번연구에서이들 β-lactamase는공시균모두에서검출되지않았다. 대부분 TC 내성균주는 teta 유전자를가장많이보유하고있는것으로알려져있으나 (Sengeløv 등, 2003), 이번연구에서는 tetb 유전자가가장많이검출되어다소차이가있었다. 그러나이러한성적은개와고양이에서분리된 E. coli에서 tetb 유전자가가장많이검출되었다는 Lanz 등 (2003) 의결과와는일치하였다. 한편 Costa 등 (2008) 은 TC에내성을나타낸 E. coli는개에서는 teta, 고양이에서는 tetb 유전자가많이검출되었다고보고하였다. 특히이번연구에서 teta 유전자를보유한 E. coli 2주는 tetb 유전자를동시에가지고있어 teta 유전자는다른유전자와복합적으로나타남을알수있었다. 이번연구에서 TC 내성유전자는 E. coli와 K. pneumoniae에서만검출이되어이들두균종이 TC에대한내성유전자를쉽게획득함을알수있었다. SM과 spectinomycin에내성을전달하는 stra-strb와 aada 유전자는 E. coli 같은그람음성균에서흔히발견되고있다 (Lanz 등, 2003; Kang 등, 2005a; Kang 등, 2005b). 이번연구에서도이들유전자는 E. coli, E. cloacae 및 K. pneumoniae에서검출되어이들유전자는그람음성균사이에서 SM 내성전달에중요한역 할을한다는것을알수있었다 (Sunde와 Norström, 2005). 개와고양이유래 P. aeruginosa에서 stra-strb 와 aada 유전자의검출에관한보고는드물지만 (Rubin 등, 2008), 이번연구에서는 stra-strb 유전자는 4주, aada 유전자는 1주에서검출되었다. Sulfonamides에내성을전달하는 sul I 유전자는 E. coli, E. cloacae, P. aeruginosa 및 M. morganii에서검출되어 sul I 유전자또한그람음성균사이에서널리분포하고있음을알수있었다. 특히 M. morganii 1주는 sul I와 sul II 유전자를동시에보유하고있었다. 한편 Sáenz 등 (2004) 은개유래 E. coli에서 sul I와 sul II 유전자는동시에존재함을보고하였다. 이번연구에서그람음성균에서 sul I 유전자는 sul II 유전자보다많이검출되었고, 이는이전연구자들의결과와일치하였다 (Lanz 등, 2003; Maynard 등, 2003). 최근까지 Enterobacteriaceae에서대부분의약제내성관련연구는 E. coli에한정되어있어타균종에서이들결과를비교하기는어려웠다. 향후이에관한많은조사가이루어져야할것으로생각된다. CM에대한내성은 cmla, cat 및 flo 유전자의존재와매우밀접한관련이있다. CM의 efflux pump를암호화하는 clma 유전자는소, 돼지및개에서분리된 E. coli에서주로보고가되고있다 (Bischoff 등, 2002; Sáenz 등, 2004; Shaheen 등, 2010). 이번연구에서 cmla 유전자는 E. coli와 P. aeruginosa에서각각한주에서검출되었으며, 이들두균주는 stra/strb 유전자를동시에보유하고있어 CM 내성유전자는다른유전자와공존함을알수있었다 (Sáenz 등, 2004). 한편국내의경우돼지유래 E. coli에서 clma 유전자에관한보고는있으나 (Kang 등, 2005b), 개에서분리한 P. aeruginosa에서 cmla 유전자에관한보고는이번조사가처음이다. 한편이번연구에서모든항생제내성균주가내성유전자를보유하는것은아닌것으로나타났다. 이는이번연구에서사용된내성유전자외다른종류의내성유전자가균주에존재할수있으며, 또한다른항생제내성기전에의한내성발현가능성이있어 (Bryan, 1984), 향후추가적인연구가필요할것으로생각된다. 이번연구결과개와고양이에서분리된 Enterobacteriaceae 중 E. coli에서다제내성균의높은출현과다양한항생제내성유전자의출현은동물병원에서항생제의광범위한사용과관련이있다. 이는임상에서치료효율의저하및사람으로내성균의전파가

8 178 조재근ㆍ김진현ㆍ김정미ㆍ박최규ㆍ김기석 이루어질수있으므로개와고양이에서항생제의신중한사용이요구된다. 아울러개와고양이등반려동물및이들과함께생활하는사람을대상으로항생제내성에대한추가적인연구가필요할것으로사료된다. 결 2009년 8월부터 2011년 12월까지대구지역동물병원에입원ㆍ치료중인개와고양이로부터분리한 Enterobacteriaceae 44주와 P. aeruginosa 21주에대한항생제내성유형및내성유전자의보유현황을조사한결과는다음과같았다. 항생제감수성시험결과 Enterobacteriaceae는공시균의 79.5%, P. aeruginosa는공시균의 47.6% 가사용된한가지이상의약제에내성을나타내었다. Enterobacteriaceae 중 E. coli (30주) 는 AM (56.7%), TC (53.3%), CF, SM 및 SXT ( 각각 43.3%), GM 및 NOR ( 각각 40.0%) 에높은내성을보였고, 나머지 Enterobacteriaceae (14주) 에서는 AM (64.3%) 과 SM (42.9%) 에높은내성을나타내었다. 한편 P. aeruginosa의경우는사용된모든약제에 15% 미만의낮은내성률을나타내었다. 한종류이상의약제에내성을나타낸 Enterobacteriaceae 36주와 P. aeruginosa 21주등총 57주를대상으로약제내성관련유전자의검출을실시한결과공시균의 38.6% (22주) 가 int I 1 유전자를가지고있었다. TEM, stra-strb, sul I, sul II, aada, teta, tetb 및 cmla 등 8종의약제내성관련유전자가단독또는다른유전자와동시에검출되었으나, int I2, SHV, CTX 및 OXA 유전자는모든균주에서검출되지않았다. 금후개와고양이에서항생제의신중한사용과지속적인모니터링이요구된다. 론 참고문헌 Bauer AW, Kirby WM, Sherris JC, Turck M Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathol 45: Belaaouaj A, Lapoumeroulie C, Caniça MM, Vedel G, Névot P, Krishnamoorthy R, Paul G Nucleotide sequences of the genes coding for the TEM-like beta-lactamases IRT-1 and IRT-2 (formerly called TRI-1 and TRI-2). FEMS Microbiol Lett 120: Bischoff KM, White DG, McDermott PF, Zhao S, Gaines S, Maurer JJ, Nisbet DJ Characterization of chloramphenicol resistance in beta-hemolytic Escherichia coli associated with diarrhea in neonatal swine. J Clin Microbiol 40: Bryan LE Aminoglycoside resistance. pp In: Bryan LE(ed.). Antimicrobial Drug Resistance. Academic Press, Orlando. Carattoli A, Lovari S, Franco A, Cordaro G, Di Matteo P, Battisti A Extended-spectrum beta-lactamases in Escherichia coli isolated from dogs and cats in Rome, Italy, from 2001 to Antimicrob Agents Chemother 49: Chamberland S, L'Ecuyer J, Lessard C, Bernier M, Provencher P, Bergeron MG Antibiotic susceptibility profiles of 941 gram-negative bacteria isolated from septicemic patients throughout Canada. The Canadian Study Group. Clin Infect Dis 15: Choi DY, Choi DS, Jang HK, Song HJ, Cho JG Antimicrobial susceptibility of bacterial isolates from domestic gogs with urinary tract infection. J Vet Clin 27: CLSI. Clinical and Laboratory Standards Institute Performance standards for antimicrobial susceptibility testing; Twenty-second informational supplement. M100-S22. Wayne, Pa, USA. Cocchi S, Grasselli E, Gutacker M, Benagli C, Convert M, Piffaretti JC Distribution and characterization of integrons in Escherichia. coli strains of animal and human origin. FEMS Immunol Med Microbiol 50: Coque TM, Oliver A, Pérez-Díaz JC, Baquero F, Cantón R Genes encoding TEM-4, SHV-2, and CTX-M-10 extended-spectrum beta-lactamases are carried by multiple Klebsiella pneumoniae clones in a single hospital (Madrid, 1989 to 2000). Antimicrob Agents Chemother 46: Costa D, Poeta P, Sáenz Y, Coelho AC, Matos M, Vinué L, Rodrigues J, Torres C Prevalence of antimicrobial resistance and resistance genes in faecal Escherichia. coli isolates recovered from healthy pets. Vet Microbiol 127: Goldstein C, Lee MD, Sanchez S, Hudson C, Phillips B, Register B, Grady M, Liebert C, Summers AO, White DG, Maurer JJ Incidence of class 1 and 2 integrases in clinical and commensal bacteria from livestock, companion animals, and exotics. Antimicrob Agents Chemother 45: Guardabassi L, Dijkshoorn L, Collard JM. Olsen JE, Dalsgaard A Distribution and in-vitro transfer of tetracycline resistance determinants in clinical and aquatic Acinetobacter strains. J Med Microbiol 49: Guardabassi L, Schwarz S, Lloyd DH Pet animals as reservoirs of antimicrobial-resistant bacteria. J Antimicrob Chemother 54: Hall RM, Collis CM Antibiotic resistance in gram-negative bacteria: the role of gene cassettes and integrons. Drug Resist Updates 1:

9 개와고양이에서분리된 Enterobacteriaceae 와 Pseudomonas aeruginosa 의항균제내성및내성유전자의분포 179 Hirsh DC, Jang S Antimicrobial susceptibility of selected infectious bacterial agents obtained from dogs. J Am Ani Hosp Assoc 30: Kadlec K, Schwarz S Analysis and distribution of class 1 and class 2 integrons and associated gene cassettes among Escherichia. coli isolates from swine, horses, cats and dogs collected in the BfT-GermVet monitoring study. J Antimicrob Chemother 62: Kang HY, Jeong YS, Oh JY, Tae SH, Choi CH, Moon DC, Lee WK, Lee YC, Seol SY, Cho DT, Lee JC. 2005a. Characterization of antimicrobial resistance and class 1 integrons found in Escherichia. coli isolates from humans and animals in Korea. J Antimicrob Chemother 55: Kang SG, Lee DY, Shin SJ, Ahn JM, Yoo HS. 2005b. Changes in patterns of antimicrobial susceptibility and class 1 integron carriage among Escherichia. coli isolates. J Vet Sci 6: Kim DK, Shin DH, Kim HY, Byun JW, Lee KH, Lee OS and Jung BY Antimicrobial sus-ceptibility of gramnegative bacteria from dogs and cats. J Vet Clin 28: Kim MS, Jeong JT, Kang SY, Yun YM, Lee JM, Lee DS, Son WG Antibiotic resistance of bacterial isolates from nasal discharges of dogs with respiratory diseases. J Vet Clin 21: Lanz R, Kuhnert P, Boerlin P Antimicrobial resistance and resistance gene determinants in clinical Escherichia. coli from different animal species in Switzerland. Vet Microbiol 91: Maynard C, Fairbrother JM, Bekal S, Sanschagrin F, Levesque RC, Brousseau R, Masson L, Larivière S, Harel J Antimicrobial resistance genes in enterotoxigenic Escherichia coli O149:K91 isolates obtained over a 23-year period from pigs. Antimicrob Agents Chemother 47: Mazel D, Dychinco B, Webb VA, Davies J Antibiotic resistance in the ECOR collection: integrons and identification of a novel aad gene. Antimicrob Agents Chemother 44: Normand EH, Gibson NR, Taylor DJ, Carmichael S. Reid SW Trends of antimicrobial resistance in bacterial isolates from a small animal referral hospital. Vet Rec 146: Park SW, Seo KW, Hwang CY, Youn HW, Han HY Isolation of bacteria from clinial specimens in veterinary medical teaching hospital and trend of antimicrobial susceptibility. J Vet Clin 21: Pedersen K, Pedersen K, Jensen H, Finster K, Jensen VF, Heuer OE Occurrence of antimicrobial resistance in bacteria from diagnostic samples from dogs. J Antimicrob Chemother 60: Pitout JD. Thomson KS, Hanson ND, Ehrhardt AF, Moland ES, Sanders CC beta-lactamases responsible for resistance to expanded-spectrum cephalosporins in Klebsiella pneumoniae, Escherichia. coli, and Proteus mirabilis isolates recovered in South Africa. Antimicrob Agents Chemother 42: Rosser SJ, Young HK Identification and characterization of class 1 integrons in bacteria from an aquatic environment. J Antimicrob Chemother 44: Rubin J, Walker RD, Blickenstaff K, Bodeis-Jones S, Zhao S Antimicrobial resistance and genetic characterization of fluoroquinolone resistance of Pseudomonas aeruginosa isolated from canine infections. Vet Microbiol 131: Sáenz Y, Briñas L, Domínguez E, Ruiz J, Zarazaga M, Vila J, Torres C Mechanisms of resistance in multiple-antibiotic-resistant Escherichia. coli strains of human, animal, and food origins. Antimicrob Agents Chemothe 48: Sengeløv G, Halling-Sørensen B, Aarestrup FM Susceptibility of Escherichia. coli and Enterococcus faecium isolated from pigs and broiler chickens to tetracycline degradation products and distribution of tetracycline resistance determinants in E. coli from food animals. Vet Microbiol 95: Shaheen BW, Oyarzabal OA, Boothe DM The role of class 1 and 2 integrons in mediating antimicrobial resistance among canine and feline clinical E. coli isolates from the US. Vet Microbiol 144: Sidjabat HE, Townsend KM, Lorentzen M, Gobius KS, Fegan N, Chin JJ, Bettelheim KA, Hanson ND, Bensink JC, Trott DJ Emergence and spread of two distinct clonal groups of multidrug-resistant Escherichia. coli in a veterinary teaching hospital in Australia. J Med Microbiol 55: Sunde M, Norström M The genetic background for streptomycin resistance in Escherichia. coli influences the distribution of MICs. J Antimicrob Chemother 56: Steward CD, Rasheed JK, Hubert SK, Biddle JW, Raney PM, Anderson GJ, Williams PP, Brittain KL, Oliver A, Mc- Gowan JE Jr, Tenover FC Characterization of clinical isolates of Klebsiella pneumoniae from 19 laboratories using the National Committee for Clinical Laboratory Standards extended-spectrum beta-lactamase detection methods. J Clin Microbiol 39: Teshager T, Domínguez L, Moreno MA, Saénz Y, Torres C, Cardeñosa S Isolation of an SHV-12 beta-lactamase-producing Escherichia. coli strain from a dog with recurrent urinary tract infections. Antimicrob Agents Chemother 44: Van Duijkeren EV, Box AT, Schellen P, Houwers DJ, Fluit AC Class 1 integrons in Enterobacteriaceae isolated from clinical infections of horses and dogs in the Netherlands. Microb Drug Resist 11: van den Bogaard AE, Stobberingh EE Epidemiology of resistance to antibiotics. Links between animals and humans. Int J Antimicrob Agents 14: Weldhagen GF, Poirel L, Nordmann P Ambler class A ex-

10 180 조재근ㆍ김진현ㆍ김정미ㆍ박최규ㆍ김기석 tended-spectrum beta-lactamases in Pseudomonas aeruginosa: novel developments and clinical impact. Antimicrob Agents Chemother 47: Yoo H, Park, Se-Won; Hwang, Cheol-Yong; Youn, Hwa-Young; Han, Hong-Ryu Aerobic antimicrobial susceptibility patterns of bacteria isolated from dog. J Vet Clin 19: Yu HS, Lee JC, Kang HY, Ro DW, Chung JY, Jeong YS, Tae SH, Choi CH, Lee EY, Seol SY, Lee YC, Cho DT Changes in gene cassettes of class 1 integrons among Escherichia. coli isolates from urine specimens collected in Korea during the last two decades. J Clin Microbiol 41: