296 Korean J Lab Med 2010;30: S. maltophila 감염증치료에는낮은항균제내성률을보이는 trimethoprim/sulfamethoxazole (TMP/SMX) 이일차치료제로사용되고있으며, quinolone, moxalactam,

Save this PDF as:
 WORD  PNG  TXT  JPG
Size: px
Start display at page:

Download "296 Korean J Lab Med 2010;30: S. maltophila 감염증치료에는낮은항균제내성률을보이는 trimethoprim/sulfamethoxazole (TMP/SMX) 이일차치료제로사용되고있으며, quinolone, moxalactam,"

Transcription

1 Korean J Lab Med 2010;30: DOI /kjlm Original Article Clinical Microbiology Analysis of Acquired Resistance Genes in Stenotrophomonas maltophilia Jeong Hoon Song, M.D. 1, Ji Youn Sung, Ph.D. 1, Kye Chul Kwon, M.D. 1, Jong Woo Park, M.D. 1, Hye Hyun Cho, B.S. 1, So Yeon Shin, M.D. 1, Young Hyun Ko, M.D. 1, Ji Myung Kim, M.D. 2, Kyeong Seob Shin, M.D. 3, and Sun Hoe Koo, M.D. 1 Department of Laboratory Medicine 1, College of Medicine, Chungnam National University, Daejeon; Department of Laboratory Medicine 2, Eulji University Hospital, Daejeon; Department of Laboratory Medicine 3, College of Medicine, Chungbuk National University, Cheongju, Korea Background : Stenotrophomonas maltophilia is a gram-negative bacillus and a nosocomial pathogen in immunocompromised patients. Trimethoprim/sulfamethoxazole (TMP/SMX) is the drug of choice for treating S. maltophilia infection; however, resistance to TMP/SMX is increasing. In this study, we investigated the relationship between the incidence of TMP/SMX resistance and the presence of sul genes and mobile elements. Methods : A total of 120 S. maltophilia isolates were collected from 3 university hospitals between April 2007 and April Antimicrobial susceptibilities were determined using the disk diffusion method. PCR and DNA sequencing were conducted for the detection of sul1, sul2, class 1 integron, and ISCR2 element. Repetitive extragenic palindromic sequence-based PCR (REP-PCR) was carried out to evaluate the genetic relatedness. Results : The TMP/SMX-resistant (R) isolates harbored a significantly higher proportion of sul1 gene and class 1 integron than TMP/SMX-susceptible (S) isolates (P<0.001). Seventeen of 28 isolates with sul1 also had a class 1 integron, but none of the isolates without sul1 had a class 1 integron. The identified gene cassettes within class 1 integrons include aaca4, aada1, aac6 -II, and qac. None of the 120 isolates carried sul2, glmm, or ISCR2 element. REP-PCR did not show any genetic relatedness among the isolates. Conclusions : In Korea, the resistance of S. maltophilia isolates to TMP/SMX is due to sul1 within a class 1 integron rather than to sul2. The class 1 integron also harbors multiple antibiotic resistance genes in addition to sul1, and therefore it could mediate multidrug resistance in S. maltophilia. (Korean J Lab Med 2010;30: ) Key Words : Stenotrophomonas maltophilia, Trimethoprim/sulfamethoxazole, sul1 gene, Class 1 integron 서 Stenotrophomonas maltophilia는포도당비발효그람음성막대균으로, 자연계나병원환경, 환자의인공호흡기등에서자주분리되어부패균이나오염균으로오인되기쉽다. 병원성이약하여건강인의감염은흔하지않으나, 면역력이약한악성종 Received : March 8, 2010 Manuscript No : KJLM Revision received : April 29, 2010 Accepted : April 30, 2010 Corresponding author : Sun Hoe Koo, M.D. Department of Laboratory Medicine, College of Medicine, Chungnam National University, 640 Daesa-dong, Jung-gu, Daejeon , Korea Tel : , Fax : shkoo@cnu.ac.kr ISSN 론 The Korean Society for Laboratory Medicine 양, 백혈병및림프종환자에서는감염률이높으며, 집중치료실의입원환자등에게자주감염을일으키는원내감염균의하나이다 [1-8]. 또한임상미생물검사실에서분리되는포도당비발효그람음성간균중에세번째로흔한균으로보고되고있다 [1-3]. 원내감염을일으키는 S. maltophilia는 b-lactam, b-lactamase 억제제및 aminoglycoside 등많은항균제에자연내성을갖는다. S. maltophilia의자연내성은 L1과 L2 b-lactamases 생산에의한 b-lactam 항균제내성, aminoglycosidemodifying 효소등에의한 aminoglycoside 항균제내성, 그리고 SmeDEF 다약제유출펌프발현에의한다약제내성등에의해나타난다 [9, 10]. 이는 S. maltophilia 감염증치료시항균제선택을어렵게만드는요인이된다. 295

2 296 Korean J Lab Med 2010;30: S. maltophila 감염증치료에는낮은항균제내성률을보이는 trimethoprim/sulfamethoxazole (TMP/SMX) 이일차치료제로사용되고있으며, quinolone, moxalactam, 그리고 ticarcillin-clavulanic acid 등도사용되고있다 [11]. 그런데최근이항균제들에대해내성을보이는 S. maltophilia가증가하고있어많은문제가되고있다 [9]. TMP/SMX 중한성분인 sulfamethoxazole에대한세균의내성은염색체의 dihydropteroate synthase (DHPS) 유전자 (folp) 의돌연변이나대체 DHPS 유전자 (sul1) 의획득을통하여일어나는데, 두가지내성기전중에서 sul1 유전자의획득에의한내성의빈도가높은것으로알려져있다 [12]. 특히 sul1 유전자는 class 1 integron의 3 말단에위치하여쉽게다른균주로전달되는특징이있어 TMP/SMX 내성확산의우려를낳고있다. sul1 유전자이외에 sul2 유전자가 TMP/SMX 내성과연관이있는것으로알려져있는데, 이유전자는 insertion element common region (ISCR2) element에의하여전파될수있음이밝혀졌다 [13]. ISCR2 element에는 sul2 유전자이외에 phosphoglucosamine mutase를 encoding하는 glmm 유전자와 florfenicol/chloramphenicol 내성단백질을 encoding하는 flor 유전자등여러유전자와연결되어이들유전자의전파에도관여하는것으로알려져있다 [13]. 이러한 TMP/SMX에대한내성확산은 S. maltophilia 감염증치료에많은어려움을야기할수있으므로 TMP/SMX내성에관한연구는중요하지만국내에서는아직이에대한연구가거의없는실정이다. 본연구에서는충청지역 3곳의대학병원진단검사의학과에의뢰된임상검체에서분리된 S. maltophila균에대해서 TMP/SMX에대한획득내성과이에관련한내성유전자에대해서분석하고자하였다. 또한내성유전자의균주간전파에관련된것으로알려진 integrons과 mobile element인 ISCR element의 TMP/SMX 내성유전자와의연관성을알아보았다. 재료및방법 1. 균주의수집 2007년 4월부터 2009년 4월까지충청지역의 3개의과대학병원진단검사의학과에의뢰된임상검체에서분리된총 120균주의 S. maltophilia를대상으로하였다. 항균제내성에상관없이분리된순서대로균주를수집하였으며, 동일환자에서반복분리된균주는수집대상에서제외하였다. 분리된균주의동정은집락의형태, oxidase 및 Vitek GNI card (biomerieux Vitek Inc., Hazelwood, MO, USA) 를이용한생화학적방법으로확인하였다. 2. 항균제감수성시험 TMP/SMX에대한감수성을디스크확산법으로확인하였고미국의 CLSI 지침에따라억제대의지름이 10 mm 이하인경우내성으로판단하였다 [8, 14]. 항균제감수성시험에대한정도관리를위해서 Escherichia coli ATCC 25922와 Pseudomonas aeruginosa ATCC 27853을동시에시험하여허용범위내에있는지를확인하였다 [14]. 3. 분자생물학적방법에의한유전형확인 1) sul1 및 sul2의검출중합효소연쇄반응 (PCR) 과염기서열분석을통하여 sul1과 sul2 유전자를검출하였다. 시발체로는이미보고된바있는 sul1과 sul2 유전자로명명된염기서열을이용하였다 (Table 1)[1]. 대상균주를 brain heart infusion broth (Difco, Cockeysville, MD, USA) 에접종하여 37 에서하룻밤진탕배양한후배양액으로부터 DNA purification kit (SolGent, Daejeon, Korea) 를사용하여염색체 DNA를추출하였다. DNA 추출액 (5 ml), 10 Taq buffer (2.5 ml), 10 mm dntp mix (0.5 ml), primer 각 10 pmol, 0.7 U Taq DNA polymerase (SolGent) 및증류수 Table 1. Oligonucleotide primers used for PCR amplification and sequencing Primer pairs Target Sequence (5-3 ) Reference Int1 F inti1 CAGTGGACATAAGCCTGTTC [15] Int1 R CCCGAGGCATAGACTGTA Int2 F inti2 GTAGCAAACGAGTGACGAAATG [15] Int2 R CACGGATATGCGACAAAAAGGT Int3 F inti3 GCCTCCGGCAGCGACTTTCAG [15] Int3 R ACGGATCTGCCAAACCTGACT LECR2 ISCR2 CACTGGCTGGCAATGTCTAG [13] RECR2 CTTTGGACCGCAGTTGACTC glmr glmm GAGTCAACTGCGGTCCAAAC [13] glmf ACGGTATTCGTGGCAAAGCC FloF flor TCGACATCCTGGCTTCACTG [13] FloR ATTACAAGCGCGACAGTGGC Sul1 F sul1 GGATTTTTCTTGAGCCCCGC [1] Sul1 R CATTGCCGATCGCGTGAAGT Sul2 F sul2 CCTGTTTCGTCCGACACAGA [1] Sul2 R GAAGCGCAGCCGCAATTCAT Abbreviations: F, forward; R, reverse.

3 Song JH, et al., Resistance Gene in S. maltophilia 297 를혼합하여총부피 25 ml의반응용액을만들었다. Gene Amp PCR System 9600 (Perkin-Elmer Centus Corp., Norwalk, CT, USA) 으로 95 에서 5분간반응시킨후, 95 에서 20초, 59 에서 40초, 72 에서 30초씩 30회증폭반응시키고, 72 에서 5분간연장반응시켰다. 각각의 PCR 생산물을 ethidium bromide가포함된 1% 우무겔에서 40분간전기영동하여밴드를확인하였다. 증폭산물을 DNA extraction kit (SolGent) 로분리후, BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Foster City, CA, USA) 와 ABI PRISM 3730xl DNA analyzer (PE Applied Biosystems) 를이용하여염기서열을분석하였다. 2) ISCR2 element의검출 sul2 유전자의존재가확인된균주를대상으로 ISCR2, glmm 그리고 Flo를검출하기위해기존의시발체를이용하여 sul 유전자분석때와동일한반응용액과조건으로 PCR을수행하였다 (Table 1)[13]. 3) Integron의검출 Class 1, 2 및 3에속하는 integron을검출하기위해다중 PCR 을수행하였다 (Table 1)[15]. sul 유전자분석때와동일한반응용액을사용하였으며반응조건만다르게하여 95 에서 5분간반응시킨후, 94 에서 1분, 59 에서 1분, 72 에서 1분씩 30 회증폭반응시키고, 72 에서 5분간연장반응시켰다. 각각의 PCR 생산물을 ethidium bromide가포함된 1.5% 우무겔에서 40분간전기영동하여밴드를확인하였다. PCR 생산물밴드의위치가약 160 bp, 788 bp 및 979 bp인것을각각 class 1, 2 및 3 integron으로간주하였다 [15]. 4) Class 1 integron의유전자카세트유전형확인 Class 1 integron 내에존재하는유전자카세트의유전형을확인하기위해 5 보존영역 (GGCATCCAAGCAGCAAG) 과 3 보존영역의분절 (AAGCAGACTTGACCTGA) 을시발체로하여 PCR을수행하였다 [16]. sul1 유전자분석때와같은조성의반응용액 25 ml를 95 에서 5분간반응시킨후, 94 에서 1분, 55 에서 1분, 72 에서 4분씩 30회증폭반응시키고, 72 에서 10 분간연장반응시켰다. 각각의 PCR 생산물을 ethidium bromide가포함된 1% 우무겔에서 40분간전기영동하여밴드를확인한후염기서열분석을수행하였다. 5 보존영역과 3 보존영역의분절을시발체로하여얻어진각각의 PCR 생산물을염기서열분석한뒤, 말단부분에서다시새로운시발체를 디자인하여 PCR을수행하고염기서열분석을하는일련의과정을되풀이하는 primer walking 방법으로전체염기서열을분석하여 sul1 이외의유전자카세트의존재를확인하였다. 4. Repetitive extragenic palindromic sequence-based PCR (REP-PCR) 을이용한분자역학조사기존에보고된시발체 (5 -IIIICGICGICATCIGGC-3 and 5 -ICGICTTATC IGGCCTAC-3 ) 를사용하여 REP-PCR을시행하였다 [17]. 증폭반응은 DNA 추출액 (5.0 ml), 10 Taq buffer (5.0 ml), 10 mm dntp mix (1.0 ml), primer 각 20 pmol, 1.4 U Taq DNA polymerase (SolGent) 및증류수를혼합하여 50 ml의혼합액으로시행하였다. Gene Amp PCR System 9600 (Perkin-Elmer Centus Corp) 으로 95 에서 5 분간반응시킨후, 90 에서 40초, 42 에서 1분, 68 에서 7 분씩 35회증폭반응시키고, 68 에서 15분간연장반응시켰다. 증폭산물 (10 ml) 은 ethidium bromide가포함된 2% 우무겔에전기영동한후 BioDoc-14 TM Imaging system (UVP, Cambridge, UK) 을이용하여분석하였다. 5. 통계 SPSS ver 12.0 (SPSS inc., Chicago, IL, USA) 을사용했고, Fisher의정확한검증을이용하여 P<0.05를통계적으로유의한것으로판단하였다. 결과 1. 항균제감수성양상환자의임상검체에서분리된 S. maltophilia 120 균주를대상으로 TMP/SMX에대한항균제감수성시험을한결과, 내성률은 16% (19/120) 이었고감수성률은 84% (101/120) 이었다. 2. sul1과 sul2 유전자및 ISCR2 element 검출항균제감수성시험에서 TMP/SMX에내성을보인 19균주중 13균주 (68.4%) 에서 sul1 유전자가검출되었다. 반면, TMP/SMX 에감수성을보인 101균주중에서는 15균주 (14.7%) 만이 sul1 유전자를가지고있는것으로나타났다. sul1 양성률은 TMP/SMX 에내성인균주가감수성인균주보다월등히높아 sul1과 TMP/

4 298 Korean J Lab Med 2010;30: Table 2. Incidence of trimethoprim/sulfamethoxazole resistance in S. maltophilia and relation to sul1, sul2, glmm, class 1 integron, and ISCR2 element Trimethoprim/sulfamethoxazole Resistant Susceptible P value* N of isolates N of isolates with sul <0.001 N of isolates with sul2 0 0 N of isolates with class 10 7 < integrons N of isolates with ISCR2 0 0 N of isolates with glmm 0 0 *Fisher s exact test. SMX 내성이서로상관관계가있음이확인되었다 (P<0.001). 한편, sul2는 120균주중단한주에서도검출되지않았고 ISCR2 element도관찰되지않았다 (Table 2). 3. Class 1 integron 검출 다중 PCR을이용하여 integron을검출한결과, 대상균주 120 균주중 17 균주에서 class 1 integron에해당하는 PCR 산물이얻어졌다. 이들을대상으로 class 1 integron 검출을위한 PCR 과염기서열분석을수행한결과 17 균주모두가 class 1 integron 을가지고있는것이확인되었다. 이중 10주는 TMP/SMX 내성균주였고 7주는 TMP/SMX 감수성균주로내성균주에서의 class 1 integron의보유율 (52.6%, 10/19) 이감수성균주에서의보유율 (6.9%, 7/101) 보다높은것으로나타났다 (P<0.001; Table 2). 이들 class 1 integron이검출된 17균주모두 sul1 유전자를가지고있었다. 그리고검출된 class 1 integron 내에는 aaca4, qac, aac6 -II 및 aada1 유전자카세트들이포함되어있었다. 한편 class 2와 class 3 integron은검출되지않았다 (Table 2). 4. REP-PCR 시험기간중총 120주의 S. maltophilia를대상으로이들이같은 clone에서유래되었는지를확인하기위하여 REP-PCR을수행한결과서로다른 band 패턴을보여서로다른클론에서유래되었음이확인되었다 (Fig. 1). 고 S. maltophilia는주요치료제인 TMP/SMX에아직까지는비교적낮은내성률을보이고있으나점차내성률이증가하는 찰 M1 S9 S10 S11 S12 S13 M1 S19 S20 S21 S26 S27 S28 S29 S30 S31 M1 S35 S36 S37 S38 S85 S86 Fig. 1. Repetitive extragenic palindromic-pcr (REP-PCR) fingerprints of S.maltophilia isolates. Lanes M1 are 1-kb DNA size markers. 추세에있다 [1, 18]. 본연구에서분리된 S. maltophilia의 TMP/ SMX 내성률은 16% 로 2003년대만에서분리된 S. maltophilia 의내성률인 25% 보다는낮았으나 2004년아메리카와유럽에서분리된 S. maltophilia의내성률인 3.8% 보다는 4배이상높은것으로나타났다. 이는지역에따라 TMP/SMX 내성률에큰차이가있으며, 특히아시아에서의내성률이높음을의미한다 [1, 19]. TMP/SMX에내성을나타내는기전은다양하나그중 sul1 유전자의획득에의한내성의빈도가높은것으로알려져있다 [12]. 본연구에서분리된 TMP/SMX 내성 S. maltophilia 균주는 TMP/SMX 감수성균주보다 4배이상많은균주에서 (68.4%, 13/19) 가 sul1 유전자를가지고있는것으로나타났다 (P<0.001). 대만에서분리된 S. maltophilia도 TMP/SMX 내성균주중 81% (21/26) 에해당하는균주가 sul1 유전자를가지고있음이확인되었다 [1]. 이는 TMP/SMX 내성에 sul1 유전자가관여함을의미한다. 그러나본연구에서 sul1 양성을보였으나 TMP/SMX 에감수성을보인 15균주가관찰되었고, 대만의연구에서도 8 균주가관찰되었는데 [1], 이러한균주에서의 TMP/SMX의치료효과등에관한연구도필요할것으로사료된다. 한편, sul1 유전자는염색체 DNA상에존재하기도하지만주로 class 1 integron의 3 말단에포함되어존재한다. 따라서 class 1 integron의존재가균주의 TMP/SMX 내성에중요한역할을한다고할수있다. 아르헨티나에서의보고에서도 S. maltophilia에서 class 1 ingegron의존재가 TMP/SMX에대한 minimal inhibitory concentration (MIC) 증가와상관관계가있다는것이밝혀졌다 [20]. 본연구에서도 TMP/SMX 내성균주중 52.6% (10균주) 가 class 1 integron을가지고있는것으로나타났으며, 이는감수성균주에서의양성률 (6.9%) 보다 7배이상높은수치였다 (P<0.001). 또한 TMP/SMX 내성을보인 sul1 양성균주중 76.9% (10/13) 에서 class 1 integron 양성을보였고, class 1 integron을가지고있는균주는모두 sul1 유전자를가지고있어서 sul1 유전자의전파가 class 1 integron 과높은연관성이있음을확인하였다.

5 Song JH, et al., Resistance Gene in S. maltophilia 299 본연구에서검출된 class 1 integron들은 700 bp에서 2,500 bp까지크기가다양했으며 3 말단에 sul1 유전자를가지고있었다. 뿐만아니라 aminoglycoside 내성유전자인 aaca4, aac6 -II 및 aada1과 quaternary ammonium compound 내성에관여하는 qac 유전자카세트들이포함되어있어 S. maltophilia의다약제내성에중요한역할을하는것으로나타났다. 대만에서분리된 S. maltophilia에서검출된 class 1 integron 에서도 aminoglycoside 내성유전자인 aada2, aaca4, aadb 및 aac6 -Ib 와 chloramphenicol 내성유전자인 cmla과 quaternary ammonium compound 내성에관여하는 qac 등이포함되어있음이확인된바있다 [1, 20]. Class 1 integron뿐아니라다른 mobile elements도 sul 유전자와연관있는것으로알려져있다. Toleman 등 [13] 의연구에의하면 ISCR2 element에의해서 sul2 유전자가 S. maltophilia로전파될수있다는것이보고된바있다. 그러나본연구에서는 120균주중한주도sul2 유전자를가지고있지않는것으로나타났으며아울러 ISCR2 element와 glmm 유전자도검출되지않았다. TMP/SMX 내성균주에서 sul2 유전자가검출되지않고주로 sul1 유전자가검출된것으로보아우리나라의 S. maltophilia 임상균주의 TMP/SMX 내성은주로 sul1 유전자에의한것으로생각된다. 그러나, sul2 유전자와 ISCR2 element의 TMP/SMX 내성연관성을정확히알기위해서는추가적인연구가필요할것으로사료된다. S. maltophilia의역학은아직완전히규명되지않아서, 임상균주간의유전적연관성을밝힐수있는여러가지신속하고신뢰할수있는기술들이필요하게되었다. Pulsed-field gel eletrophoresis는이러한목적으로흔히사용되는방법이지만, 특수한장비가필요하고, 검사시간이오래걸리며, 숙련자가필요하다는단점이있다. 그래서 PCR을이용한많은기술들이사용되기시작하였고, 그중하나가 repetitive-sequence PCR 이고여기에는 enterobacterial repetitive intergenic consensus-pcr, BOX-PCR, REP-PCR 등이있다. REP-PCR 을이용하여 S. maltophilia의유전적연관성을검사한것은 Lin 등 [17] 에의해서처음시도된바있다. 본실험에서총 120 균주를대상으로 REP-PCR을시행한결과높은유전적다양성을보이고있었고, 유전적연관성은없어서병원내환자간감염은없었던것으로생각되었다. 요약배경 : Stenotrophomonas maltophilia는그람음성간균 으로면역이저하된환자에게기회감염을일으키는것으로알려져있다. Trimethoprim/sulfamethoxazole (TMP/SMX) 은 S. maltophilia 감염의최우선치료약제이지만점차내성률이증가하고있다. 이번연구에서는 3곳의대학병원에의뢰된임상검체에서분리된 S. maltophilia를대상으로 TMP/SMX 내성률과 sul 유전자, 그리고이들유전자의전파와연관된것으로알려진 integrons, ISCR2 element 등의연관성에관하여조사하였다. 방법 : 2007년 4월부터 2009년 4월까지충청지역 3곳의대학병원진단검사의학과의의뢰된임상검체에서분리된총 120 균주의 S. maltophilia균을대상으로실험하였다. 디스크확산법에의하여항균제감수성검사를하였고, PCR과 DNA 염기서열분석을통하여 sul1 유전자, sul2 유전자, integrons 그리고ISCR2 element를검출하고자하였고, REP-PCR을통해서이들임상균주사이의유전적연관성을조사하였다. 결과 : 총 120균주중에서 19균주가 TMP/SMX에내성을보이고있었다. TMP/SMX 내성균주는감수성균주에비해서높은비율로 sul1 유전자와 class 1 integron을가지고있었다 (P< 0.001). sul1 유전자를가진 28균주중 17 균주가 class 1 integron을가지고있었고, sul1 유전자를가지지않은균주는 class 1 integron을한균주도가지고있지않아서 sul1 양성균주에서 class 1 integron의양성률이높았다 (P<0.001). Class 1 integron의 DNA 염기서열을분석한결과 sul1 유전자이외에 aaca4, aada1, aac6 -II 그리고 qac 등여러내성유전자가발견되었다. 결론 : 충청지역 3곳의대학병원의임상검체에서분리된 S. maltophilia의 TMP/SMX 내성은외국과다르게 sul2 유전자에의한경우는발견되지않았고, 주로 sul1 유전자에의해서발생한다는것을확인하였다. 또한 sul1 유전자는 class 1 integron에의해서전파되며, class 1 integron은여러내성유전자를함유하고있어, S. maltophilia의다제내성을유발할수있음을확인하였다. 참고문헌 1. Chang LL, Lin HH, Chang CY, Lu PL. Increased incidence of class 1 integrons in trimethoprim/sulfamethoxazole-resistant clinical isolates of Stenotrophomonas maltophilia. J Antimicrob Chemother 2007; 59: Valdezate S, Vindel A, Loza E, Baquero F, Canton R. Antimicrobial susceptibilities of unique Stenotrophomonas maltophilia clinical strains.

6 300 Korean J Lab Med 2010;30: Antimicrob Agents Chemother 2001;45: Ahn GY, Yu FN, Jang SJ, Kim DM, Park G, Moon DS, et al. Pseudooutbreak of Stenotrophomonas maltophilia due to contamination of bronchoscope. Korean J Lab Med 2007;27: ( 안균열, 유봉남, 장숙진, 김동민, 박건, 문대수등. 기관지내시경오염에기인한 Stenotrophomonas maltophilia의가유행발생. 대한진단검사의학회지 2007;27: ) 4. Harlowe HD. Acute mastoiditis following pseudomonas maltophilia infection: case report. Laryngoscope 1972;82: Sutter VL. Identification of Pseudomonas species isolated from hospital environment and human sources. Appl Microbiol 1968;16: Ben-Tovim T, Eylan E, Romano A, Stein R. Gram-negative bacteria isolated from external eye infections. Infection 1974;2: Gardner P, Griffin WB, Swartz MN, Kunz LJ. Nonfermentative gramnegative bacilli of nosocomial interest. Am J Med 1970;48: Seol SY, Jang KS, Jeong OG, Cho ER, Kim NH, Yu HS, et al. Antimicrobial resistance and molecular epidemiologic characteristics of Stenotrophomonas maltophilia isolated from clinical specimen. J Korean Soc Microbiol 2000;35: ( 설성용, 장경수, 정웅기, 조응래, 김능희, 유학선등. 병원재료에서분리한 Stenotrophomonas maltophilia의항균제내성및분자역학적특성. 대한미생물학회지 2000;35: ) 9. Chang LL, Chen HF, Chang CY, Lee TM, Wu WJ. Contribution of integrons, and SmeABC and SmeDEF efflux pumps to multidrug resistance in clinical isolates of Stenotrophomonas maltophilia. J Antimicrob Chemother 2004;53: Zhang L, Li XZ, Poole K. SmeDEF multidrug efflux pump contributes to intrinsic multidrug resistance in Stenotrophomonas maltophilia. Antimicrob Agents Chemother 2001;45: Sader HS and Jones RN. Antimicrobial susceptibility of uncommonly isolated non-enteric Gram-negative bacilli. Int J Antimicrob Agents 2005;25: Perreten V and Boerlin P. A new sulfonamide resistance gene (sul3) in Escherichia coli is widespread in the pig population of Switzerland. Antimicrob Agents Chemother 2003;47: Toleman MA, Bennett PM, Bennett DM, Jones RN, Walsh TR. Global emergence of trimethoprim/sulfamethoxazole resistance in Stenotrophomonas maltophilia mediated by acquisition of sul genes. Emerg Infect Dis 2007;13: Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; sixteenth informational supplement. M100-S18 (M2). Wayne, PA: Clinical and Laboratory Standards Institute, Dillon B, Thomas L, Mohmand G, Zelynski A, Iredell J. Multiplex PCR for screening of integrons in bacterial lysates. J Microbiol Methods 2005;62: Levesque C, Piche L, Larose C, Roy PH. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob Agents Chemother 1995;39: Lin CW, Chiou CS, Chang YC, Yang TC. Comparison of pulsed-field gel electrophoresis and three rep-pcr methods for evaluating the genetic relatedness of Stenotrophomonas maltophilia isolates. Lett Appl Microbiol 2008;47: Garrison MW, Anderson DE, Campbell DM, Carroll KC, Malone CL, Anderson JD, et al. Stenotrophomonas maltophilia: emergence of multidrug-resistant strains during therapy and in an in vitro pharmacodynamic chamber model. Antimicrob Agents Chemother 1996; 40: Fedler KA, Biedenbach DJ, Jones RN. Assessment of pathogen frequency and resistance patterns among pediatric patient isolates: report from the 2004 SENTRY Antimicrobial Surveillance Program on 3 continents. Diagn Microbiol Infect Dis 2006;56: Barbolla R, Catalano M, Orman BE, Famiglietti A, Vay C, Smayevsky J, et al. Class 1 integrons increase trimethoprim-sulfamethoxazole MICs against epidemiologically unrelated Stenotrophomonas maltophilia isolates. Antimicrob Agents Chemother 2004;48:666-9.

untitled

untitled ORIGINAL ARTICLE Korean J Clin Lab Sci. Vol. 45, No. 1, Mar. 2013 21 Korean J Clin Lab Sci. 2013, 45(1):21-25 ISSN 1738-3544 Errors of Antibiotic Susceptibility Testing from Automated and Manual Systems

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

untitled

untitled 210 Ji Youn Sung. PMQR Genes among CTX-M-14 Producing E. coli ORIGINAL ARTICLE Korean J Clin Lab Sci. 2016, 48(3):210-216 http://dx.doi.org/10.15324/kjcls.2016.48.3.210 pissn 1738-3544 eissn 2288-1662

More information

ORIGINAL ARTICLE Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist

ORIGINAL ARTICLE   Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist ORIGINAL ARTICLE http://dx.doi.org/10.15263/jlmqa.2015.37.4.209 Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resistance: MicroScan versus Etest Goeun Kang, Hyun Soo Kim,

More information

< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770>

< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770> 대한임상검사학회지 : 40권제2호, 75-79, 2008 ISSN 1738-3544 대구지역병원에서분리된 Acinetobacter baumannii와 Pseudomonas aeruginosa의항생제내성현황 대구보건대학임상병리과 1, 세명대학교임상병리학과 2 김수정 1 이재식 2 Antibiotic Resistance Patterns of Acinetobacter

More information

untitled

untitled Korean J Clin Microbiol Vol. 12, No. 1, March, 2009 Characterization of Class 1 Integrons in Metallo-βlactamase-producing Pseudomonas aeruginosa Ji Youn Sung, Sun Hoe Koo, Kye Chul Kwon, Jong Woo Park,

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

( )Kju225.hwp

( )Kju225.hwp 비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

untitled

untitled Korean J Clin Microbiol Vol., No., December, 20 http://dx.doi.org/0.55/kjcm.20...3 Chromosomal Mutations in oprd, gyra, and parc in Carbapenem Resistant Pseudomonas aeruginosa Ji Youn Sung, Hye Hyun Cho

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr

자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr Original Article pissn 1738-2637 J Korean Soc Radiol 2012;67(2):129-134 The Survey of Magnetic Resonance Imaging Quality according to in Korea 1 자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 1 Hyun-Hae

More information

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를 Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4) THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method

More information

1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus

More information

A Case of Acute Cholecystitis Caused by Stenotrophomonas maltophilia Bacteremia,. 5,6 B S. maltophilia. 증례 B,, 3 2 (entecavir 0.5 mg) 7. 3,.

A Case of Acute Cholecystitis Caused by Stenotrophomonas maltophilia Bacteremia,. 5,6 B S. maltophilia. 증례 B,, 3 2 (entecavir 0.5 mg) 7. 3,. Case Report The Korean Journal of Pancreas and Biliary Tract 2014;19:189-193 http://dx.doi.org/10.15279/kpba.2014.19.4.189 pissn 1976-3573 eissn 2288-0941 Stenotrophomonas maltophilia 균혈증에의해발생한급성담낭염 1

More information

untitled

untitled 대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran

More information

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung

More information

04김호걸(39~50)ok

04김호걸(39~50)ok Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*

More information

Trd022.hwp

Trd022.hwp 김신태, 이선녕, 이석정, 정필문, 박홍준, 신명상, 김종환, 이부길, 김상하, 리원연, 신계철, 용석중 Shin-Tae Kim, M.D., Shun Nyung Lee, M.D., Seok Jeong Lee, M.D., Pil Moon Jung, M.D., Hong Jun Park, M.D., Myung Sang Shin, M.D., Chong Whan Kim,

More information

09권오설_ok.hwp

09권오설_ok.hwp (JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction

More information

untitled

untitled ORIGINAL ARTICLE Korean J Clin Lab Sci. 2017;49(4):427-434 https://doi.org/10.15324/kjcls.2017.49.4.427 pissn 1738-3544 eissn 2288-1662 Korean J Clin Lab Sci. Vol. 49, No. 4, December 2017 427 Distribution

More information

- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -

More information

..........5-45..

..........5-45.. K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals

More information

Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI: 3 * Effects of 9th

Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI:   3 * Effects of 9th Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp.357-378 DOI: http://dx.doi.org/10.21024/pnuedi.29.2.201906.357 3 * Effects of 9th Grade Students Participation in Career Curriculum Cluster

More information

(

( 317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,

More information

K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis

More information

???춍??숏

???춍??숏 Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY

More information

( )Kju269.hwp

( )Kju269.hwp 만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University

More information

jaeryomading review.pdf

jaeryomading review.pdf 4 5 6 7 8 9 10 11 12 13 1. S. Kim, H. Y. Jeong, S. K. Kim, S. Y. Choi and K. J. Lee, Nano Lett. 11, 5438 (2011). 2. E. Menard, K. J. Lee, D. Y. Khang, R. G. Nuzzo and J. A. Rogers, Appl. Phys. Lett. 84,

More information

untitled

untitled 대한내과학회지 : 제 72 권제 1 호 27 Streptococcus pneumoniae와 Haemophilus influenzae 임상분리주에대한 Cefditoren의시험관내항균력 인제대학교의과대학일산백병원감염내과, 울산대학교의과대학서울아산병원감염내과 2, 울산대학교항균제내성ㆍ미생물유전학연구센터 3 곽이경 추은주 2, 3 박수진 3 이정은 3 정진용 2,

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770> 대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실

More information

- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α

More information

005송영일

005송영일 Received : 2015. 12. 09 Reviewed : 2015. 12. 16 Accepted : 2015. 12. 16 Sternal Fracture occurred after Thai Massage : A Case Report Young-Il Song, K.M.D. 1, Dong-Eun Kim, K.M.D. 1 1 Department of Rehabilitation

More information

한국성인에서초기황반변성질환과 연관된위험요인연구

한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words

More information

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu 한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -

More information

α α α α α

α α α α α α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer

패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 1 2 3 4 5 6 7 8 9 9 2010.1 Fashionbiz

More information

<353420B1C7B9CCB6F52DC1F5B0ADC7F6BDC7C0BB20C0CCBFEBC7D120BEC6B5BFB1B3C0B0C7C1B7CEB1D7B7A52E687770>

<353420B1C7B9CCB6F52DC1F5B0ADC7F6BDC7C0BB20C0CCBFEBC7D120BEC6B5BFB1B3C0B0C7C1B7CEB1D7B7A52E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 13, No. 2 pp. 866-871, 2012 http://dx.doi.org/10.5762/kais.2012.13.2.866 증강현실을 이용한 아동교육프로그램 모델제안 권미란 1*, 김정일 2 1 나사렛대학교 아동학과, 2 한세대학교 e-비즈니스학과

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con

Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI:   (NCS) Method of Con Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency

More information

Microsoft PowerPoint - PDFCoTemp.PPT

Microsoft PowerPoint - PDFCoTemp.PPT 주요유방염세균의검출및 항생제감수성검사 임숙경 1. 검사시료 1. 시료채취 유방염우유 2. 체세포수측정 3. 대상세균 - Staphylococcus aureus - Coagulase negative staphylococci -Escherichia coli 3. 균분리방법 E. coli CHEC Agar 직접도말 (37 18-24h) 보라색집락 EMB Agar

More information

12이문규

12이문규 Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental

More information

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF. 1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -

More information

°Ç°�°úÁúº´6-2È£

°Ç°�°úÁúº´6-2È£ K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine

More information

08김현휘_ok.hwp

08김현휘_ok.hwp (Regular Paper) 21 3, 2016 5 (JBE Vol. 21, No. 3, May 2016) http://dx.doi.org/10.5909/jbe.2016.21.3.369 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a), a) An Audio Coding Technique Employing the Inter-channel

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina

More information

04조남훈

04조남훈 Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache

More information

12_HM hwp

12_HM hwp The Korean Journal of Microbiology (2010) Vol. 46, No. 3, pp. 303-307 Copyright c 2010, The Microbiological Society of Korea 단보 국내에서분리된 Acinetobacter baumannii 의 Integron 과연관된다제내성분석 김성환 최지혜 박은진 서인원 손승렬

More information

( )Kjhps043.hwp

( )Kjhps043.hwp Difference of Fistula Maturation Degree and Physical Property by the Types of Tube Material: An Experimental Study Sang Koo Kang, M.D. 1, Hee Chul Yu, M.D. 1,4, Woo Sung Moon, M.D. 2,4, Ju Hyoung Lee,

More information

untitled

untitled 대한마취과학회지 2008; 55: 190~6 Korean J Anesthesiol Vol. 55, No. 2, August, 2008 임상연구 대한민국의 마취통증의학 임상실습 현황 연세대학교 의과대학 마취통증의학교실 및 마취통증의학연구소 장동진ㆍ안소운ㆍ안지원ㆍ김종훈 The current status of anesthesiology clerkship in Korea

More information

1

1 - MEDIC (MEDical Intelligent wheelchair ) MedicalIntelligent, Wheelchair MEDIC. MEDIC LG Global Challenger 2003 - 1. 3 2. 4 2.1 4 (1) 4 (2) 5 2.2 6 (1) 6 (2) 6 (3) 7 3. 8 3.1 8 3.2 10 3.3 11 4. 12 4.1

More information

<5BC0FAC0DABCF6C1A430355D434D30362D313320BEE7BAB4BCB12D E687770>

<5BC0FAC0DABCF6C1A430355D434D30362D313320BEE7BAB4BCB12D E687770> 대한임상검사학회지 : 38 권제 3 호, 173-178, 2006 Multiplex Polymerase Chain Reaction 을이용한 Extended-Spectrum β-lactamase 생성 Klebsiella pneumoniae 균주의검출 진주보건대학임상병리과 양병선 Detection of Extended-Spectrum β-lactamase Producing

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI:   : Researc Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education

More information

Æ÷Àå82š

Æ÷Àå82š Lee, Kyungbae (E-mail : kblee6078@ex.co.kr) Lee, Jaehoon (E-mail : ranian74@ex.co.kr) Sohn, Duecksu (E-mail : mgsds@ex.co.kr) Kwon, Soonmin (E-mail : soonmini2@ex.co.kr) ABSTRACT PURPOSES : The purpose

More information

- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol

More information

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( : 27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,

More information

충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~ Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교

충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~ Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교 충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~5 2017 Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교의과대학마취통증의학교실, 의학연구소 (28644), happycat19@hanmail.net

More information

김범수

김범수 Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis

More information

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*

More information

14.531~539(08-037).fm

14.531~539(08-037).fm G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked

More information

untitled

untitled Ann Clin Microbiol Vol., No., September, http://dx.doi.org/./acm... ISSN - Loss of bla and bla IMP- during the Storage of Gram- Bacilli, Antimicrobial Susceptibility of the Gene-Lost Strain, and Location

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   3 * The Effect of H Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales

More information

04_이근원_21~27.hwp

04_이근원_21~27.hwp 1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 27(2), 2007, 96-121 S ij k i POP j a i SEXR j i AGER j i BEDDAT j ij i j S ij S ij POP j SEXR j AGER j BEDDAT j k i a i i i L ij = S ij - S ij ---------- S ij S ij = k i POP j a i SEXR j i AGER j i BEDDAT

More information

2 - ceftazidime-clavulanate 디스크를이용하여 ESBL 생성균주를확인하였다. 또한 2009년도에수집된균주인 P. aeruginosa(386주 ), A. baumannii(349주 ) 를대상으로 imipenem에대한감수성을확인하였고 imipenem-h

2 - ceftazidime-clavulanate 디스크를이용하여 ESBL 생성균주를확인하였다. 또한 2009년도에수집된균주인 P. aeruginosa(386주 ), A. baumannii(349주 ) 를대상으로 imipenem에대한감수성을확인하였고 imipenem-h 1 - 국내종합병원을대상으로한항균제내성모니터링 Monitoring of antimicrobial resistance on general hospitals in Korea 질병관리본부국립보건연구원감염병센터약제내성과 연세대학교의과대학진단검사의학교실, 세균내성연구소 Ⅰ. 들어가는말 항균제내성세균의출현과확산으로인하여세균감염증치료는점점어려워지고있다 [1-4]. 항균제내성률은흔히국가간,

More information

Æ÷Àå½Ã¼³94š

Æ÷Àå½Ã¼³94š Cho, Mun Jin (E-mail: mjcho@ex.co.kr) ABSTRACT PURPOSES : The performance of tack coat, commonly used for layer interface bonding, is affected by application rate and curing time. In this study, bonding

More information

KJFP Jeongsook Yoon. bla VIM-2 of Pseudomonas aeruginosa in primary hospitals in Korea Vitek(Biomerieux, Marcy 1 Etoile, France) 으로균을동정하였다. 항균제감수성검사는디

KJFP Jeongsook Yoon. bla VIM-2 of Pseudomonas aeruginosa in primary hospitals in Korea Vitek(Biomerieux, Marcy 1 Etoile, France) 으로균을동정하였다. 항균제감수성검사는디 KJFPpISSN 2233-9019 eissn 2233-9116 Original Article 한국 1 차병원의 Pseudomonas aeruginosa 에서 blavim-2 유전자관찰 윤정숙 서울베스티안병원 bla VIM-2 of Pseudomonas aeruginosa in primary hospitals in Korea Jeong-sook Yoon Director

More information

untitled

untitled Korean J Clin Microbiol Vol. 11, No. 2, October, 2008 Characteristics of Acquired β-lactamase Gene in Clinical solates of Multidrug-resistant Pseudomonas aeruginosa un Yang Chung 1, Ji Youn ung 2, Kye

More information

Crt114( ).hwp

Crt114( ).hwp cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1

More information

09구자용(489~500)

09구자용(489~500) The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal

More information

09È«¼®¿µ 5~152s

09È«¼®¿µ5~152s Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,

More information

12(2) fm

12(2) fm Journal of Dental Hygiene Science Vol. 12, No. 2, pp. 109~113 (2012) 임상에서분리한 Streptococcus pneumoniae 에서 Levofloxacin 내성유전자의비교연구 최재민 1 박선희 1 윤지아 1 한양금 2 이인수 1 1 한남대학교생명공학과, 2 대전보건대학교치위생 ( 학 ) 과 Comparative

More information

:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( )

:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( ) :,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α=.83.91.,.,,..,,,.,. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ..,.,.,. Bandura(1997),.,,,,., (,,, 2009), (,,,, 2014).?.,,,.. Bandura (1995) (Resiliency

More information

03(12-65)p fm

03(12-65)p fm 한국임상약학회지제 23 권제 1 호 Kor. J. Clin. Pharm., Vol. 23, No. 1. 2013 화상감염소아환자에서분리된주요균종에대한항생제의내성률 강주연 신혜순 * 덕성여자대학교약학대학 (2012 년 12 월 28 일접수 2013 년 3 월 2 일수정 2013 년 3 월 4 일승인 ) Antimicrobial Resistance of Clinically

More information

기관고유연구사업결과보고

기관고유연구사업결과보고 기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

10(3)-10.fm

10(3)-10.fm w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction

More information

???? 1

???? 1 The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1

More information

< D34312D303628BEE7BAB4BCB12CC0B0B1D9B5B9292E687770>

< D34312D303628BEE7BAB4BCB12CC0B0B1D9B5B9292E687770> 대한임상검사학회지 : 41권제4호, 153-157, 2009 ISSN 1738-3544 SHV ESBL 생성 Klebsiella pneumoniae 균주의실시간중합효소반응분석 진주보건대학임상병리과 1, 대전보건대학임상병리과 2 양병선 1 육근돌 2 Real-Time PCR Analysis of SHV Extended-Spectrum beta-lactamases

More information

1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.

More information

00약제부봄호c03逞풚

00약제부봄호c03逞풚 경희대학교 동서신의학병원 약품 정보지 2 0 0 7. S P R I N G. V O L. 0 1 신약 소개 02 Journal Review 03 Special Subject 04 복약 지도 06 의약품 안전성 정보 07 약제부 알림 07 약제부 업무 소개 08 E A S T - W E S T N E O M E D I C A L C E N T E R 본 약품

More information

<35BFCFBCBA2E687770>

<35BFCFBCBA2E687770> 주요개념 : 컴퓨터음란물 접촉자, 성지식, 성태도 남자중학생의 컴퓨터음란물 접촉자와 비접촉자간의 성지식과 태도의 차이 김 영 혜* 이 화 자** 정 향 미*** 1. 연구의 필요성 한국은 I. 서 론 1960 년대 이후부터 시작된 돌진적 산업화 ( 한 상진, 1996) 로 인하여 경제적 부흥을 이루어 집집마다 TV 수상기를 가질 수 있게 되었고 최근에는 PC보급율

More information

untitled

untitled Ann Clin Microbiol Vol. 19, No. 2, June, 2016 http://dx.doi.org/10.5145/acm.2016.19.2.48 pissn 2288-0585 eissn 2288-6850 Distribution and Antimicrobial Resistance of Streptococcus pneumoniae at Four University

More information

Microsoft Word - 3-이유철.doc

Microsoft Word - 3-이유철.doc Journal of Bacteriology and Virology 2007. Vol. 37, No. 2 p.79 89 임상가검물에서분리한 Stenotrophomonas maltophilia 의유전적다양성 경북대학교의과대학미생물학교실 장경수 오재영 강희영 진종숙 설성용 김정민 이제철 조동택 이유철 * Genetic Diversity of Stenotrophomonas

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 16 Jul.; 27(7), 64662. http://dx.doi.org/./kjkiees.16.27.7.646 ISSN 1226-3133 (Print)ISSN 2288-226 (Online) 2D Microwave Image

More information

A 617

A 617 Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R

More information

16(1)-3(국문)(p.40-45).fm

16(1)-3(국문)(p.40-45).fm w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University

More information

<B8F1C2F72E687770>

<B8F1C2F72E687770> 제1장 제17장 성홍열 및 사슬알균 감염증 사슬알균 (Streptococci)은 증식 중의 특징적으로 쌍 또는 사슬모양의 그람양성 알균 으로 catalase 음성, 통성혐기성균이며, 보통 한천배지에서는 발육이 어렵고 혈액이나 혈청 등을 첨가한 배지에서 잘 발육한다. 포도당이나 다른 탄수화물을 분해하나 포도당 을 분해하여 가스를 생성하지 않는다. 이들은 최소

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 28(3),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 28(3), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2017 Mar.; 28(3), 163 169. http://dx.doi.org/10.5515/kjkiees.2017.28.3.163 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) PCB

More information

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Sep.; 30(9), 712 717. http://dx.doi.org/10.5515/kjkiees.2019.30.9.712 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) MOS

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp DOI: * A Study on Teache

Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp DOI:   * A Study on Teache Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp.149-171 DOI: http://dx.doi.org/10.21024/pnuedi.27.4.201712.149 * A Study on Teachers and Parents Perceptions on the Introduction of Innovational

More information