untitled

Save this PDF as:
 WORD  PNG  TXT  JPG
Size: px
Start display at page:

Download "untitled"

Transcription

1 Korean J Clin Microbiol Vol., No., December, 20 Chromosomal Mutations in oprd, gyra, and parc in Carbapenem Resistant Pseudomonas aeruginosa Ji Youn Sung, Hye Hyun Cho 2, Kye Chul Kwon 2, Sun Hoe Koo 2 Department of Biomedical Laboratory Science, Far East University, Eumseong, 2 Department of Laboratory Medicine, College of Medicine, Chungnam National University, Daejeon, Korea Background: Outbreaks of carbapenem resistant P. aeruginosa give rise to significant therapeutic challenges for treating nosocomial infections. In this study, we analyzed carbapenem resistance mechanisms in carbapenem resistant and clonally different P. aeruginosa strains. We analyzed chromosomal alterations in the genes of OprD and efflux system regulatory proteins (MexR, NalC, NalD, MexT, and MexZ). We also investigated chromosomal alterations in the quinolone resistance-determining region (QRDR) for quinolone resistance mechanisms. Methods: Twenty-one clonally different P. aeruginosa strains were isolated by repetitive extragenic palindromic sequence-based PCR (rep-pcr). PCR and DNA sequencing were conducted for the detection of β-lactamase genes and chromosomal alterations of efflux pump regulatory genes, oprd, and QRDR in gyra, gyrb, parc, and pare. Results: Only one (P2) of the 2 strains harbored bla VIM-2. Two isolates had mutations in nald or mexz that were associated with efflux pump overexpression. Chromosomal alterations causing loss of OprD were found in out of 2 carbapenem resistant P. aeruginosa strains. Nine of 0 imipenem and ciprofloxacin resistant strains had alterations in gyra and/or parc. Conclusion: Carbapenem resistance in P. aeruginosa was mediated by several mechanisms, including loss of the OprD, overexpression of efflux systems, and production of carbapenemase. Resistance to quinolone is frequently caused by point mutations in gyra and/or parc. (Korean J Clin Microbiol 20;: 3-37) Key Words: Carbapenem resistant P. aeruginosa, OprD, Efflux system regulatory proteins, QRDR 서 녹농균에의한감염증치료에는 carbapenem계항균제가많이사용되어왔는데이는작용범위가넓고, extended-spectrum β-lactamase (ESBL) 을포함한대부분의 β-lactamase에저항성을보여그람음성균의치료에매우효과적이기때문이다 []. 그러나, 최근 carbapenem에도내성을보이는녹농균의감염이증가하고있어심각한문제가되고있다 [2]. 녹농균의 carbapenem 내성은주로세포막의투과성감소, 항균제의유출, 그리고 carbapenemase 생성등에의해나타난다 [3]. 이중 carbapenemase 생성을제외한나머지기전은염색체상의유전자변이에의해나타나는것으로클론성으로내성이확산된다 []. 항균제가제기능을하기위해서는녹농균의외막층을먼저통과해야하는데외막의구멍단백질 (outer membrane porin proteins) 이감소하면세포질내로항균제가들어갈수없게된다. Received 27 July, 20, Revised 0 October, 20 Accepted 7 October, 20 Correspondence: Sun Hoe Koo, Department of Laboratory Medicine, College of Medicine, Chungnam National University Hospital, 0 Daesa-dong, Jung-gu, Daejeon 30-72, Korea. (Tel) , (Fax) , ( ) shkoo@cnu.ac.kr 론 특히외막의구멍단백질중 OprD 의소실은녹농균의 carbapenem 에대한내성과밀접하게관련된다고알려져있다. 우리나라에서분리된녹농균을대상으로한연구에서도 carbapenem 내성균에서 OprD 단백이소실되거나감소되었음이확인된바있다 [5]. 또한녹농균은세포내로들어간항균제를적극적으로세포밖으로퍼내는유출계 (efflux system) 를작동시킴으로써세포내항균제농도를감소시키는데이러한능동적인약물배출은녹농균이항균제에내성을갖게하는중요한기전이다. 유출계중특히 RND (resistance nodulation division) 계열인 MexAB- OprM, MexEF-OprN, MexCD-OprJ 그리고 MexXY-OprM 등이녹농균에서중요한역할을한다. 이들유출계는각각의조절인자들에의해그발현이제한된다. 그러나조절인자의유전자에변이가생겨그기능을하지못하게되면유출계가다량발현하게되어항균제내성을유발한다 [6]. 유출계의발현조절과관련된유전자로는 MexAB-OprM 계를조절하는 mexr, nalc 및 nald와 MexEF-OprN 계를조절하는 mext와 mexs 등이있다 [7]. MexAB-OprM의발현억제유전자인 mexr과두번째그리고세번째조절인자인 nalc 및 nald에변이가생기면 Mex- AB-OprM계의발현량이증가한다. 2006년미국에서분리된 3

2 Korean J Clin Microbiol 20;():3-37 carbapenem 내성녹농균에서도 mexa의발현량이증가된균들대부분에서 nalc와 / 또는 nald의변이가확인된바있다 []. MexEF-OprN 계의발현을조절하는 mext와 mexs에돌연변이가생기면 MexEF-OprN 계도역시과량발현된다. mext는그외에도 OprD 단백과 MexAB-OprM 계의억제조절인자로작용한다. mexz 또한조절인자로작용을하며 MexXY-OprM 계의과량발현을유도함이확인되었다 [9,0]. 녹농균은염색체상의유전자변이에의한것뿐아니라내성유전자의획득에의해서도 carbapenem에내성을갖게되는데대표적인것이 carbapenem을불활성화시키는효소인 carbapenemase 의획득이다. 특히획득성 carbapenemase 에의한내성은다른균에그내성유전자를전달할수있다는점에서내성확산의우려를낳고있다. 녹농균이생성하는대표적인 carbapenemase로는 class A의 GES형 β-lactamase, class B의 VIM, IMP, SIM, GIM 및 SPM형 metallo-β-lactamase (MBL), class D의 OXA-23, OXA-2, OXA-25, OXA-26, OXA-27, OXA-0, OXA-5 및 OXA-5형 β-lactamase 등이있다 [,2]. 한편녹농균은염색체상에존재하는유전자의변이에의해 carbapenem 항균제이외에도다른항균제들에내성을나타낸다. 그중하나가 quinolone 내성인데 DNA gyrase 와 topoisomerase IV 유전자를암호화하는 quinolone 내성결정부위 (QRDR; quinolone resistance-determining region) 의변이는녹농균이 quinolone에내성을갖는데중요한역할을한다 [3]. DNA gyrase 는 GyrA와 GyrB라는단량체소단위 (monomeric subunits) 로구성되고 topoisomerase IV는 ParC와 ParE라는단량체소단위로구성되기때문에이들유전자에변이가생기면항균제내성이증가한다 []. 이러한내성기전들로인해 carbapenem 또는 quinolone 내성을갖게된녹농균의출현및확산은이세균에의한감염증치료에많은어려움을가중시킬수있으므로임상적으로중요한문제이다. 따라서녹농균의항균제내성기전을밝히는것은이균의특성을이해하고, 치료와예방계획을수립하는데중요하다. 본연구에서는대전의한대학병원에서분리된 imipenem 내성녹농균을대상으로녹농균의 carbapenem 내성기전을밝히기위해 OprD 단백유전자및유출계조절유전자들에변이가있는지를조사하였고 carbapenemase의유전형을규명하였다. 더불어 quinolone 내성에관여하는 QRDR의변이도함께연구하여염색체상의유전자변이와항균제내성과의관련성을조사하였다. 재료및방법. 균주의수집 2006년 7월부터 200년 3월까지충남대학교병원진단검사의학과에의뢰된임상검체에서분리된녹농균중 imipenem 에내성을보인 62주를대상으로하였다. 항균제내성에상관없이분리 된순서대로균주를수집하였으며, 동일환자에서반복분리된균주는수집대상에서제외하였다. 분리된균주의동정은집락의형태, oxidase 및 Vitek GNI card (biomerieux Vitek Inc., Hazelwood, Mo., USA) 를이용한생화학적방법으로확인하였다. 2. 항균제감수성시험미국의 Clinical and Laboratory Standards Institute (CLSI) 지침에따라 amikacin (Sigma-Aldrich, St. Louis, MO., USA), gentamicin (Sigma-Aldrich), ceftazidime (Hanmi, Seoul, Korea), cefepime (Boryung, Seoul, Korea), imipenem (MSD, Westpoint, Pa., USA), meropenem (Yuhan, Seoul, Korea) 및 ciprofloxacin (ICN Biomedicals, Aurora, Ohio, USA) 에대한최소억제농도 (MIC, minimal inhibitory concentration) 를한천희석법으로측정하였다 [5]. 정도관리를위해서 Escherichia coli ATCC 25922와 P. aeruginosa ATCC 2753을동시에시험하여허용범위내에있는지를확인하였다. 3. Repetitive extragenic palindromic sequence-based PCR (rep-pcr) 을이용한클론선택 DNA purification kit ( 솔젠트, 대전, 한국 ) 로대상균주의염색체 DNA를추출하여주형 DNA로사용하였다. Primer 로는 ERIC2 (5'-AAGTAAGTGACTGGGGTGAGCG-3') 와 REP2-Dt (5'-NCGNCTTATCNGGCCTAC-3') 로명명된장내세균의반복서열을이용하였다 [6]. 증폭반응은 DNA 추출액 (5.0 μl), 0 Taq buffer (5.0 μl), 0 mm dntp mix (.0 μl), primer 각 20 pmol,. U Taq DNA polymerase ( 솔젠트 ) 및증류수를혼합하여 50 μl의혼합액으로시행하였다. Gene Amp PCR System 9600 (Perkin-Elmer Centus Corp., Norwalk, CT., USA) 으로 95 o C에서 5분간반응시킨후, 90 o C에서 0초, 2 o C에서 분, 6 o C에서 7분씩 35회증폭반응시키고, 6 o C에서 5분간연장반응시켰다. 증폭산물 (0 μl) 은 ethidium bromide가포함된 2% agarose gels에전기영동한후 BioDoc- TM Imaging system (UVP, Cambridge, UK) 을이용하여분석하였다. 밴드의강도와상관없이밴드의분자량과개수로각균주를비교하며, 두개이상의밴드차이가있으면역학적상관관계가없는것으로판단하였다 [7].. 분자생물학적방법에의한유전형확인및유전자변이조사 ) Carbapenemase 의유전형분석 : Class A 유전자 (bla GES), class B 유전자 (bla IMP, bla VIM, bla SIM, bla SPM, bla SIM), class D 유전자 (bla OXA-23, bla OXA-2, bla OXA-5) 를검출하기위해이미보고된바있는기존의시발체를사용하여중합효소연쇄반응 (polymerase chain reaction, PCR) 과염기서열분석을시행하였다 []. DNA 추출액 (5 μl), 0 Taq buffer (2.5 μl), 0 mm dntp mix (0.5 μl), primer 각 0 pmol, 0.7U Taq DNA poly-

3 Ji Youn Sung, et al. : Chromosomal Mutations in Carbapenem Resistant P. aeruginosa 33 merase ( 솔젠트 ) 및증류수를혼합하여총부피 25 ml의반응용액을만들었다. Gene Amp PCR System 9600 (Perkin-Elmer Centus Corp.) 으로 95 o C에서 5분간반응시킨후, 95 o C에서 20 초, 59 o C에서 0초, 72 o C에서 30초씩 30회증폭반응시키고, 72 o C에서 5분간연장반응시켰다. 각각의 PCR 생산물을 ethidium bromide가포함된 2% agarose gel에서 0분간전기영동하여밴드를확인하였다. 증폭산물을 DNA extraction kit ( 솔젠트 ) 로분리후, BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Foster City, CA, USA) 와 ABI PRISM 3730xl DNA analyzer (PE Applied Biosystems) 를이용하여염기서열을분석하였다. 2) 염색체상에존재하는유전자의변이조사 : PCR과염기서열분석을통하여염색체상에존재하는항균제내성관련유전자의변이를조사하였다. 유출계의중요한조절유전자인 mexr, nalc, nald, mext 및 mexz와외막의구멍단백질유전자인 oprd의변이를조사하였고더불어 gyra, gyrb, parc 및 pard 의 QRDR 변이도확인하였다. 사용한시발체는 Table 에기술하였고 PCR 반응용액과염기서열분석방법은 carbapenemase의유전형분석때와동일하게하였다. 결과. 항균제감수성양상시험기간중총 62주의 imipenem 내성녹농균이환자의임 상검체에서분리되었다. 이들이같은클론에서유래되었는지를확인하기위하여 rep-pcr을수행한결과 62주가 2가지의밴드패턴을보였다. 각기다른밴드패턴을보인균주한주씩을선택하여총 2주를대상으로항균제에대한 MIC를측정한결과대상균주 2주중한주 (P5) 를제외한 20주가 imipenem 에고도내성을보였다 (MIC > mg/l) (Table 2). 2. Carbapenemase 유전형및염색체유전자의변이 ) Carbapenemase 유전형 : Carbapenemase 유전자검출을위해 PCR을수행한결과대상균주 2주중한주 (P2) 만이 bla VIM 에양성반응을보였다. PCR 생산물을염기서열분석한결과 bla VIM-2 의염기서열과일치하였다. 한편 2주의 imipenem 내성녹농균에서 Ambler class A와 D 에속하는 carbapenemase 유전자는검출되지않았다. 2) 유전자의변이조사 : 유출계의중요한조절유전자인 mexr, nalc, nald, mext 및 mexz의변이를조사한결과, 대상균주 2 주중 7주가 mexr에 Val 26 Glu 변이를가지고있었고 주가 nalc에 Gly 7 Glu 및 Ser 209 Arg 변이를가지고있었다. nald 에변이를가지고있는균주는한주로 Thr Ala 변이를가지고있었다. 2주중 5주가 mext에 Leu 26 Val 변이를가지고있었고 mexz에서다양한변이가확인된균주도 2주나되었다 (Table 3). 외막의구멍단백질유전자인 oprd의변이를조사한결과총 주에서변이가확인되었는데 주중한주는 Tyr 9 stop Table. Oligonucleotide primers for the detection of efflux regulator-encoding, OprD, and QRDR genes Primer pairs Target Sequence (5 3 ) Reference Efflux regulator-encoding genes mexr-f mexr-r nalc-f nalc-r nald-f nald-r mext-f mext-r mexz-f mexz-r Opr D gene oprd-f oprd-r QRDR gene GyrA-F GyrA-R ParC-F ParC-R ParE-F ParE-R GyrB-F GyrB-R mexr nalc nald mext mexz oprd gyra parc pare gyrb TGTTCTTAAATATCCTCAAGCGG GTTGCATAGCGTTGTCCTCA TCAACCCTAACGAGAAACGCT TCCACCTCACCGAACTGC GCGGCTAAAATCGGTACACT ACGTCCAGGTGGATCTTGG AAAACCACCCGTCGTTATTG CAGTTCGTCGGTGTAGCTGA ATTGGATGTGCATGGGTG TGGAGATCGAAGGCAGC ATGCGACATGCGTCATGCAAT CGGTACCTACGCCCTTCCTT CGGGATGAACGAATTGGGTGTGA AATTTTACTCATACGTGCTTCGG TTCCCGTGCATTTCGATCAGTACTTC CGTATGACAAAGGATTCGGTAAATC GTCCGTAAAGCAATCAAAG CTTTATATAAAGGCGGTAACG TGAAATTCTTGCTGGAAAAC CAACAATAGGACGCATGTAAC

4 3 Korean J Clin Microbiol 20;():3-37 Table 2. Minimum inhibitory concentrations (MICs) of the 7 antimicrobial agents for 2 isolates of imipenem-resistant Pseudomonas aeruginosa as determined by agar dilution Isolates MICs (mg/l) AMK GEN CAZ FEP IPM MEM CIP Rep-PCR identical strains* P P2 P3 P P5 P6 P P P5 P7 P P20 P2 P P P53 P55 P70 P6 P9 P ,02, > > > > 2 > > > 2 > > *The number of strain(s) shown identical rep-pcr band pattern. Abbreviations: AMK, amikacin; GEN, gentamicin; CAZ, ceftazidime; FEP, cefepime; IPM, imipenem; MEM, meropenem; CIP, ciprofloxacin. Table 3. Chromosomal alteration(s) in efflux regulator-encoding genes of imipenem-resistant Pseudomonas aeruginosa Isolate Chromosomal alteration(s) in MexR NalC NalD MexT MexZ P P2 P3 P P5 P6 P P P5 P7 P P20 P2 P P P53 P55 P70 P6 P9 P92 Val 26 Glu Val 26 Glu Val 26 Glu Val 26 Glu Val 26 Glu Val 26 Glu Val 26 Glu Gly 7 Glu, Ser 209 Arg Gly 7 Glu, Ser 209 Arg Gly 7 Glu, Glu 53 Gln, Ser 209 Arg Gly 7 Glu, Glu 53 Gln, Ser 209 Arg Gly 7 Glu, Ser 209 Arg Gly 7 Glu, Ser 209 Arg Gly 7 Glu, Glu 53 Gln, Ser 209 Arg Gly 7 Glu, Ala 6 Thr Gly 7 Glu, Ser 209 Arg Gly 7 Glu, Ser 209 Arg Gly 7 Glu, Ser 209 Arg Gly 7 Glu, Glu 53 Gln, Ser 209 Arg Gly 7 Glu, Ser 209 Arg Gly 7 Glu, Ser 209 Arg Thr Ala Ser 6 Asp Ser 6 Asp His 5 Tyr, Arg 3 Leu, Ser 6 Asp Arg 3 Leu, Ser 6 Asp Arg 3 Leu, Ser 6 Asp Gln stop Arg 3 Leu, Ser 6 Asp Arg 3 Leu, Ser 6 Asp Arg 3 Leu, Ser 6 Asp Arg 3 Leu, Ser 6 Asp Arg 3 Leu, Ser 6 Asp Ser 6 Asp

5 Ji Youn Sung, et al. : Chromosomal Mutations in Carbapenem Resistant P. aeruginosa 35 Table. Chromosomal alteration(s) in oprd, gyra, and parc of imipenem-resistant Pseudomonas aeruginosa Isolate P P2 P3 P P5 P6 P P P5 P7 P P20 P2 P P P53 P55 P70 P6 P9 P92 Chromosomal alteration(s) in OprD GyrA ParC Deletion bp Tyr 9 stop Deletion G 333 GA insertion after A Thr3 Ile Thr3 Ile Thr3 Ile Thr3 Ile Thr3 Ile Thr3 Ile Thr3 Ile, Asp 7 Tyr Thr3 Ile Thr3 Ile Thr3 Ile Ser 7 Trp 변이를가지고있었고나머지 3주는 frameshift 를가지고있었다 (Table ). 한편 gyra, gyrb, parc 및 pard의 QRDR 변이를조사한결과 2주중 0주가 gyra에변이를가지고있는것으로확인되었다. 이들 0주는모두 Thr 3 Ile 변이를가지고있었으며그중한주 (P20) 는 Asp 7 Tyr 변이도같이가지고있었다. parc 에변이를가지고있는균주는모두 2 주였는데그중 주가 변이를가지고있었고나머지한주가 Ser 7 Trp 변이를가지고있었다 (Table ). 반면에 gyrb와 pard에서는변이가발견되지않았다. 고 Carbapenem 항균제는녹농균이생성하는여러가지 β-lactamase에안정하며분자량이작고양성 (zwitterionic) 하전및친수성구조여서세균세포내로잘투과되는장점이있다. 따라서 carbapenem은여러 β-lactam제에내성인녹농균의감염치료에쓸수있는귀중한항균제이다. 그러나 carbapenem 사용이늘어감에따라최근에는 carbapenem에도내성을보이는다제내성녹농균의감염이증가하고있어임상적으로많은문제가되고있다. 따라서 carbapenem 내성기전을밝히는것은녹농균감염을치료하는데매우중요하다. 녹농균의 carbapenem 내성기전을조사하기위해 imipenem 찰 내성이면서유전적으로는서로다른균주를수집한결과총 2 주의녹농균이임상검체로부터얻어졌다. 수집된총 2주의 imipenem 내성녹농균을대상으로유출계의조절유전자인 mexr, nalc, nald, mext 및 mexz의변이를조사한결과 7주에서 mexr에, 그리고 주에서 nalc에변이가있는것이확인되었다. 그러나이들유전자의변이는녹농균에서빈번하게발견되는변이이기는하나 mexa의발현에직접적으로양향을주는변이는아니다 [,9]. 2주중한주 (P20) 가 nald에 Thr Ala 변이를가지고있었는데이변이는 mexa의발현량증가와관련이있는것으로확인된바있다 []. mext와 mexz 또한많은변이를가지고있었으나실제로발현에영향을주는변이를가지고있는균주는한주 (P5) 뿐이었다. 이균주 (P5) 는아미노산이 stop codon으로치환된변이를가지고있었는데, 2006 년미국에서도 mexz의염기가바뀌어서 stop codon이된경우에 mexx의발현량이증가했다는보고가있었다 []. Imipenem 내성균 2주를대상으로유출펌프조절유전자에변이가있는지를조사한결과많은균주가유전자에변이를가지고있었으나실제로발현량에중요한영향을주는변이를가지고있었던균주는 2주 (P5, P20) 뿐이었다. 그러나이균주들의 carbapenem에대한 MIC는유출펌프조절유전자에변이를갖고있지않는균주들과크게차이가없었다. 200년의보고에서도유출펌프의발현량보다는 OprD 단백발현이 carbapenem 내성에크게기여한다고하였다 [5]. 본연구에서도 oprd의변이를조사한결과총 주에서 OprD 단백발현억제와관련된변이가확인되었다 (Table ). 주중한주는 Tyr 9 stop 변이를가지고있었고나머지 3주는 frameshift를가지고있었는데유전자상에 stop codon이나 frameshift가생기면이는 OprD의소실을유발한다 [,7]. OprD 단백발현억제와관련된변이가확인된 개의균주는모두 imipenem (MIC >52 mg/l) 과 meropenem (MIC mg/l) 에대해고도내성을보였는데이는녹농균의경우 OprD 단백발현이 carbapenem 내성에중요한역할을하고있음을시사한다. 녹농균 2주를대상으로 carbapenem 내성획득에중요한역할을하는 carbapenemase의유전형을조사한결과대상균주 2 주중한주 (P2) 가 VIM-2 를생성하는것으로나타났다. VIM-2 생성녹농균은 99년국내에처음으로소개되었으며 2003년국내에서분리된 carbapenem 비감수성녹농균중.% 를차지하였다 [20,2]. 2005년의보고에서도.% 에해당하는 carbapenem 비감수성녹농균이 VIM-2 를생성하는것으로나타나국내에는 VIM-2 가흔한것임이밝혀진바있다 [22]. 본연구에서는녹농균의 carbapenem 내성기전에대한연구외에, quinolone 내성을갖게하는염색체상의유전자에변이에대해서도조사하였다. Quinolone은녹농균감염치료에광범위하게사용되어온항균제중하나이다. 그러나사용한지 20년이지나자이항균제에내성인세균이널리퍼지게되었다. 녹

6 36 Korean J Clin Microbiol 20;():3-37 농균이 quinolone 내성을갖게되는중요한기전중하나가 quinolone 의표적인세균의 DNA gyrase 와 DNA topoisomerase Ⅳ의변이이다. Quinolone 결합부위즉 QRDR의아미노산이바뀌면 quinolone과의결합이감소하게되어녹농균이 quinolone에내성을나타내게되는것이다. 본연구에서도 2주중 0주가 gyra에변이를, 그리고 2주가 parc에변이를가지고있는것으로나타났으며이중 9주는 gyra와 parc에모두변이를가지고있었다. 두유전자에변이를가지고있는 9주중한주 (P) 를제외한 주는 ciprofloxacin에고도내성을보였다 (MIC mg/l) (Table ). 한편본연구에서는 gyra의 Thr 3 Ile 변이와 parc의 변이가압도적으로많았는데이변이들은 QRDR에서가장빈번하게나타나는변이들로알려져있다 [23]. Quinolone 내성과관련한연구에서 DNA gyrase 와 DNA topoisomerase Ⅳ의 A subunit인 gyra와 parc의변이는많이연구되고보고되어있는반면 B subunit인 gyrb와 pare의변이에대한보고는드물다. 본연구에서도 gyrb와 pard에서는변이가발견되지않았다. 대전의한대학병원에서분리된 imipenem 내성녹농균은항균제의유출펌프조절유전자및 OprD 단백유전자등에다양한돌연변이를가지고있었다. 또한 quinolone 내성을갖는데중요한역할을하는염색체상의 QRDR 변이를가지고있었다. 이상의결과에서녹농균은다양한염색체상의유전자변이에의해서도 carbapenem과 quinolone 등의항균제에대해내성을나타낼수있음이확인되었다. 그러나본연구에서염색체상의유전자변이나 carbapenemase가확인되지않은균주도상당수포함되어있었으므로이들의내성기전을밝히기위해서는추가적인연구가필요할것이다. 참고문헌. Jacoby GA and Medeiros AA. More extended-spectrum beta-lactamases. Antimicrob Agents Chemother 99;35: Lee K, Park KH, Jeong SH, Lim HS, Shin JH, Yong D, et al. Further increase of vancomycin-resistant Enterococcus faecium, amikacin- and fluoroquinolone-resistant Klebsiella pneumoniae, and imipenem-resistant Acinetobacter spp. in Korea: 2003 KONSAR surveillance. Yonsei Med J 2006;7: Livermore DM. Of Pseudomonas, porins, pumps and carbapenems. J Antimicrob Chemother 200;7: Edalucci E, Spinelli R, Dolzani L, Riccio ML, Dubois V, Tonin EA, et al. Acquisition of different carbapenem resistance mechanisms by an epidemic clonal lineage of Pseudomonas aeruginosa. Clin Microbiol Infect 200;: Pai H, Kim J, Kim J, Lee JH, Choe KW, Gotoh N. Carbapenem resistance mechanisms in Pseudomonas aeruginosa clinical isolates. Antimicrob Agents Chemother 200;5: Köhler T, Michéa-Hamzehpour M, Henze U, Gotoh N, Curty LK, Pechère JC. Characterization of MexE-MexF-OprN, a positively regulated multidrug efflux system of Pseudomonas aeruginosa. Mol Microbiol 997;23: Sawada I, Maseda H, Nakae T, Uchiyama H, Nomura N. A quorum-sensing autoinducer enhances the mexab-oprm effluxpump expression without the MexR-mediated regulation in Pseudomonas aeruginosa. Microbiol Immunol 200;: Quale J, Bratu S, Gupta J, Landman D. Interplay of efflux system, ampc, and oprd expression in carbapenem resistance of Pseudomonas aeruginosa clinical isolates. Antimicrob Agents Chemother 2006;50: Sobel ML, Neshat S, Poole K. Mutations in PA29 (mexs) promote MexT-dependent mexef-oprn expression and multidrug resistance in a clinical strain of Pseudomonas aeruginosa. J Bacteriol 2005;7: Vogne C, Aires JR, Bailly C, Hocquet D, Plésiat P. Role of the multidrug efflux system MexXY in the emergence of moderate resistance to aminoglycosides among Pseudomonas aeruginosa isolates from patients with cystic fibrosis. Antimicrob Agents Chemother 200;: Sung JY, Koo SH, Kwon KC, Park JW, Ko CS, Shin SY, et al. Characterization of class integrons in metallo-beta-lactamaseproducing Pseudomonas aeruginosa. Korean J Clin Microbiol 2009;2: Yoon WS, Lee BY, Bae IK, Kwon SB, Jeong SH, Jeong TJ, et al. Prevalence of imipenem-resistant Pseudomonas aeruginosa isolates and mechanisms of resistance. Korean J Clin Microbiol 2005;: Jalal S and Wretlind B. Mechanisms of quinolone resistance in clinical strains of Pseudomonas aeruginosa. Microb Drug Resist 99;: Rubin J, Walker RD, Blickenstaff K, Bodeis-Jones S, Zhao S. Antimicrobial resistance and genetic characterization of fluoroquinolone resistance of Pseudomonas aeruginosa isolated from canine infections. Vet Microbiol 200;3: Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; sixteenth informational supplement. M00-S0 (M2). Wayne, Pensylvania: CLSI, Shannon KP and French GL. Increasing resistance to antimicrobial agents of Gram-negative organisms isolated at a London teaching hospital, J Antimicrob Chemother 200;53: Chung SY, Sung JY, Kwon KC, Park JW, Ko CS, Shin SY, et al. Characteristics of acquired beta-lactamase gene in clinical isolates of multidrug-resistant Pseudomonas aeruginosa. Korean J Clin Microbiol 200;: Llanes C, Hocquet D, Vogne C, Benali-Baitich D, Neuwirth C, Plésiat P. Clinical strains of Pseudomonas aeruginosa overproducing MexAB-OprM and MexXY efflux pumps simultaneously. Antimicrob Agents Chemother 200;: Ziha-Zarifi I, Llanes C, Köhler T, Pechere JC, Plesiat P. In vivo emergence of multidrug-resistant mutants of Pseudomonas aeruginosa overexpressing the active efflux system MexA-MexB-OprM. Antimicrob Agents Chemother 999;3: Lee K, Chong Y, Shin HB, Yong D. Rapid increase of imipenemhydrolyzing Pseudomonas aeruginosa in a Korean hospital. Abstr E-5, 3th ICAAC, Lee K, Lee WG, Uh Y, Ha GY, Cho J, Chong Y; Korean Nationwide Surveillance of Antimicrobial Resistance Group. VIMand IMP-type metallo-beta-lactamase-producing Pseudomonas spp. and Acinetobacter spp. in Korean hospitals. Emerg Infect Dis 2003;9: Kim IS, Lee NY, Ki CS, Oh WS, Peck KR, Song JH. Increasing prevalence of imipenem-resistant Pseudomonas aeruginosa and molecular typing of metallo-beta-lactamase producers in a Korean

7 Ji Youn Sung, et al. : Chromosomal Mutations in Carbapenem Resistant P. aeruginosa 37 hospital. Microb Drug Resist 2005;: Akasaka T, Tanaka M, Yamaguchi A, Sato K. Type II topoisomerase mutations in fluoroquinolone-resistant clinical strains of Pseudomonas aeruginosa isolated in 99 and 999: role of target enzyme in mechanism of fluoroquinolone resistance. Antimicrob Agents Chemother 200;5: = 국문초록 = oprd, gyra 및 parc 유전자에변이를갖는 Carbapenem 내성녹농균 극동대학교임상병리학과, 2 충남대학교의과대학진단검사의학교실성지연, 조혜현 2, 권계철 2, 구선회 2 배경 : Carbapenem 내성녹농균의확산은이균에의한감염증치료에많은어려움을준다. 본연구에서는녹농균의 carbapenem 내성기전을분석하기위해 OprD 및유출펌프조절유전자 (MexR, NalC, NalD, MexT 및 MexZ) 의염색체상의변이를조사하였다. 아울러 quinolone 내성기전을알아보기위해 QRDR (quinolone resistance-determining region) 변이도함께조사하였다. 방법 : Repetitive extragenic palindromic sequence-based PCR (rep-pcr) 을이용하여서로다른클론에속하는녹농균을선별하였다. 총 2주가서로밴드패턴을보였으며이균주들을대상으로 PCR과 DNA 염기서열분석을통해 β-lactamase 유전자를검출하였고유출펌프조절유전자, oprd 및 QRDR (gyra, gyrb, parc 및 pare) 의변이를확인하였다. 결과 : 분리된 2주의녹농균중한주 (P2) 가 bla VIM-2 를가지고있었으며 2주가 nald 또는 mexz에유출펌프의과량발현을유발할수있는변이를가지고있었다. OprD의소실을유발할수있는염색체상의변이가 2주의녹농균중 주에서확인되었다. Imipenem 및 ciprofloxacin에내성인녹농균 0주중 9주가 gyra와 / 또는 parc에변이를가지고있었다. 결론 : Carbapenem 내성녹농균은유출펌프의과량발현, OprD 단백의소실및 carbapenemase 생성등에의해서 carbapenem 에내성을나타낸다. 녹농균은또한 gyra와 / 또는 parc의 QRDR에변이를일으켜 quinolone에내성을나타낸다. [ 대한임상미생물학회지 20;:3-37] 교신저자 : 구선회, 대전시중구대사동 0 충남대학교병원진단검사의학과 Tel: , Fax: shkoo@cnu.ac.kr

untitled

untitled Korean J Clin Microbiol Vol. 12, No. 1, March, 2009 Characterization of Class 1 Integrons in Metallo-βlactamase-producing Pseudomonas aeruginosa Ji Youn Sung, Sun Hoe Koo, Kye Chul Kwon, Jong Woo Park,

More information

untitled

untitled 210 Ji Youn Sung. PMQR Genes among CTX-M-14 Producing E. coli ORIGINAL ARTICLE Korean J Clin Lab Sci. 2016, 48(3):210-216 http://dx.doi.org/10.15324/kjcls.2016.48.3.210 pissn 1738-3544 eissn 2288-1662

More information

untitled

untitled ORIGINAL ARTICLE Korean J Clin Lab Sci. 2017;49(4):427-434 https://doi.org/10.15324/kjcls.2017.49.4.427 pissn 1738-3544 eissn 2288-1662 Korean J Clin Lab Sci. Vol. 49, No. 4, December 2017 427 Distribution

More information

untitled

untitled ORIGINAL ARTICLE Korean J Clin Lab Sci. Vol. 45, No. 1, Mar. 2013 21 Korean J Clin Lab Sci. 2013, 45(1):21-25 ISSN 1738-3544 Errors of Antibiotic Susceptibility Testing from Automated and Manual Systems

More information

< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770>

< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770> 대한임상검사학회지 : 40권제2호, 75-79, 2008 ISSN 1738-3544 대구지역병원에서분리된 Acinetobacter baumannii와 Pseudomonas aeruginosa의항생제내성현황 대구보건대학임상병리과 1, 세명대학교임상병리학과 2 김수정 1 이재식 2 Antibiotic Resistance Patterns of Acinetobacter

More information

ORIGINAL ARTICLE Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist

ORIGINAL ARTICLE   Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist ORIGINAL ARTICLE http://dx.doi.org/10.15263/jlmqa.2015.37.4.209 Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resistance: MicroScan versus Etest Goeun Kang, Hyun Soo Kim,

More information

296 Korean J Lab Med 2010;30: S. maltophila 감염증치료에는낮은항균제내성률을보이는 trimethoprim/sulfamethoxazole (TMP/SMX) 이일차치료제로사용되고있으며, quinolone, moxalactam,

296 Korean J Lab Med 2010;30: S. maltophila 감염증치료에는낮은항균제내성률을보이는 trimethoprim/sulfamethoxazole (TMP/SMX) 이일차치료제로사용되고있으며, quinolone, moxalactam, Korean J Lab Med 2010;30:295-300 DOI 10.3343/kjlm.2010.30.3.295 Original Article Clinical Microbiology Analysis of Acquired Resistance Genes in Stenotrophomonas maltophilia Jeong Hoon Song, M.D. 1, Ji

More information

untitled

untitled Ann Clin Microbiol Vol., No., September, http://dx.doi.org/./acm... ISSN - Loss of bla and bla IMP- during the Storage of Gram- Bacilli, Antimicrobial Susceptibility of the Gene-Lost Strain, and Location

More information

2 - ceftazidime-clavulanate 디스크를이용하여 ESBL 생성균주를확인하였다. 또한 2009년도에수집된균주인 P. aeruginosa(386주 ), A. baumannii(349주 ) 를대상으로 imipenem에대한감수성을확인하였고 imipenem-h

2 - ceftazidime-clavulanate 디스크를이용하여 ESBL 생성균주를확인하였다. 또한 2009년도에수집된균주인 P. aeruginosa(386주 ), A. baumannii(349주 ) 를대상으로 imipenem에대한감수성을확인하였고 imipenem-h 1 - 국내종합병원을대상으로한항균제내성모니터링 Monitoring of antimicrobial resistance on general hospitals in Korea 질병관리본부국립보건연구원감염병센터약제내성과 연세대학교의과대학진단검사의학교실, 세균내성연구소 Ⅰ. 들어가는말 항균제내성세균의출현과확산으로인하여세균감염증치료는점점어려워지고있다 [1-4]. 항균제내성률은흔히국가간,

More information

untitled

untitled Korean J Clin Microbiol Vol. 11, No. 2, October, 2008 Characteristics of Acquired β-lactamase Gene in Clinical solates of Multidrug-resistant Pseudomonas aeruginosa un Yang Chung 1, Ji Youn ung 2, Kye

More information

KJFP Jeongsook Yoon. bla VIM-2 of Pseudomonas aeruginosa in primary hospitals in Korea Vitek(Biomerieux, Marcy 1 Etoile, France) 으로균을동정하였다. 항균제감수성검사는디

KJFP Jeongsook Yoon. bla VIM-2 of Pseudomonas aeruginosa in primary hospitals in Korea Vitek(Biomerieux, Marcy 1 Etoile, France) 으로균을동정하였다. 항균제감수성검사는디 KJFPpISSN 2233-9019 eissn 2233-9116 Original Article 한국 1 차병원의 Pseudomonas aeruginosa 에서 blavim-2 유전자관찰 윤정숙 서울베스티안병원 bla VIM-2 of Pseudomonas aeruginosa in primary hospitals in Korea Jeong-sook Yoon Director

More information

< BFF8C0FA2D B9E8C7F6C1D62E687770>

< BFF8C0FA2D B9E8C7F6C1D62E687770> 대한내과학회지 : 제 권제 호 다약제내성 Pseudomonas aeruginosa 에대한항생제병합효과 한양대학교의과대학감염내과학교실 배현주 In Vitro Effects of Combined Antibiotics against Multidrug-resistant Pseudomonas aeruginosa HyunJoo Pai, M.D. Infectious Diseases,

More information

untitled

untitled Korean J Clin Microbiol Vol. 13, No. 1, March, 2010 DOI: 10.5145/KJCM.2010.13.1.27 Carbapenem Resistance Mechanisms and Molecular Epidemiology of Acinetobacter spp. from Four Hospitals in Seoul and Gyeonggi

More information

untitled

untitled Ann Clin Microbiol Vol. 16, No. 3, September, 213 http://dx.doi.org/1.5145/acm.213.16.3.126 ISSN 2288-585 Molecular Characteristics of bla OXA-23 -Producing Acinetobacter baumannii Isolated from a University

More information

Kang CI 문제가되고있는주요병원균으로는소위 ESKAPE 균주들 이있는데, 이는 Enterococci, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aerugino

Kang CI 문제가되고있는주요병원균으로는소위 ESKAPE 균주들 이있는데, 이는 Enterococci, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aerugino DOI: 10.5124/jkma.2011.54.3.325 pissn: 1975-8456 eissn: 2093-5951 http://jkma.org Pharmacotherapeutics 다제내성그람음성균감염의치료전략 강철인 * 성균관대학교의과대학삼성서울병원감염내과 Therapeutic strategy for the management of multidrug-resistant

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

12_HM hwp

12_HM hwp The Korean Journal of Microbiology (2010) Vol. 46, No. 3, pp. 303-307 Copyright c 2010, The Microbiological Society of Korea 단보 국내에서분리된 Acinetobacter baumannii 의 Integron 과연관된다제내성분석 김성환 최지혜 박은진 서인원 손승렬

More information

(59-69)Kjcm13.hwp

(59-69)Kjcm13.hwp Korean J Clin Microbiol Vol. 10, No. 1, April, 2007 Antimicrobial Resistance of Clinically Important Bacteria Isolated from 12 Hospitals in Korea in 2005 and 2006 Hyukmin Lee 1, Chang Ki Kim 2, Jongwook

More information

<37375FB1E8C0E7C1DF2DC7F7BED7B9E8BEE7BFA1BCAD20BAD0B8AEB5C820C0D3BBF3C0FB2E687770>

<37375FB1E8C0E7C1DF2DC7F7BED7B9E8BEE7BFA1BCAD20BAD0B8AEB5C820C0D3BBF3C0FB2E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 17, No. 5 pp. 653-659, 2016 http://dx.doi.org/10.5762/kais.2016.17.5.653 ISSN 1975-4701 / eissn 2288-4688 혈액배양에서분리된임상적주요균주의항균제사용량에따른내성률변화

More information

12(2) fm

12(2) fm Journal of Dental Hygiene Science Vol. 12, No. 2, pp. 109~113 (2012) 임상에서분리한 Streptococcus pneumoniae 에서 Levofloxacin 내성유전자의비교연구 최재민 1 박선희 1 윤지아 1 한양금 2 이인수 1 1 한남대학교생명공학과, 2 대전보건대학교치위생 ( 학 ) 과 Comparative

More information

A. baumannii 와 P. aeruginosa 의 ESBL 생성현황 15 인하여광범위 -lactam 제제일부를포함한여러항균제에내재적내성이지만, ceftazidime, piperacillin, ticarcillin 등은이들세균에비교적강한항균력을지닌다 [3]. Cla

A. baumannii 와 P. aeruginosa 의 ESBL 생성현황 15 인하여광범위 -lactam 제제일부를포함한여러항균제에내재적내성이지만, ceftazidime, piperacillin, ticarcillin 등은이들세균에비교적강한항균력을지닌다 [3]. Cla 대한진단검사의학회지제 26 권제 1 호 2006 Korean J Lab Med 2006;26:14-20 원저 임상미생물학 임상검체에서분리된 Acinetobacter baumannii와 Pseudomonas aeruginosa의 Class A Extended-Spectrum -Lactamase 생성현황 오세진 이상욱 황현용 1 배일권 1 조현수 1 이병호 1

More information

Microsoft Word - 15-홍승복.doc

Microsoft Word - 15-홍승복.doc J. Exp. Biomed. Sci. 2012, 18(3): 299~306 pissn : 1738-3226 Original Article Molecular Characterization and Prevalence of 16S Ribosomal RNA Methylase Producing Bacteria in Amikacin Resistant Gram-negative

More information

<5BC0FAC0DABCF6C1A430355D434D30362D313320BEE7BAB4BCB12D E687770>

<5BC0FAC0DABCF6C1A430355D434D30362D313320BEE7BAB4BCB12D E687770> 대한임상검사학회지 : 38 권제 3 호, 173-178, 2006 Multiplex Polymerase Chain Reaction 을이용한 Extended-Spectrum β-lactamase 생성 Klebsiella pneumoniae 균주의검출 진주보건대학임상병리과 양병선 Detection of Extended-Spectrum β-lactamase Producing

More information

Microsoft Word - 05-이영주.doc

Microsoft Word - 05-이영주.doc Journal of Bacteriology and Virology 2006. Vol. 36, No. 2 p.73 78 닭분변유래 Enterococcus spp. 의 Fluoroquinolone 계내성관련 gyra 및 parc Gene 의변이 대구광역시보건환경연구원 1, 경북대학교수의과대학 2, 국립수의과학검역원 3 조재근 1 김기석 2 이영주 2* 박청규 2

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를 Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

untitled

untitled 대한내과학회지 : 제 72 권제 1 호 27 Streptococcus pneumoniae와 Haemophilus influenzae 임상분리주에대한 Cefditoren의시험관내항균력 인제대학교의과대학일산백병원감염내과, 울산대학교의과대학서울아산병원감염내과 2, 울산대학교항균제내성ㆍ미생물유전학연구센터 3 곽이경 추은주 2, 3 박수진 3 이정은 3 정진용 2,

More information

03(12-65)p fm

03(12-65)p fm 한국임상약학회지제 23 권제 1 호 Kor. J. Clin. Pharm., Vol. 23, No. 1. 2013 화상감염소아환자에서분리된주요균종에대한항생제의내성률 강주연 신혜순 * 덕성여자대학교약학대학 (2012 년 12 월 28 일접수 2013 년 3 월 2 일수정 2013 년 3 월 4 일승인 ) Antimicrobial Resistance of Clinically

More information

400 김정민 신경섭 집락을쉽게형성하여장기입원환자나비뇨기계질환이있는노인에서흔히감염을일으킬수있다 [2, 3]. P. rettgeri는 P. stuartii보다 aminoglycoside, cephalosporin 및페니실린계항균제에대한내성률이낮으며, 다제내성인경우도드물다

400 김정민 신경섭 집락을쉽게형성하여장기입원환자나비뇨기계질환이있는노인에서흔히감염을일으킬수있다 [2, 3]. P. rettgeri는 P. stuartii보다 aminoglycoside, cephalosporin 및페니실린계항균제에대한내성률이낮으며, 다제내성인경우도드물다 대한진단검사의학회지 : 제 25 권제 6 호 2005 Korean J Lab Med 2005; 25: 399-405 임상미생물학 요검체에서분리된 Providencia rettgeri 에서 VIM-2형 Metallo- -Lactamase의생성 김정민 신경섭 1 경북대학교의과대학미생물학교실, 충북대학교의과대학진단검사의학교실 1 Production of VIM-2

More information

ƯÇãû

ƯÇãû '' - 1 - - 2 - - 3 - - 4 - - 5 - ' - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - Super-Bio Co., Ltd. KWON, Suk-Tae Thermostable DNA Polymerase-encoding Gene from Thermus sp. X-1 an d Amino Acid Sequence

More information

untitled

untitled 병원감염관리 : 제19권제1호 2014 Korean J Nosocomial Infect Control 2014;19(1):29-36 http://dx.doi.org/10.14192/kjnic.2014.19.1.29 원저 국내중환자실환자에서분리된세균의항균제내성 이양순 1 ㆍ김영아 2 ㆍ송원근 3 ㆍ이혁민 4 ㆍ이혜수 5 ㆍ장숙진 6 ㆍ정석훈 1 ㆍ홍성근 7 용동은

More information

1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus

More information

2101

2101 대한진단검사의학회지제 28 권제 3 호 2008 Korean J Lab Med 2008;28:185-90 DOI 10.3343/kjlm.2008.28.3.185 원저 임상미생물학 Escherichia coli, Klebsiella spp., Proteus mirabilis에서 Phoenix Automated Microbiology System의 Extended-Spectrum

More information

..........5-45..

..........5-45.. K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals

More information

<303220C6AFC1FD303220B0ADC3B6C0CE2E687770>

<303220C6AFC1FD303220B0ADC3B6C0CE2E687770> 대한내과학회지 : 제 88 권제 5 호 2015 http://dx.doi.org/10.3904/kjm.2015.88.5.502 특집 (Special Review) - 다제내성균감염의위협 다제내성그람음성균감염의항생제치료 성균관대학교의과대학삼성서울병원감염내과 강철인 Antimicrobial Therapy for Infections Caused by Multidrug-Resistant

More information

< D34312D303628BEE7BAB4BCB12CC0B0B1D9B5B9292E687770>

< D34312D303628BEE7BAB4BCB12CC0B0B1D9B5B9292E687770> 대한임상검사학회지 : 41권제4호, 153-157, 2009 ISSN 1738-3544 SHV ESBL 생성 Klebsiella pneumoniae 균주의실시간중합효소반응분석 진주보건대학임상병리과 1, 대전보건대학임상병리과 2 양병선 1 육근돌 2 Real-Time PCR Analysis of SHV Extended-Spectrum beta-lactamases

More information

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770> 대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

( )Kju225.hwp

( )Kju225.hwp 비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin

More information

Microsoft PowerPoint - PDFCoTemp.PPT

Microsoft PowerPoint - PDFCoTemp.PPT 주요유방염세균의검출및 항생제감수성검사 임숙경 1. 검사시료 1. 시료채취 유방염우유 2. 체세포수측정 3. 대상세균 - Staphylococcus aureus - Coagulase negative staphylococci -Escherichia coli 3. 균분리방법 E. coli CHEC Agar 직접도말 (37 18-24h) 보라색집락 EMB Agar

More information

untitled

untitled Korean J Clin Microbiol Vol. 5, No., March, http://dx.doi.org/.545/kjcm..5.. Carbapenem-Resistant Acinetobacter baumannii Il Kwon Bae, Seok Hoon Jeong, Kyungwon Lee Department of Laboratory Medicine and

More information

February 2007

February 2007 November 2009 Vol. 17 No. 4 Ser. No. 67 Quarterly ISSN 1226-1734 www.whonetkorea.org Antimicrobial resistance of bacteria isolated during July to September in 2009 at a KONSAR program participating hospital

More information

untitled

untitled ORIGINAL ARTICLE Korean J Clin Lab Sci. 2016, 48(3):217-224 http://dx.doi.org/10.15324/kjcls.2016.48.3.217 pissn 1738-3544 eissn 2288-1662 Korean J Clin Lab Sci. Vol. 48, No. 3, September 2016 217 An Analysis

More information

1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.

More information

KJFP Jeongsook Yoon. Bacterial Strains and Antimicrobial Resistance in Burn Patients 심부화상인경우 Clostridium, Bacteroides 등을감별하기위해무산소성배양을시행해야한다고권장하고있다. 6)

KJFP Jeongsook Yoon. Bacterial Strains and Antimicrobial Resistance in Burn Patients 심부화상인경우 Clostridium, Bacteroides 등을감별하기위해무산소성배양을시행해야한다고권장하고있다. 6) KJFP Original Article http://dx.doi.org/10.21215/kjfp.2016.6.3.179 pissn 2233-9019 eissn 2233-9116 화상창 감염의 균종 및 항균제 감수성률 윤정숙* 서울베스티안병원 진단검사의학과 Bacterial Strains and Antimicrobial Resistance of Wound Infection

More information

대한진단검사의학회지제 26 권제 6 호 2006 Korean J Lab Med 2006;26:412-7 원저 임상미생물학 vana 유전자를지닌 Vancomycin 내성장구균의 VanB 표현형발현기전 박일중 1 이위교 2 이혁민 3 용동은 4 이경원 4 김의종 5 정석훈

대한진단검사의학회지제 26 권제 6 호 2006 Korean J Lab Med 2006;26:412-7 원저 임상미생물학 vana 유전자를지닌 Vancomycin 내성장구균의 VanB 표현형발현기전 박일중 1 이위교 2 이혁민 3 용동은 4 이경원 4 김의종 5 정석훈 대한진단검사의학회지제 26 권제 6 호 2006 Korean J Lab Med 2006;26:412-7 원저 임상미생물학 vana 유전자를지닌 Vancomycin 내성장구균의 VanB 표현형발현기전 박일중 1 이위교 2 이혁민 3 용동은 4 이경원 4 김의종 5 정석훈 6 박연준 7 최태열 8 어영 9 신종희 10 이종욱 11 안지영 12 이성희 13 우건조

More information

Trd022.hwp

Trd022.hwp 김신태, 이선녕, 이석정, 정필문, 박홍준, 신명상, 김종환, 이부길, 김상하, 리원연, 신계철, 용석중 Shin-Tae Kim, M.D., Shun Nyung Lee, M.D., Seok Jeong Lee, M.D., Pil Moon Jung, M.D., Hong Jun Park, M.D., Myung Sang Shin, M.D., Chong Whan Kim,

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

untitled

untitled 대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran

More information

Çмúº¸°í6ÇÏÇý¹Î

Çмúº¸°í6ÇÏÇý¹Î 병원약사회지 (27), 제 34 권제 4 호 J. Kor. Soc. Health-syst. Pharm., Vol. 34, No. 4, 433 ~ 442 (27) Original Article 국내지역사회획득폐렴원인균의경험적항균제에대한내성현황 하혜민 a, 김윤숙 b, 안정미 c, 천부순 a, 인제대학교약학대학 a, 인제대학교해운대백병원약제부 b, 인제대학교상계백병원약제부

More information

04_이근원_21~27.hwp

04_이근원_21~27.hwp 1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일

More information

Çмúº¸°í5¿À´ÙÇö

Çмúº¸°í5¿À´ÙÇö 병원약사회지 (28), 제 35 권제 호 J. Kor. Soc. Health-syst. Pharm., Vol. 35, No., 48 ~ 58 (28) Original Article 국내병원획득폐렴원인균의경험적항균제에대한내성현황 오다현 a, 김윤숙 a, 천부순 b, 인제대학교해운대백병원약제부 a, 인제대학교약학대학 b The Status of Resistance

More information

(

( 317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,

More information

22 신경섭 손보라 oxyimino-cephalosporin은물론 monobactam계항생제도분해하는효소이다 [1-3]. 장내세균에서 ESBL 생성균주의증가에대한여러보고가있는데 [4-6], Escherichia coli와 Klebsiella pneumoniae는임상에서

22 신경섭 손보라 oxyimino-cephalosporin은물론 monobactam계항생제도분해하는효소이다 [1-3]. 장내세균에서 ESBL 생성균주의증가에대한여러보고가있는데 [4-6], Escherichia coli와 Klebsiella pneumoniae는임상에서 대한임상병리학회지 : 제 22 권제 1 호 2002 Korean J Clin Pathol 2002; 22: 21-6 임상미생물학 Escherichia coli와 Klebsiella Species에서 Extended-Spectrum -Lactamase 검출을위한 Vitek ESBL Test와그외방법의비교 신경섭 손보라 충북대학교의과대학임상병리학교실 Comparison

More information

Table 2. Antimicrobial susceptibility (%) of P. aeruginosa a Antimicrobial agents Resistant Intermediate Susceptible Piperacillin 45/27 b 0/0 55/73 Pi

Table 2. Antimicrobial susceptibility (%) of P. aeruginosa a Antimicrobial agents Resistant Intermediate Susceptible Piperacillin 45/27 b 0/0 55/73 Pi May 2012 Vol. 20, No. 2 Ser. No. 77, Quarterly ISSN1226-1734 www.whonetkorea.org Antimicrobial resistance of clinical isolates of bacteria during January to March, 2012 Antimicrobial resistance rates determined

More information

주간건강과질병 제 12 권제 16 호 연구단신, Brief report 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : s

주간건강과질병 제 12 권제 16 호 연구단신, Brief report 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : s 연구단신, Brief report 2 2013 2017 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : sea2sky@korea.kr, 043-719-7580 Results of healthcare-associated infection

More information

<303120C6AFC1FD20B9E8C7F6C1D62E687770>

<303120C6AFC1FD20B9E8C7F6C1D62E687770> 대한내과학회지: 제 81 권 제 6 호 2011 특 집(Special Review) - 흔한 감염질환에서의 항생제 내성 및 최신 치료 지역사회 단순 요로감염에서의 항생제 내성 및 최신 치료 한양대학교병원 감염내과 배 현 주 Treatment of Community-Acquired Uncomplicated Urinary Tract Infection Hyunjoo

More information

untitled

untitled ORIGINAL ARTICLE Korean J Clin Lab Sci. 017;9():13-19 https://doi.org/10.153/kjcls.017.9..13 pissn 173-35 eissn -6 Korean J Clin Lab Sci. Vol. 9, No., December 017 13 The Characteristics of Imipenem-Resistant

More information

Drug-Resistant Bacteria: Tertiary Hospitals versus Smaller Medical Institutions resistant Pseudomonas aeruginosa (CRPA), carbapenem resistant Acinetob

Drug-Resistant Bacteria: Tertiary Hospitals versus Smaller Medical Institutions resistant Pseudomonas aeruginosa (CRPA), carbapenem resistant Acinetob Original Article Ewha Med J 2013;36(2):126-131 http://dx.doi.org/10.12771/emj.2013.36.2.126 pissn 2234-3180 eissn 2234-2591 전원온환자의의료기관별호흡기검체에서의균종류비교 김태형, 조경표, 이재성, 우용문, 성지석, 노창석 1 서울적십자병원내과, 1 서울특별시서남병원호흡기내과

More information

<30322EC6AFC1FD30312DBCDBC0E7C8C62E687770>

<30322EC6AFC1FD30312DBCDBC0E7C8C62E687770> 대한내과학회지 : 제 77 권제 2 호 2009 특집 (Special Review) - 신종감염병의최신지견 항생제내성의국내현황및대책 성균관대학교의과대학삼성서울병원감염내과, 아시아태평양감염연구재단 송재훈 Current status and future strategies of antimicrobial resistance in Korea Jae-Hoon Song,

More information

- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -

More information

untitled

untitled Korean J Clin Lab Sci. 2019;51(3):301-308 https://doi.org/10.15324/kjcls.2019.51.3.301 Korean Society for Clinical Laboratory Science ORIGINAL ARTICLE Molecular Detection of Virulence Factors in Carbapenem-Resistant

More information

제 1 장연구개발과제의개요 1 (2002 2003) 2 (2003 2004) 3 (2004 2005) 제 2 장국내외기술개발현황 제 3 장종보존을위한동결및해동조건의최적화 μ μ μ μ Survival rate (%) 100 80 60 40 20 0 50%S.W.+DMSO 100%S.W.+DMSO 0 5 10 15 DMSO concentration

More information

untitled

untitled Ann Clin Microbiol Vol. 19, No. 2, June, 2016 http://dx.doi.org/10.5145/acm.2016.19.2.48 pissn 2288-0585 eissn 2288-6850 Distribution and Antimicrobial Resistance of Streptococcus pneumoniae at Four University

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing

More information

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF. 1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -

More information

005송영일

005송영일 Received : 2015. 12. 09 Reviewed : 2015. 12. 16 Accepted : 2015. 12. 16 Sternal Fracture occurred after Thai Massage : A Case Report Young-Il Song, K.M.D. 1, Dong-Eun Kim, K.M.D. 1 1 Department of Rehabilitation

More information

00º½Çмú-¾Õ

00º½Çмú-¾Õ 547-8( 307 ) TEL (02)458-3078, 3079 / FAX (02)458-3047, 3077 NICE , (),, ( 1) NICE 1. Biochemical Engineering in 21st Century in the era of Life Science and Technology 09:00 ~ 09:15 Opening Remarks: President

More information

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

09구자용(489~500)

09구자용(489~500) The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal

More information

( )Kju269.hwp

( )Kju269.hwp 만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University

More information

untitled

untitled Ann Clin Microbiol Vol. 7, No., June, http://dx.doi.org/5/acm..7..5 pissn -55 eissn -65 Characterization of Salmonella spp. Clinical Isolates in Gyeongsangbuk-do Province, to 3 Oh-Geun Kweon, Jin Seok

More information

untitled

untitled J Korean Soc Transplant 2013;27:81-86 http://dx.doi.org/10.4285/jkstn.2013.27.3.81 Review Article 다제내성세균의시대에세균성감염질환에대한항생제치료의최근발전들 성균관대학교의과대학삼성서울병원감염내과 강철인 What s New in the Management of Bacterial Infections

More information

A Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran

More information

Microsoft Word - 3-김정민.doc

Microsoft Word - 3-김정민.doc Journal of Bacteriology and Virology 2006. Vol. 36, No. 1 p.21 30 다약제내성 Acinetobacter 균의유전종결정및항균제내성의특성규명 경북대학교의과대학미생물학교실, 단국대학교의과대학미생물학교실 1 임유미 최태생 1 김정민 * Determination of Genomospecies and Characterization

More information

Jkbcs016(92-97).hwp

Jkbcs016(92-97).hwp Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean

More information

Crt114( ).hwp

Crt114( ).hwp cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1

More information

433대지05박창용

433대지05박창용 Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This

More information

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling

More information

Microsoft Word - 27-김윤태.doc

Microsoft Word - 27-김윤태.doc J. Exp. Biomed. Sci. 10 (2004) 507 514 TopoisomeraseII and Topoisomerase IV Gene Mutations Fluoroquinolone Resistance of Pseudomonas aeruginosa Yuntae Kim and Heongseok Baik 1 Department of Laboratory

More information

1..

1.. Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :

More information

보도자료 년 5 월 16 일 ( 목 ) 조간부터보도하여주시기바랍니다. 문의 : 에너지환경표준과최철우과장, 류지영연구사 ( ) 화장품에도국제표준이...? - 화장품도이젠표준선점으로세계시장선도를 - [ 붙임 1

보도자료 년 5 월 16 일 ( 목 ) 조간부터보도하여주시기바랍니다. 문의 : 에너지환경표준과최철우과장, 류지영연구사 ( ) 화장품에도국제표준이...? - 화장품도이젠표준선점으로세계시장선도를 - [ 붙임 1 보도자료 http://www.motie.go.kr 2013 년 5 월 16 일 ( 목 ) 조간부터보도하여주시기바랍니다. 문의 : 에너지환경표준과최철우과장, 류지영연구사 (509-7272) 화장품에도국제표준이...? - 화장품도이젠표준선점으로세계시장선도를 - [ 붙임 1 참조 ] [ 붙임 2 참조 ] [ 붙임 3, 4 참조 ] 이보도자료와관련하여보다자세한내용이나취재를원하시면산업통상자원부기술표준원에너지환경표준과류지영연구사

More information

2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285

2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285 13 2 ( 25 ) 2004 12 Korean J Med Hist 13 284 296 Dec 2004 ISSN 1225 505X 1) * ** ** 1 1920 1930 40 ( 1896-1973) 80 * ** 1) 2003 284 2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914

More information

A 617

A 617 Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R

More information

±èÇ¥³â

±èÇ¥³â 533 Fig. 1. Dead zone. Nine echoes are positioned 2-10 mm below the scan surface with 1 mm distance. All nine echoes are clearly visualized. 534 Fig. 2. Vertical and horizontal measurement. 10 cm distance

More information

Table 2. Antimicrobial susceptibility (%) of P. aeruginosa a Antimicrobial agents Resistant Intermediate Susceptible Piperacillin 44/25 b 12/11 44/64

Table 2. Antimicrobial susceptibility (%) of P. aeruginosa a Antimicrobial agents Resistant Intermediate Susceptible Piperacillin 44/25 b 12/11 44/64 Nov 2012 Vol. 20, No. 4 Ser. No. 79, Quarterly ISSN1226-1734 www.whonetkorea.org Antimicrobial resistance of clinical isolates of bacteria during July to September, 2012 Antimicrobial resistance rates

More information

February 2007

February 2007 Aug 2011 Vol. 19 No. 3 Ser. No. 74 Quarterly ISSN 1226-1734 www.whonetkorea.org Antimicrobial resistance of bacteria isolated during April to June in 2011 at a KONSAR program participating hospital Antimicrobial

More information

142 Hanyang Medical Reviews Vol. 31, No. 3, 2011 본론 국내에서이들여섯가지주요다제내성균중 MRSA는 1990년대이미현재수준까지증가하였고, VRSA는증례보 Proportion among nosocomial infections 25 2

142 Hanyang Medical Reviews Vol. 31, No. 3, 2011 본론 국내에서이들여섯가지주요다제내성균중 MRSA는 1990년대이미현재수준까지증가하였고, VRSA는증례보 Proportion among nosocomial infections 25 2 Hanyang Medical Reviews Vol. 31 No. 3, 2011 141 다제내성균과의료관련감염 Multidrug-resistant Organisms and Healthcare-associated Infections 김미나울산대학교의과대학서울아산병원진단검사의학과 Mi-Na Kim. M.D., Ph.D. Department of Laboratory

More information

Microsoft PowerPoint - 4.조지현 [호환 모드]

Microsoft PowerPoint - 4.조지현 [호환 모드] 감염관리를위한진단검사 다제내성균감시검사 (MULTIDRUG RESISTANT ORGANISMS) 조지현원광의대진단검사의학과 다제내성균감시검사 1. MDRO 정의 (multidrug resistant organisms) 2. MDRO 중요성과국내 MDRO 현황 3. MDRO 검사 (screen, confirm) 1) MRSA, VRSA/VISA, CNS 2)

More information

6 JH Byun, et al. IRS-PCR on E. coli 성을나타낸다. CTX-M ESBL 유전자는 mobile genetic element 와연관되어지역사회에서 ESBL 이쉽게전파할수있다 [5, 6]. 병원균의역학적분석을하기위

6 JH Byun, et al. IRS-PCR on E. coli   성을나타낸다. CTX-M ESBL 유전자는 mobile genetic element 와연관되어지역사회에서 ESBL 이쉽게전파할수있다 [5, 6]. 병원균의역학적분석을하기위 Original Article http://dx.doi.org/10.3947/ic.2012.44.1.5 Infect Chemother 2012;44(1):5-10 pissn 2093-2340 eissn 2092-6448 Infection & Chemotherapy Infrequent-Restriction-Site 중합효소연쇄반응 (ISR-PCR) 을사용한지역사회발생

More information

γ

γ 경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical

More information

α α α α α

α α α α α α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4) THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method

More information

84 계명의대학술지제 31 권 1 호 2012 μg /ml). Isolation frequency of MDRAB strains was 97.7% (172 strains) and was highly prevalent. Fifty eight (33.0%) strains

84 계명의대학술지제 31 권 1 호 2012 μg /ml). Isolation frequency of MDRAB strains was 97.7% (172 strains) and was highly prevalent. Fifty eight (33.0%) strains 계명의대학술지제 31 권 1 호 Keimyung Med J Vol. 31, No. 1, June, 2012 다약제내성 Acinetobacter baumannii 의 유병율과항균제감수성 계명대학교의과대학미생물학교실, 의과학연구소 서성일 백원기 서민호 High Prevalence and Antimicrobial Drug Susceptibility of Multidrug

More information

< BFEBBFAAB0E1B0FABAB8B0EDBCAD2DBCF6C1A42028BCADBFEFB4EB292E687770>

< BFEBBFAAB0E1B0FABAB8B0EDBCAD2DBCF6C1A42028BCADBFEFB4EB292E687770> 제출문 질병관리본부장 귀하 이보고서를 균혈증과요로감염원인균의내성실태및내성기전연구 ( 서울대학교의과대 학 / 김의종 ) 과제의연구결과보고서로제출합니다. 2006. 1. 25 주관연구기관명 : 서울대학교의과대학 주관연구책임자 : 김의종 제 1세부과제명 : 균혈증및요로감염을일으키는주요원인균의내성실태 ( 제1세부연구기관 / 세부과제책임자 ): 서울대학교의과대학 /

More information

<5BC0FAC0DABCF6C1A430345D434D30362D313220C8ABBDC2BAB92D E687770>

<5BC0FAC0DABCF6C1A430345D434D30362D313220C8ABBDC2BAB92D E687770> 대한임상검사학회지 : 38 권제 3 호, 166-172, 2006 Metallo-β-lactamase 생성 Pseudomonas aeruginosa의시험관내항균제병합요법에대한연구 분당제생병원진단검사의학과 홍승복 In vitro Antimicrobial Combination Therapy in Metallo-β-lactamase Producing Pseudomonas

More information

歯1.PDF

歯1.PDF 200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)

More information