untitled

Transcription

1 Korean J Clin Lab Sci. 2019;51(3): Korean Society for Clinical Laboratory Science ORIGINAL ARTICLE Molecular Detection of Virulence Factors in Carbapenem-Resistant Pseudomonas aeruginosa Isolated from a Tertiary Hospital in Daejeon Hye Hyun Cho Department of Biomedical Laboratory Science, Daejeon Institute of Science and Technology, Daejeon, Korea 대전지역의 3 차병원에서분리된 Carbapenem 내성 Pseudomonas aeruginosa 의병독성인자검출 조혜현 대전과학기술대학교임상병리과 ARTICLE INFO Received August 15, 2019 Revised 1 st August 23, 2019 Revised 2 nd August 27, 2019 Accepted August 27, 2019 Key words ExoU gene Multidrug-resistant Virulence factor ABSTRACT The emergence and spread of multidrug resistant (MDR) Pseudomonas aeruginosa is a critical problem worldwide. The pathogenesis of P. aeruginosa is due partly to the production of several cell-associated and extracellular virulence factors. This study examined the distribution of virulence factors and antimicrobial resistance patterns of carbapenem-resistant P. aeruginosa (CRPA) isolated from a tertiary hospital in Daejeon, Korea. Antimicrobial susceptibility testing was performed using the disk diffusion method, and PCR and DNA sequencing were performed to determine for the presence of virulence genes. In addition, the sequence type (ST) of MDR P. aeruginosa was investigated by multilocus sequence typing (MLST). Among 32 CRPA isolates, 14 (43.8%) were MDR and the major ST was ST235 (10 isolates, 71.4%). All isolates were positive for the presence of virulence genes and the most prevalent virulence genes were toxa, plcn, and phzm (100%). All isolates carried at least eight or more different virulence genes and nine (28.1%) isolates had 15 virulence genes. The presence of the exou gene was detected in 71.4% of the MDR P. aeruginosa isolates. These results indicate that the presence of the exou gene can be a predictive marker for the persistence of MDR P. aeruginosa isolates. Copyright 2019 The Korean Society for Clinical Laboratory Science. All rights reserved. 서론 Pseudomonas aeruginosa는만성감염과심각한급성감염을일으키는광범위한기회감염균이다. 또한 P. aeruginosa는폐렴, 창상감염, 심각한화상, 욕창, 면역력이저하된환자의다양한전신감염을일으키는원내감염균의 10 15% 를차지하고 * Corresponding author: Hye Hyun Cho Department of Biomedical Laboratory Science, Daejeon Institute of Science and Technology, 100 Hyechon-ro, Seo-gu, Daejeon 35408, Korea airplane1102@hanmail.net * ORCID: 있다. 최근원내감염에의한사망율이 18 61% 로보고되고있으며, 특히다제내성 P. aeruginosa에의한원내감염은전세계적으로증가하고있는실정이다 [1-3]. 최근 P. aeruginosa에의한발병기전중하나로, 세포관련및세포외병독성인자의생성은광범위조직손상, 혈류침입및확산을일으키는것으로보고되고있다 [4, 5]. 세포관련병독성인자로는 flagella, lipopolysaccharide, pili (pila, pilb), type III system effector proteins, type III secretion system (exos, exot, exou, exoy) 과 alginate 가있으며, 세포외병독성인자로는 exotoxin A (toxa), phospholipases (plch, plcn), pissn eissn This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

2 302 Hye Hyun Cho. Virulence Factors of Carbapenem-Resistant Pseudomonas aeruginosa phenazine (phzi, phzii, phzh, phzm, phzs), elastase (lasa), zinc metalloprotease (lasb), alkaline protease (apra), pyoverdin (pvda) 이있다 [6-9]. 이러한세포관련및세포외병독성인자에의한침입성 P. aeruginosa 감염은 carbapenem 과같은항균제의사용에도불구하고높은사망률을나타내고있다. 최근 carbapenem 에대한높은내성이발달함에따라다제내성 P. aeruginosa의출현은전세계적으로심각한문제로대두되고있으며일본, 대만, 인도, 이란등아시아지역국가에서항균제의선택과사용의제한으로인해치료에많은어려움이보고되고있다 [10-13]. 특히, 우리나라의경우 carbapenem 에대한내성이지속적으로증가하고있으며, 대부분의 carbapenem 내성 P. aeruginosa가다제내성으로보고되어큰우려를낳고있다 [14]. 현재우리나라에서는다제내성 P. aeruginosa에대한많은연구가보고되고있으나, 세포관련및세포외병독성인자와관련된연구는매우미비한실정이다. 이에본연구에서는대전지역의 3차병원에서분리된 carbapenem 내성 P. aeruginosa를대상으로주요세포관련및세포외병독성인자의분포를확인하고, 항균제내성과의관계에대해조사하고자한다. 재료및방법 1. 균주의수집과동정본연구는 2011년 3월부터 2012년 12월까지대전지역의 3 차병원에의뢰된객담 (21), 소변 (5), 창상 (3), 농 (1), 담즙 (1), 혈액 (1) 로부터분리된 carbapenem 내성 P. aeruginosa 32균주를대상으로하였다. 이중동일환자에서반복분리된균주는수집대상에서제외하였다. 임상검체로부터분리배양된균주는 Vitek II automated ID system (BioMerieux, Hazelwood, MO, USA) 을이용하여동정하였고, carbapenem 내성 P. aeruginosa 는 imipenem 과 meropenem 에내성인균주로선별하였다. 2. 항균제감수성검사 Clinical and Laboratory Standards Institute (CLSI) 지침에따라, amikacin, gentamicin, imipenem, meropenem 및 ciprofloxacin, levofloxacin, ceftazidime, cefepime (BBL, Cockeysville, MI, USA) 에대한감수성검사는 Mueller-Hinton 한천배지 (Difco, Cockeysville, MD, USA) 를사용하여디스크확산법으로확인하였다 [15]. 정도관리를위해 Escherichia coli ATCC 25922와 Pseudomonas aeruginosa ATCC 27853을동시에시험하여허용범위내에있는지확인하였다. Magiorakos 등 [16] 의연구를참고하여, aminoglycosides, carbapenems 및 fluoroquinolones 계열에내성을보인균주를다제내성 P. aeruginosa로하였다. 3. 다제내성 P. aeruginosa의 multilocus sequencing typing (MLST) 분석항균제감수성시험결과, 다제내성 P. aeruginosa로확인된균주는 brain heart infusion broth (Difco) 에접종하여 37 C 에서 24시간배양한후, Genomic DNA Prep kit (Solgent, Daejeon, Korea) 을사용하여 DNA를추출하였다. DNA 추출액 (5 L), 10 Taq buffer (2.5 L), 10 mm dntp mix (0.5 L), primer 각 10 pmol, 0.7 U Taq DNA polymerase (Solgent) 및증류수를혼합하여총부피 25 L의반응용액을만들었다. 7개의 housekeeping gene (acsa, aroe, guaa, mutl, nuod, ppsa, trpe) 은 Gene Amp PCR System 9600 (Perkin-Elmer, Norwalk, CT, USA) 을사용하여 96 C에서 1 분간반응시킨후, 96 C에서 1분, 55 C에서 1분, 72 C에서 1분으로 30회증폭반응시키고, 72 C에서 10분간연장반응시켰다. 각각의 PCR 반응산물은 ethidium bromide가포함된 1% agarose gel에서 30분간전기영동하여밴드를확인하였다. 증폭산물은 PCR purification kit (Solgent) 로분리한후, BigDye Terminator cycle sequencing kit (PE Applied Biosystems, Foster City, CA, USA) 와 ABI PRISM 3730xl DNA analyzer (PE Applied Biosystems) 를이용하여염기서열을분석하였다. MLST는 P. aeruginosa MLST database website ( pubmlst.org/ paeruginosa/) 에설명된방법에따라분석하였다. 7개의 housekeeping gene에대한각각의염기서열분석결과는 MLST database 에입력하여 allelic number와 sequence type (ST) 를확인하였다. 4. 세포관련및세포외병독성인자의검출 P. aeruginosa의주요병독성인자인 toxa, exos, exot, exou, exoy, plch, plcn, phzi, phzii, phzh, phzm, phzs, lasa, lasb, pila, pilb, apra, pvda 유전자를검출하기위해이전연구에서사용된 primer (Table 1) 를이용하여 PCR을진행하였다 [7, 17]. 먼저, toxa, exos, plch, plcn, lasb 유전자를확인하기위해, MLST 분석에서와동일한방법으로 DNA 추출액 (5 L), 10 Taq buffer (2.5 L), 10 mm dntp mix (0.5 L), primer 각 10 pmol, 0.7 U Taq DNA polymerase (Solgent) 및증류수를혼합하여총부피 25 L의반응용액을만들었다. PCR 과정은 94 C에서 3분간반응시킨후, 94 C에

3 Korean J Clin Lab Sci. Vol. 51, No. 3, September Table 1. Oligonucleotides primers used for virulence genes amplification Gene Sequence (5-3 ) Size of product (bp) References toxa F: CTGCGCGGGTCTATGTGCC R: GATGCTGGACGGGTCGAG exos F: CGTCGTGTTCAAGCAGATGGTGCTG R: CCGAACCGCTTCACCAGGC exot F: CAATCATCTCAGCAGAACCC R: TGTCGTAGAGGATCTCCTG exou F: GATTCCATCACAGGCTCG R: CTAGCAATGGCACTAATCG exoy F: TATCGACGGTCATCGTCAGGT R: TTGATGCACTCGACCAGCAAG plch F: GCACGTGGTCATCCTGATGC R: TCCGTAGGCGTCGACGTAC plcn F: TCCGTTATCGCAACCAGCCCTACG R: TCGCTGTCGAGCAGGTCGAAC phzi F: CATCAGCTTAGCAATCCC R: CGGAGAAACTTTTCCCTC phzii F: GCCAAGGTTTGTTGTCGG R: CGCATTGACGATATGGAAC phzh F: GGGTTGGGTGGATTACAC R: CTCACCTGGGTGTTGAAG phzm F: ATGGAGAGCGGGATCGACAG R: ATGCGGGTTTCCATCGGCAG phzs F: TCGCCATGACCGATACGCTC R: ACAACCTGAGCCAGCCTTCC lasa F: GCAGCACAAAAGATCCC R: GAAATGCAGGTGCGGTC lasb F: GGAATGAACGAAGCGTTCTCCGAC R: TGGCGTCGACGAACACCTCG pila F: ACAGCATCCAACTGAGCG R: TTGACTTCCTCCAGGCTG pilb F: TCGAACTGATGATCGTGG R: CTTTCGGAGTGAACATCG apra F: TGTCCAGCAATTCTCTTGC R: CGTTTTCCACGGTGACC pvda F: GACTCAGGCAACTGCAAC R: TTCAGGTGCTGGTACAGG 서 30초, 55 C에서 1분, 72 C에서 1분 30초로 30회증폭반응시키고, 72 C에서 5분간연장반응시켰다. 또한, exot, exou, exoy, phzi, phzii, phzh, phzm, phzs, lasa, pila, pilb, apra, pvda 유전자검출을위해 Finnan 등 [17] 의연구에서사용된 primer와반응조건을참고하여진행하였다. PCR 반응산물은 ethidium bromide가포함된 1% agarose gel에서 30분간전기영동하여밴드를확인하였다. 증폭산물은 PCR purification kit (Solgent) 로분리한후, BigDye Terminator cycle sequencing kit (PE Applied Biosystems, Foster City, CA, USA) 와 ABI PRISM 3730xl DNA analyzer (PE Applied Biosystems) 를이용하여염기서열을분석하였다. 5. 통계분석 Microsoft Excel 2010 (Microsoft Inc., Redmond, WA, USA) 를이용한 chi-square test를통해 P<0.05 인경우를유의한것으로판정하였다. 결과 1. 항균제감수성양상과다제내성균의 MLST 분석총 32균주의 carbapenem 내성 P. aeruginosa를대상으로항균제감수성검사를실시한결과, amikacin 에 14균주 (43.8%), gentamicin에 16균주 (50.0%), ciprofloxacin에 22 균주 (68.8%) levofloxacin에 22균주 (68.8%), ceftazidime에 13균주 (40.6%), cefepime에 16균주가내성을보였으며, imipenem과 meropenem에 32균주 (100%) 모두내성을보였다 (Table 2). 이중 14균주는다제내성임을확인하였고, ST235가 10균주 (71.4%), ST245가 2균주 (14.3%), ST589, ST654가각각 1균주 (7.1%) 를나타내었다. 또한, 다제내성균 (14균주) 와다제내성이아닌균 (18균주) 에대한세포관련및세포외병독성인자의분포차이를확인하였다 (Table 3). 15개의세포관련및 Table 2. Antimicrobial susceptibility of 32 CRPA isolates Antimicrobial agent No. of isolates (%) Resistant Susceptible Intermediate Amikacin 14 (43.8%) 17 (53.1%) 1 (3.1%) Gentamicin 16 (50.0%) 16 (50.0%) 0 (0.0%) Imipenem 32 (100.0%) 0 (0.0%) 0 (0.0%) Meropenem 32 (100.0%) 0 (0.0%) 0 (0.0%) Ciprofloxacin 22 (68.8%) 10 (31.3%) 0 (0.0%) Levofloxacin 22 (68.8%) 8 (25.0%) 2 (6.3%) Ceftazidime 13 (40.6%) 13 (40.6%) 6 (18.8%) Cefepime 16 (50.0%) 12 (37.5%) 4 (12.5%)

4 304 Hye Hyun Cho. Virulence Factors of Carbapenem-Resistant Pseudomonas aeruginosa Table 3. Prevalence of virulence genes between MDR and non-mdr P. aeruginosa isolates Genes No. of isolates (%) Total (N=32) MDR (N=14) non-mdr (N=18) toxa 32 (100.0%) 14 (100.0%) 18 (100.0%) exos 20 (62.5%) 4 (28.6%) 16 (88.9%) exot 31 (96.9%) 13 (92.9%) 18 (100.0%) exou 12 (37.5%) 10 (71.4%) 2 (11.1%) exoy 27 (84.4%) 10 (71.4%) 17 (94.4%) plch 27 (84.4%) 10 (71.4%) 17 (94.4%) plcn 32 (100.0%) 14 (100.0%) 18 (100.0%) phzi 31 (96.9%) 13 (92.9%) 18 (100.0%) phzii 27 (84.4%) 10 (71.4%) 17 (94.4%) phzh 30 (93.8%) 12 (85.7%) 18 (100.0%) phzm 32 (100.0%) 14 (100.0%) 18 (100.0%) phzs 31 (96.9%) 14 (100.0%) 17 (94.4%) lasa 27 (84.4%) 9 (64.3%) 18 (100.0%) lasb 31 (96.9%) 14 (100.0%) 17 (94.4%) pila 8 (25.0%) 3 (21.4%) 5 (27.8%) pilb 0 (0.0%) 0 (0.0%) 0 (0.0%) apra 30 (93.8%) 12 (85.7%) 18 (100.0%) pvda 16 (50.0%) 3 (21.4%) 13 (72.2%) Abbreviation: MDR, multidrug resistant. 세포외병독성인자의유전자의경우, 다제내성균과다제내성이아닌균에서큰차이를보이지않았으나, exos, exou, pvda 유전자의경우, 유의한차이를보였다 (P<0.001, P<0.001, P=0.004). 특히, exou 유전자의경우, 다제내성균에서 71.4% (10/14) 의높은비율을보인반면, 다제내성이아닌균에서는 11.1% (2/18) 의낮은비율로확인되었으며, exos 유전자의경우, 다제내성균에서 28.6% (4/14) 의낮은비율을보였으나, 다제내성이아닌균에서는 88.9% (16/18) 의높은비율이확인되었다 (Table 4). 2. 세포관련및세포외병독성인자의확인 18개의세포관련및세포외병독성인자의유전자확인을위해 PCR과염기서열을분석한결과, 총 32균주의 carbapenem 내성 P. aeruginosa 중 32균주 (100.0%) 모두에서확인되었다 (Table 3). 18개의세포관련및세포외병독성인자유전자중 toxa, plcn, phzm 유전자 (100%, 32/32) 가가장높은비율로확인되었으며, exot, phzi, phzs, lasb 유전자가각각 96.9% (31/32), phzh, apra 유전자가각각 93.8% (30/32) 의높은비율로확인되었다. 반면, pilb 유전자는 32균주모두에서확인되지않았으며, exou와 pila 유전자는각각 37.5% (12/32) 와 25.0% (8/32) 로비교적낮은비율로확인되었다. 또한, 32균주는각각 8 16 개의유전자를동시에가지고있는것으로확인되었으며, 그중 15개의유전자를가지고있는균주가 9균주 (28.1%) 로가장높은비율을보였다 (Table 5). 그다음으로 14 개의유전자를가지고있는균주가 8균주 (25.0%), 13개와 16개의유전자를가지고있는균주가각각 5균주 (15.6%) 로확인되었으며, 12개의유전자를가지고있는균주가 2균주 (6.3%), 8개와 9개, 11개의유전자를가지고있는균주가각각 1균주 (3.1%) 로확인되었다. 고찰 Carbapenem 내성 P. aeruginosa의증가는전세계적으로높은사망율의원인이되고있으며, 다제내성으로발달하고있어매우심각한실정이다 [9, 14, 18]. 본연구에서도 32균주의 carbapenem 내성 P. aeruginosa 중 14균주 (43.8%) 가다제내성균이었으며, 이중 71.4% (10균주) 가 ST235로확인되었다. 이전많은연구에서다제내성으로보고되고있는 ST235는 CC235의대표적인클론으로, 유럽, 아시아, 남아메리카등에서보고되고있다 [19, 20]. 우리나라의경우, IMP-6를생성하는 ST235의출현과확산에대해보고하고있으며, 최근에는 IMP-10을생성하는 ST235가보고되어 carbapenemases의다양화에대한우려를낳고있다 [21, 22]. 또한, 항균제감수성결과, 8개의항균제에대해모두 40% 이상의높은내성율을보임에따라, 향후다제내성으로의발달가능성과항균제의선택과사용에대한어려움이대두되고있다

5 Korean J Clin Lab Sci. Vol. 51, No. 3, September Table 4. Distribution of exo genes between MDR and non-mdr P. aeruginosa isolates Strain Source ST Virulence gene Resistance profile MDR (N=14) 26 Wound 235 exot, exou, exoy AMK, GEN, IPM, MEM, CIP, LEV 29 Sputum 235 exot, exou, exoy AMK, GEN, IPM, MEM, CIP, LEV, CAZ, CFP 31 Wound 235 exou AMK, GEN, IPM, MEM, CIP, LEV, CFP 38 Sputum 235 exot, exou, exoy AMK, GEN, IPM, MEM, CIP, LEV, CAZ, CFP 82 Urine 235 exot, exou, exoy AMK, GEN, IPM, MEM, CIP, LEV, CAZ, CFP 87 Sputum 245 exos, exot, exoy GEN, IPM, MEM, CIP, LEV, CFP 114 Wound 235 exot, exou, exoy AMK, GEN, IPM, MEM, CIP, LEV, CFP 169 Sputum 235 exot, exou AMK, GEN, IPM, MEM, CIP, LEV, CAZ, CFP 255 Sputum 654 exos, exot AMK, GEN, IPM, MEM, CIP, LEV 257 Urine 235 exot, exou, exoy AMK, GEN, IPM, MEM, CIP, LEV, CAZ, CFP 269 Sputum 589 exos, exot, exoy AMK, GEN, IPM, MEM, CIP, LEV 293 Urine 245 exos, exot, exoy AMK, GEN, IPM, MEM, CIP, LEV 308 Urine 235 exot, exou, exoy AMK, GEN, IPM, MEM, CIP, LEV, CFP 310 Sputum 235 exot, exou AMK, GEN, IPM, MEM, CIP, LEV non-mdr (N=18) 19 Sputum exos, exot, exoy IPM, MEM, CIP, LEV, CAZ, CFP 32 Blood exos, exot, exoy IPM, MEM 107 Sputum exos, exot, exoy IPM, MEM 184 Urine exos, exot, exoy IPM, MEM, CAZ, CFP 196 Sputum exos, exot, exoy IPM, MEM, CIP, LEV, CAZ, CFP 213 Sputum exos, exot, exoy IPM, MEM, CIP, LEV, CAZ, CFP 252 Bile exos, exot, exoy IPM, MEM, CIP, LEV 254 Pus exos, exot, exoy IPM, MEM 274 Sputum exos, exot, exoy IPM, MEM 275 Sputum exot, exou, exoy AMK, GEN, IPM, MEM, CAZ, CFP 279 Sputum exot, exou, exoy GEN, IPM, MEM, CAZ, CFP 300 Sputum exos, exot, exoy IPM, MEM, CIP, LEV 325 Sputum exos, exot, exoy IPM, MEM, CIP, LEV, CAZ 337 Sputum exos, exot, exoy IPM, MEM, CIP, LEV 346 Sputum exos, exot, exoy IPM, MEM 351 Sputum exos, exot, exoy IPM, MEM, CFP 369 Sputum exos, exot, exoy IPM, MEM 371 Sputum exos, exot IPM, MEM, CIP, LEV, CAZ Abbreviations: MDR, multidrug resistan; ST, sequence type; AMK, amikacin; GEN, gentamicin; IPM, imipenem; MEM, meropenem; CIP, ciprofloxacin; LEV, levofloxacin; CAZ, ceftazidime; CFP, cefepime. [23]. 최근 P. aeruginosa는많은항균제에내재된또는획득된내성관련연구뿐만아니라, 세포관련및세포외병독성인자에대한많은연구가보고되고있다 [2, 9]. 이러한병독성인자들은심각한조직손상, 혈액감염전파및질병의진행에관여하며, 현재사용가능한항균제의치료를제한하고있어그심각성이중요시되고있다 [24, 25]. 이전연구에서특정항균제인 fluoroquinolne 과일부병독성유전자인 exos와 exou의관계를확인한결과를토대로, 이번연구에서는동일지역의병원에서분리한 carbapenem 내성 P. aeruginosa를대상으로다양한세포관련및세포외병독성인자의분포및항균제내성과의관계를확인하였다. 18개의세포관련및세포외병독성인자를확인한결과, 32균주모두에서유전자가확인되었으며, toxa, plcn, phzm 유전자 (100%, 32/32) 가가장높은비율로확인되었다. 앞서발표된많은연구에서도 toxa 유전자는높은빈도로 확인되었는데, Badr RI 등 [26] 의연구에의하면, 화상환자로부터분리된 P. aeruginosa에서 89% 의높은비율로확인되었으며, Haghi 등 [9] 의연구에서도총 93균주의 P. aeruginosa 중 97.8% 에서확인되었다. toxa 유전자에의해암호화된 exotoxin A는 type II secretion system (T2SS) 의주요구성성분으로, 인체에서세포사멸, 심각한조직손상과괴사를일으키고있다. 이러한 exotoxin A는 ADP-ribosyl 부분을신장인자 2 로전달하는 ADP-ribosyl transferase 로서, 포유동물세포에서단백질합성을억제하고있다 [7, 8]. 또한, P. aeruginosa에서 rhamnolipid와 2종류의 phospholipases C ( 용혈성 phospholipase C (PlcH) 와비용혈성 phospholipase C (PlcN)) 는 3가지용해성단백질로써, 숙주세포의침입에관여하고있다. PlcH는적혈구막의분해를촉진하는데외막의인지질성분인 phosphatidylcholine 과 sphingomyelin 을분해하

6 306 Hye Hyun Cho. Virulence Factors of Carbapenem-Resistant Pseudomonas aeruginosa Table 5. Distribution of virulence genes among 32 CRPA isolates Genes Virulence genes profile No. of isolates (%) Total No. (%) 8 genes toxa, exou, plcn, phzi, phzm, phzs, lasa, lasb 1 (3.1%) 1 (3.1%) 9 genes toxa, exot, exou, plch, plcn, phzm, phzs, lasb, apra 1 (3.1%) 1 (3.1%) 11 genes toxa, exot, exou, plcn, phzi, phzii, phzh, phzm, phzs, lasa, lasb 1 (3.1%) 1 (3.1%) 12 genes toxa, exot, exou, exoy, plch, plcn, phzi, phzh, phzm, phzs, lasb, apra 1 (3.1%) 2 (6.3%) toxa, exot, exou, exoy, plcn, phzi, phzh, phzm, phzs, lasa, lasb, apra 1 (3.1%) 13 genes toxa, exos, exot, exoy, plch, plcn, phzi, phzii, phzh, phzm, phzs, lasa, apra 1 (3.1%) 5 (15.6%) toxa, exos, exot, exoy, plch, plcn, phzi, phzii, phzh, phzm, phzs, lasb, apra 1 (3.1%) toxa, exos, exot, plch, plcn, phzi, phzh, phzm, phzs, lasa, lasb, apra, pvda 1 (3.1%) toxa, exot, exou, exoy, plch, plcn, phzi, phzii, phzh, phzm, lasa, lasb, apra 1 (3.1%) toxa, exot, exou, exoy, plcn, phzi, phzii, phzh, phzm, phzs, lasa, lasb, apra 1 (3.1%) 14 genes toxa, exot, exou, exoy, plch, plcn, phzi, phzii, phzh, phzm, phzs, lasa, lasb, apra 5 (15.6%) 8 (25.0%) toxa, exos, exot, exoy, plch, plcn, phzi, phzii, phzh, phzm, phzs, lasa, lasb, apra 2 (6.3%) toxa, exos, exot, plch, plcn, phzi, phzii, phzh, phzm, phzs, lasb, pila, apra, pvda 1 (3.1%) 15 genes toxa, exos, exot, exoy, plch, plcn, phzi, phzii, phzh, phzm, phzs, lasa, lasb, apra, pvda 7 (21.9%) 9 (28.1%) toxa, exos, exot, exoy, plch, plcn, phzi, phzii, phzh, phzm, phzs, lasb, pila, apra, pvda 1 (3.1%) toxa, exos, exot, exoy, plcn, phzi, phzii, phzh, phzm, phzs, lasa, lasb, pila, apra, pvda 1 (3.1%) 16 genes toxa, exos, exot, exoy, plch, plcn, phzi, phzii, phzh, phzm, phzs, lasa, lasb, pila, apra, pvda 5 (15.6%) 5 (15.6%) 여내막을노출시키고, PlcN은내막에존재하는 phosphatidylserine 을가수분해함으로써, 2종류의 phospholipases 는상승작용을하고있다 [27]. Georgescu 등 [28] 은 plch 유전자만확인되었던루마니아의이전연구결과와달리, 혈액배양과상처부위로부터분리된 P. aeruginosa에서 plch와 plcn 유전자모두 84.6% 의높은빈도로확인된결과를보고하였다 년이란에서발표한 Faraji 등 [29] 은낭포성섬유증과화상감염을가진소아에서 P. aeruginosa의병독성인자를각각확인한결과, plch (87.7%, 79.0%) 와 plcn (60.0%, 63.1%) 유전자모두검출되었으며, 본연구에서도 plcn와 plch 유전자가 100% 와 84.4% 로확인되어, 이전연구보다높은결과를보였다. Phenazine 오페론 (phzi, phzii) 및유전자 (phzh, phzm, phzs) 는 P. aeruginosa에의해수동적으로분비되는 3 가지 phenazine 화합물의형성에관여하는전구단백질을암호화한다 [30]. 이러한 3가지 phenazine 화합물은 pyocyanin, 1-hydroxyphenazine, phenazine-1-carboxamide로써, 세포내산화스트레스를증가시키는원인이되고있으며, 2015년미국에서발표한 Goldufsky 등 [6] 은 P. aeruginosa 균주의 90% 이상이 pyocyanin 을생성함으로써만성폐감염에서관찰된폐조직손상에중요한역할을하는것으로보고하였다. 본연구에서는 5개의 phenazine 오페론및유전자가 84% 이상의높은빈도를보였으며, phzm 유전자가 32균주모두에서확인되었다. P. aeruginosa 감염에의한조직손상의또다른원인중하나는 type III secretion proteins로써, exo 유전자 (exos, exot, exou, exoy) 는 type III secretion systems의발현과분비에 관여하고있다 [31, 32]. Allydice-Francis 등 [33] 의연구에의하면, 대부분의많은 P. aeruginosa 균주들이여러 exo 유전자를동시에가지고있는것을보고하였다. 이와유사하게, 본연구에서는 exot 유전자가 96.9% 로가장높은빈도로확인되었고, 그다음으로 exoy 유전자가 84.4%, exos 유전자가 62.5%, exou 유전자가 37.5% 를보였으며, 1균주를제외한 31균주 (96.9%) 가 2개이상의 exo 유전자를가지고있었다. 이중 exou 유전자와 exos 유전자는유의한관계를보이는데, exou 유전자가확인된 12균주중 10균주는다제내성균 (83.3%) 인반면, exos 유전자가확인된 20균주중 16균주는다제내성이아닌균 (80.0%) 으로확인되었으며, 두유전자를모두가지고있는균주는한균주도확인되지않았다. 2019년이란에서발표한 Khodayary 등 [18] 은 exou 유전자의획득과항균제의높은내성에대한정확한기전은알려지지않았으나, exou 유전자의존재는 exos 유전자와비교하여항균제에대한내성이높다는점을확인하였고, 이러한결과는이란과한국, 인도, 호주등다른국가에서연구한결과와일치하였다. 그밖에 P. aeruginosa 는 lasa와 lasb 유전자가암호화하는 elastase 효소를가지고있는데, 이효소는사이토카인, 백혈구및방어세포를분해할수있으며, 폐와혈관조직의분해에중요한역할을하고있다 [34, 35]. 또다른병독성인자중하나로, apra 유전자가암호화하는 alkaline protease는각막염, 중이염, 낭포성섬유증및균혈증에서생성되며, 사이토카인, 보체, 인터페론및종양괴사인자와같이생물학적으로중요한단백질의가수분해에관여하고있다 [36]. 본연구에서 lasb와 lasa, apra 유전자는각각 96.9% 와

7 Korean J Clin Lab Sci. Vol. 51, No. 3, September %, 93.8% 의높은빈도로확인되었다. 또한, pyoverdine 생합성에관여하는 pvda 유전자는 50.0% 가확인되었으며, type IV pili의생합성에관여하는 pila 유전자는 25.0% 를보였고 pilb 유전자는한균주에서도검출되지않았다. 또한, 이전연구에서 Fazeli N 등 [2] 은다제내성 P. aeruginosa 균주에서병독성관련유전자의다양한범위와조합을확인하였다. 이와유사하게 32균주에서확인된 17개의세포관련및세포외병독성인자는 8개이상의유전자가다양한조합으로확인되었으며, 이중 15개의유전자를가지고있는 9균주 (28.1%) 는가장높은빈도로확인되었다. 2011년 3월부터 2012년 12월까지대전지역의 3차병원에서분리된 carbapenem 내성 P. aeruginosa를대상으로한항균제감수성결과, 43.8% 가다제내성균으로확인되었으며, 각항균제에대한내성율이 40% 이상을보임에따라다제내성으로의발달및확산, 항균제의선택과제한이심각한실정이다. 또한, 세포관련및세포외병독성인자의생성을확인한결과, 32 균주모두에서확인되었고 8개이상의유전자를가진다양한조합으로존재하는것을확인하였으며, 이중 exou 유전자와다제내성과의유의한관계를확인하였다 (P<0.001). 향후다제내성균에대한중요한예측마커로써활용되기위해 exou 유전자와다제내성균과의연관성에대한연구가지속적으로진행되어야할것으로사료된다. 요약다제내성 P. aeruginosa의출현과확산은전세계적으로중요한문제가되고있다. P. aeruginosa에의한발병은일부몇몇세포관련및세포외병독성인자의생성에기인한다. 본연구에서는대전지역의 3차병원에서분리된 carbapenem 내성 P. aeruginosa를대상으로병독성인자의분포와항균제내성양상을조사하였다. 항균제감수성시험은디스크확산법으로확인하였고, 병독성유전자의분석을위해 PCR과염기서열분석을수행하였다. 또한, 다제내성 P. aeruginosa의 sequence type (ST) 은 multilocus sequence typing (MLST) 을통해확인하였다. 32균주의 carbapenem 내성 P. aeruginosa 중, 14균주 (43.8%) 가다제내성이었으며, 주요 ST는 ST235 (10균주, 71.4.%) 임을확인하였다. 병독성유전자는 32균주모두에서확인되었고, 이중가장높은빈도로확인된병독성유전자는 toxa, plcn, phzm (100.%) 이었다. 또한, 32균주는모두 8개이상의병독성유전자를가지고있었으며, 9균주 (28.1%) 가 15개의병독성유전자를가지고있었다. exou 유전자는다제내성 P. aeruginosa 균주의 71.4% 에서확인되었다. 이러한결과는 exou 유전자가다제내성 P. aeruginosa 균주의지속성에대한예측표지자가될수있을것으로사료된다. Acknowledgements: None Conflict of interest: None Author s information (Position): Cho HH, Professor. REFERENCES 1. Kumari H, Balasubramanian D, Zincke D, Mathee K. Role of Pseudomonas aeruginosa AmpR on -lactam and non- -lactam transient cross-resistance upon pre-exposure to subinhibitory concentrations of antibiotics. J Med Microbiol. 2014;63: Fazeli N, Momtaz H. Virulence gene profiles of multidrug-resistant Pseudomonas aeruginosa isolated from Iranian hospital infections. Iran Red Crescent Med J. 2014;16:E Strateva T, Yordanov D. Pseudomonas aeruginosa - a phenomenon of bacterial resistance. J Med Microbiol. 2009;58: Lanotte P, Watt S, Mereghetti L, Dartiguelongue N, Rastegar- Lari A, Goudeau A, et al. Genetic features of Pseudomonas aeruginosa isolates from cystic fibrosis patients compared with those of isolates from other origins. J Med Microbiol. 2004; 53: Choy MH, Stapleton F, Willcox MD, Zhu H. Comparison of virulence factors in Pseudomonas aeruginosa strains isolated from contact lens- and non-contact lens-related keratitis. J Med Microbiol. 2008;57: / Goldufsky J, Wood S, Hajihossainlou B, Rehman T, Majdobeh O, Kaufman HL, et al. Pseudomonas aeruginosa exotoxin T induces potent cytotoxicity against a variety of murine and human cancer celllines. J Med Microbiol. 2015;64: Wolska K, Szweda P. Genetic features of clinical Pseudomonas aeruginosa strains. Pol J Microbiol. 2009;58: Kipnis E, Sawa T, Wiener-Kronish J. Targeting mechanisms of Pseudomonas aeruginosa pathogenesis. Med Mal Infect. 2006;36: Haghi F, Zeighami H, Monazami A, Toutouchi F, Nazaralian S, Naderi G. Diversity of virulenc egenes in multidrug resistant Pseudomonas aeruginosa isolated from burn wound infections. Microb Pathog. 2018;115: j.micpath Makedou KG, Tsiakiri EP, Bisiklis AG, Chatzidimitriou M, Halvantzis AA, Ntoutsou K, et al. Changes in antibiotic resistance of the most common Gram-negative bacteria isolated in intensive care units. J Hosp Infect. 2005;60: Tsukayama DT, van Loon HJ, Cartwright C, Chmielewski B, Fluit

8 308 Hye Hyun Cho. Virulence Factors of Carbapenem-Resistant Pseudomonas aeruginosa AC, van der Werken C, et al. The evolution of Pseudomonas aeruginosa during antibiotic rotation in a medical intensive care unit: the RADAR-trial. Int J Antimicrob Agents. 2004;24: Rossi Gonçalves I, Dantas RCC, Ferreira ML, Batistão DWDF, Gontijo-Filho PP, Ribas RM. Carbapenem-resistant Pseudomonas aeruginosa: association with virulence genes and biofilm formation. Braz J Microbiol. 2017;48: Khosravi Y, Tay ST, Vadivelu J. Analysis of integrons and associated gene cassettes of metallo- -lactamase-positive Pseudomonas aeruginosa in Malaysia. Med Microbiol. 2011;60: Cho HH. Molecular analysis of carbapenem-resistant Pseudomonas aeruginosa isolated from patients hospitalized in Daejeon between 2008 and 2014 year. Korean J Clin Lab Sci. 2018;50: Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; twentieth informational supplement, M100-S20. Wayne, PA: Clinical and Laboratory Standards Institute; Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012;18: /j x. 17. Finnan S, Morrissey JP, O'Gara F, Boyd EF. Genome diversity of Pseudomonas aeruginosa isolates from cystic fibrosis patients and the hospital environment. J Clin Microbiol. 2004;42: Khodayary R, Nikokar I, Mobayen MR, Afrasiabi F, Araghian A, Elmi A, et al. High incidence of type III secretion system associated virulence factors (exoenzymes) in Pseudomonas aeruginosa isolated from Iranian burn patients. BMC Res Notes. 2019;12: /s Samuelsen O, Toleman MA, Sundsfjord A, Rydberg J, Leegaard TM, Walder M, et al. Molecular epidemiology of metallo-beta-lactamase-producing Pseudomonas aeruginosa isolates from Norway and Sweden shows import of international clones and local clonal expansion. Antimicrob Agents Chemother. 2010;54: Cholley P, Thouverez M, Hocquet D, van der Mee-Marquet N, Talon D, Bertrand X. Most multidrug-resistant Pseudomonas aeruginosa isolates from hospitals in eastern France belong to a few clonal types. J Clin Microbiol. 2011;49: Hong JS, Yoon EJ, Lee H, Jeong SH, Lee K. Clonal dissemination of Pseudomonas aeruginosa sequence type 235 isolates carrying bla IMP-6 and emergence of bla GES-24 and bla IMP-10 on novel genomic islands PAGI-15 and 16 in South Korea. Antimicrob Agents Chemother. 2016;60: /AAC Wi YM, Choi JY, Lee JY, Kang CI, Chung DR, Peck KR, et al. Emergence of colistin resistance in Pseudomonas aeruginosa ST235 clone in South Korea. Int J Antimicrob Agents. 2017; 49: Kim D, Ahn JY, Lee CH, Jang SJ, Lee H, Yong D, et al. Increasing resistance to extended-spectrum cephalosporins, fluoroquinolone, and carbapenem in Gram-negative bacilli and the emergence of carbapenem non-susceptibility in Klebsiella pneumoniae: Analysis of Korean Antimicrobial Resistance Monitoring System (KARMS) data from 2013 to Ann Lab Med. 2017;37: Breidenstein EB, de la Fuente-Núñez C, Hancock RE. Pseudomonas aeruginosa: all roads lead to resistance. Trends Microbiol. 2011;19: Kerr KG, Snelling AM. Pseudomonas aeruginosa: a formidable and ever-present adversary. J Hosp Infect. 2009;73: Badr RI, Nagdy M, Sabagh A, Din AB. Pseudomonas aeruginosa exotoxin A as a virulence factor in burn wound infections. Egypt J Med Microbiol. 2008;17: Cotar AI, Chifiriuc MC, Banu O, Lazar V. Molecular characterization of virulence patterns in Pseudomonas aeruginosa strains isolated from respiratory and wound samples. Biointerface Res Appl Chem. 2013;3: Georgescu M, Gheorghe I, Curutiu C, Lazar V, Bleotu C, Chifiriuc MC. Virulence and resistance features of Pseudomonas aeruginosa strains isolated from chronic leg ulcers. BMC Infect Dis. 2016;16: Faraji F, Mahzounieh M, Ebrahimi A, Fallah F, Teymournejad O, Lajevardi B. Molecular detection of virulence genes in Pseudomonas aeruginosa isolated from children with cystic fibrosis and burn wounds in Iran. Microb Pathog. 2016;99: Jamunadevi S, Balashanmugam P, Muralitharan G, Kalaichelvan PT. Molecular characterization of pathogenic and non-pathogenic Pseudomonas aeruginosa with special reference to phenazine gene. J Mod Biotechnol. 2012;1: Galle M, Carpentier I, Beyaert R. Structure and function of the type III secretion system of Pseudomonas aeruginosa. Curr Protein Pept Sci. 2012;13: Hauser AR. The type III secretion system of Pseudomonas aeruginosa: infection by injection. Nat Rev Microbiol. 2009;7: Allydice-Francis K, Brown PD. Diversity of antimicrobial resistance and virulence determinants in Pseudomonas aeruginosa associated with fresh vegetables. Int J Microbiol. 2012;2012: Kruczek C, Kottapalli KR, Dissanaike S, Dzvova N, Griswold JA, Colmer-Hamood JA, et al. Major transcriptome changes accompany the growth of Pseudomonas aeruginosa in blood from patients with severe thermal injuries. PLoS One. 2016;11: E Islamieh DI, Afshar D, Esmaeili D. Effect of Satureja khuzistanica essential oil (SKEO) extract on expression of lasa and lasb genes in Pseudomonas aeruginosa. Iran J Microbiol. 2019;11: Andrejko M, Siemińska-Kuczer A, Janczarek M, Janik E, Bednarczyk M, Gagoś M, et al. Pseudomonas aeruginosa alkaline protease exhibits a high renaturation capability. Acta Biochim Pol. 2019;66: _2741.