untitled
|
|
- 승형 원
- 5 years ago
- Views:
Transcription
1 Korean J Clin Lab Sci. 2019;51(3): Korean Society for Clinical Laboratory Science ORIGINAL ARTICLE Molecular Detection of Virulence Factors in Carbapenem-Resistant Pseudomonas aeruginosa Isolated from a Tertiary Hospital in Daejeon Hye Hyun Cho Department of Biomedical Laboratory Science, Daejeon Institute of Science and Technology, Daejeon, Korea 대전지역의 3 차병원에서분리된 Carbapenem 내성 Pseudomonas aeruginosa 의병독성인자검출 조혜현 대전과학기술대학교임상병리과 ARTICLE INFO Received August 15, 2019 Revised 1 st August 23, 2019 Revised 2 nd August 27, 2019 Accepted August 27, 2019 Key words ExoU gene Multidrug-resistant Virulence factor ABSTRACT The emergence and spread of multidrug resistant (MDR) Pseudomonas aeruginosa is a critical problem worldwide. The pathogenesis of P. aeruginosa is due partly to the production of several cell-associated and extracellular virulence factors. This study examined the distribution of virulence factors and antimicrobial resistance patterns of carbapenem-resistant P. aeruginosa (CRPA) isolated from a tertiary hospital in Daejeon, Korea. Antimicrobial susceptibility testing was performed using the disk diffusion method, and PCR and DNA sequencing were performed to determine for the presence of virulence genes. In addition, the sequence type (ST) of MDR P. aeruginosa was investigated by multilocus sequence typing (MLST). Among 32 CRPA isolates, 14 (43.8%) were MDR and the major ST was ST235 (10 isolates, 71.4%). All isolates were positive for the presence of virulence genes and the most prevalent virulence genes were toxa, plcn, and phzm (100%). All isolates carried at least eight or more different virulence genes and nine (28.1%) isolates had 15 virulence genes. The presence of the exou gene was detected in 71.4% of the MDR P. aeruginosa isolates. These results indicate that the presence of the exou gene can be a predictive marker for the persistence of MDR P. aeruginosa isolates. Copyright 2019 The Korean Society for Clinical Laboratory Science. All rights reserved. 서론 Pseudomonas aeruginosa는만성감염과심각한급성감염을일으키는광범위한기회감염균이다. 또한 P. aeruginosa는폐렴, 창상감염, 심각한화상, 욕창, 면역력이저하된환자의다양한전신감염을일으키는원내감염균의 10 15% 를차지하고 * Corresponding author: Hye Hyun Cho Department of Biomedical Laboratory Science, Daejeon Institute of Science and Technology, 100 Hyechon-ro, Seo-gu, Daejeon 35408, Korea airplane1102@hanmail.net * ORCID: 있다. 최근원내감염에의한사망율이 18 61% 로보고되고있으며, 특히다제내성 P. aeruginosa에의한원내감염은전세계적으로증가하고있는실정이다 [1-3]. 최근 P. aeruginosa에의한발병기전중하나로, 세포관련및세포외병독성인자의생성은광범위조직손상, 혈류침입및확산을일으키는것으로보고되고있다 [4, 5]. 세포관련병독성인자로는 flagella, lipopolysaccharide, pili (pila, pilb), type III system effector proteins, type III secretion system (exos, exot, exou, exoy) 과 alginate 가있으며, 세포외병독성인자로는 exotoxin A (toxa), phospholipases (plch, plcn), pissn eissn This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
2 302 Hye Hyun Cho. Virulence Factors of Carbapenem-Resistant Pseudomonas aeruginosa phenazine (phzi, phzii, phzh, phzm, phzs), elastase (lasa), zinc metalloprotease (lasb), alkaline protease (apra), pyoverdin (pvda) 이있다 [6-9]. 이러한세포관련및세포외병독성인자에의한침입성 P. aeruginosa 감염은 carbapenem 과같은항균제의사용에도불구하고높은사망률을나타내고있다. 최근 carbapenem 에대한높은내성이발달함에따라다제내성 P. aeruginosa의출현은전세계적으로심각한문제로대두되고있으며일본, 대만, 인도, 이란등아시아지역국가에서항균제의선택과사용의제한으로인해치료에많은어려움이보고되고있다 [10-13]. 특히, 우리나라의경우 carbapenem 에대한내성이지속적으로증가하고있으며, 대부분의 carbapenem 내성 P. aeruginosa가다제내성으로보고되어큰우려를낳고있다 [14]. 현재우리나라에서는다제내성 P. aeruginosa에대한많은연구가보고되고있으나, 세포관련및세포외병독성인자와관련된연구는매우미비한실정이다. 이에본연구에서는대전지역의 3차병원에서분리된 carbapenem 내성 P. aeruginosa를대상으로주요세포관련및세포외병독성인자의분포를확인하고, 항균제내성과의관계에대해조사하고자한다. 재료및방법 1. 균주의수집과동정본연구는 2011년 3월부터 2012년 12월까지대전지역의 3 차병원에의뢰된객담 (21), 소변 (5), 창상 (3), 농 (1), 담즙 (1), 혈액 (1) 로부터분리된 carbapenem 내성 P. aeruginosa 32균주를대상으로하였다. 이중동일환자에서반복분리된균주는수집대상에서제외하였다. 임상검체로부터분리배양된균주는 Vitek II automated ID system (BioMerieux, Hazelwood, MO, USA) 을이용하여동정하였고, carbapenem 내성 P. aeruginosa 는 imipenem 과 meropenem 에내성인균주로선별하였다. 2. 항균제감수성검사 Clinical and Laboratory Standards Institute (CLSI) 지침에따라, amikacin, gentamicin, imipenem, meropenem 및 ciprofloxacin, levofloxacin, ceftazidime, cefepime (BBL, Cockeysville, MI, USA) 에대한감수성검사는 Mueller-Hinton 한천배지 (Difco, Cockeysville, MD, USA) 를사용하여디스크확산법으로확인하였다 [15]. 정도관리를위해 Escherichia coli ATCC 25922와 Pseudomonas aeruginosa ATCC 27853을동시에시험하여허용범위내에있는지확인하였다. Magiorakos 등 [16] 의연구를참고하여, aminoglycosides, carbapenems 및 fluoroquinolones 계열에내성을보인균주를다제내성 P. aeruginosa로하였다. 3. 다제내성 P. aeruginosa의 multilocus sequencing typing (MLST) 분석항균제감수성시험결과, 다제내성 P. aeruginosa로확인된균주는 brain heart infusion broth (Difco) 에접종하여 37 C 에서 24시간배양한후, Genomic DNA Prep kit (Solgent, Daejeon, Korea) 을사용하여 DNA를추출하였다. DNA 추출액 (5 L), 10 Taq buffer (2.5 L), 10 mm dntp mix (0.5 L), primer 각 10 pmol, 0.7 U Taq DNA polymerase (Solgent) 및증류수를혼합하여총부피 25 L의반응용액을만들었다. 7개의 housekeeping gene (acsa, aroe, guaa, mutl, nuod, ppsa, trpe) 은 Gene Amp PCR System 9600 (Perkin-Elmer, Norwalk, CT, USA) 을사용하여 96 C에서 1 분간반응시킨후, 96 C에서 1분, 55 C에서 1분, 72 C에서 1분으로 30회증폭반응시키고, 72 C에서 10분간연장반응시켰다. 각각의 PCR 반응산물은 ethidium bromide가포함된 1% agarose gel에서 30분간전기영동하여밴드를확인하였다. 증폭산물은 PCR purification kit (Solgent) 로분리한후, BigDye Terminator cycle sequencing kit (PE Applied Biosystems, Foster City, CA, USA) 와 ABI PRISM 3730xl DNA analyzer (PE Applied Biosystems) 를이용하여염기서열을분석하였다. MLST는 P. aeruginosa MLST database website ( pubmlst.org/ paeruginosa/) 에설명된방법에따라분석하였다. 7개의 housekeeping gene에대한각각의염기서열분석결과는 MLST database 에입력하여 allelic number와 sequence type (ST) 를확인하였다. 4. 세포관련및세포외병독성인자의검출 P. aeruginosa의주요병독성인자인 toxa, exos, exot, exou, exoy, plch, plcn, phzi, phzii, phzh, phzm, phzs, lasa, lasb, pila, pilb, apra, pvda 유전자를검출하기위해이전연구에서사용된 primer (Table 1) 를이용하여 PCR을진행하였다 [7, 17]. 먼저, toxa, exos, plch, plcn, lasb 유전자를확인하기위해, MLST 분석에서와동일한방법으로 DNA 추출액 (5 L), 10 Taq buffer (2.5 L), 10 mm dntp mix (0.5 L), primer 각 10 pmol, 0.7 U Taq DNA polymerase (Solgent) 및증류수를혼합하여총부피 25 L의반응용액을만들었다. PCR 과정은 94 C에서 3분간반응시킨후, 94 C에
3 Korean J Clin Lab Sci. Vol. 51, No. 3, September Table 1. Oligonucleotides primers used for virulence genes amplification Gene Sequence (5-3 ) Size of product (bp) References toxa F: CTGCGCGGGTCTATGTGCC R: GATGCTGGACGGGTCGAG exos F: CGTCGTGTTCAAGCAGATGGTGCTG R: CCGAACCGCTTCACCAGGC exot F: CAATCATCTCAGCAGAACCC R: TGTCGTAGAGGATCTCCTG exou F: GATTCCATCACAGGCTCG R: CTAGCAATGGCACTAATCG exoy F: TATCGACGGTCATCGTCAGGT R: TTGATGCACTCGACCAGCAAG plch F: GCACGTGGTCATCCTGATGC R: TCCGTAGGCGTCGACGTAC plcn F: TCCGTTATCGCAACCAGCCCTACG R: TCGCTGTCGAGCAGGTCGAAC phzi F: CATCAGCTTAGCAATCCC R: CGGAGAAACTTTTCCCTC phzii F: GCCAAGGTTTGTTGTCGG R: CGCATTGACGATATGGAAC phzh F: GGGTTGGGTGGATTACAC R: CTCACCTGGGTGTTGAAG phzm F: ATGGAGAGCGGGATCGACAG R: ATGCGGGTTTCCATCGGCAG phzs F: TCGCCATGACCGATACGCTC R: ACAACCTGAGCCAGCCTTCC lasa F: GCAGCACAAAAGATCCC R: GAAATGCAGGTGCGGTC lasb F: GGAATGAACGAAGCGTTCTCCGAC R: TGGCGTCGACGAACACCTCG pila F: ACAGCATCCAACTGAGCG R: TTGACTTCCTCCAGGCTG pilb F: TCGAACTGATGATCGTGG R: CTTTCGGAGTGAACATCG apra F: TGTCCAGCAATTCTCTTGC R: CGTTTTCCACGGTGACC pvda F: GACTCAGGCAACTGCAAC R: TTCAGGTGCTGGTACAGG 서 30초, 55 C에서 1분, 72 C에서 1분 30초로 30회증폭반응시키고, 72 C에서 5분간연장반응시켰다. 또한, exot, exou, exoy, phzi, phzii, phzh, phzm, phzs, lasa, pila, pilb, apra, pvda 유전자검출을위해 Finnan 등 [17] 의연구에서사용된 primer와반응조건을참고하여진행하였다. PCR 반응산물은 ethidium bromide가포함된 1% agarose gel에서 30분간전기영동하여밴드를확인하였다. 증폭산물은 PCR purification kit (Solgent) 로분리한후, BigDye Terminator cycle sequencing kit (PE Applied Biosystems, Foster City, CA, USA) 와 ABI PRISM 3730xl DNA analyzer (PE Applied Biosystems) 를이용하여염기서열을분석하였다. 5. 통계분석 Microsoft Excel 2010 (Microsoft Inc., Redmond, WA, USA) 를이용한 chi-square test를통해 P<0.05 인경우를유의한것으로판정하였다. 결과 1. 항균제감수성양상과다제내성균의 MLST 분석총 32균주의 carbapenem 내성 P. aeruginosa를대상으로항균제감수성검사를실시한결과, amikacin 에 14균주 (43.8%), gentamicin에 16균주 (50.0%), ciprofloxacin에 22 균주 (68.8%) levofloxacin에 22균주 (68.8%), ceftazidime에 13균주 (40.6%), cefepime에 16균주가내성을보였으며, imipenem과 meropenem에 32균주 (100%) 모두내성을보였다 (Table 2). 이중 14균주는다제내성임을확인하였고, ST235가 10균주 (71.4%), ST245가 2균주 (14.3%), ST589, ST654가각각 1균주 (7.1%) 를나타내었다. 또한, 다제내성균 (14균주) 와다제내성이아닌균 (18균주) 에대한세포관련및세포외병독성인자의분포차이를확인하였다 (Table 3). 15개의세포관련및 Table 2. Antimicrobial susceptibility of 32 CRPA isolates Antimicrobial agent No. of isolates (%) Resistant Susceptible Intermediate Amikacin 14 (43.8%) 17 (53.1%) 1 (3.1%) Gentamicin 16 (50.0%) 16 (50.0%) 0 (0.0%) Imipenem 32 (100.0%) 0 (0.0%) 0 (0.0%) Meropenem 32 (100.0%) 0 (0.0%) 0 (0.0%) Ciprofloxacin 22 (68.8%) 10 (31.3%) 0 (0.0%) Levofloxacin 22 (68.8%) 8 (25.0%) 2 (6.3%) Ceftazidime 13 (40.6%) 13 (40.6%) 6 (18.8%) Cefepime 16 (50.0%) 12 (37.5%) 4 (12.5%)
4 304 Hye Hyun Cho. Virulence Factors of Carbapenem-Resistant Pseudomonas aeruginosa Table 3. Prevalence of virulence genes between MDR and non-mdr P. aeruginosa isolates Genes No. of isolates (%) Total (N=32) MDR (N=14) non-mdr (N=18) toxa 32 (100.0%) 14 (100.0%) 18 (100.0%) exos 20 (62.5%) 4 (28.6%) 16 (88.9%) exot 31 (96.9%) 13 (92.9%) 18 (100.0%) exou 12 (37.5%) 10 (71.4%) 2 (11.1%) exoy 27 (84.4%) 10 (71.4%) 17 (94.4%) plch 27 (84.4%) 10 (71.4%) 17 (94.4%) plcn 32 (100.0%) 14 (100.0%) 18 (100.0%) phzi 31 (96.9%) 13 (92.9%) 18 (100.0%) phzii 27 (84.4%) 10 (71.4%) 17 (94.4%) phzh 30 (93.8%) 12 (85.7%) 18 (100.0%) phzm 32 (100.0%) 14 (100.0%) 18 (100.0%) phzs 31 (96.9%) 14 (100.0%) 17 (94.4%) lasa 27 (84.4%) 9 (64.3%) 18 (100.0%) lasb 31 (96.9%) 14 (100.0%) 17 (94.4%) pila 8 (25.0%) 3 (21.4%) 5 (27.8%) pilb 0 (0.0%) 0 (0.0%) 0 (0.0%) apra 30 (93.8%) 12 (85.7%) 18 (100.0%) pvda 16 (50.0%) 3 (21.4%) 13 (72.2%) Abbreviation: MDR, multidrug resistant. 세포외병독성인자의유전자의경우, 다제내성균과다제내성이아닌균에서큰차이를보이지않았으나, exos, exou, pvda 유전자의경우, 유의한차이를보였다 (P<0.001, P<0.001, P=0.004). 특히, exou 유전자의경우, 다제내성균에서 71.4% (10/14) 의높은비율을보인반면, 다제내성이아닌균에서는 11.1% (2/18) 의낮은비율로확인되었으며, exos 유전자의경우, 다제내성균에서 28.6% (4/14) 의낮은비율을보였으나, 다제내성이아닌균에서는 88.9% (16/18) 의높은비율이확인되었다 (Table 4). 2. 세포관련및세포외병독성인자의확인 18개의세포관련및세포외병독성인자의유전자확인을위해 PCR과염기서열을분석한결과, 총 32균주의 carbapenem 내성 P. aeruginosa 중 32균주 (100.0%) 모두에서확인되었다 (Table 3). 18개의세포관련및세포외병독성인자유전자중 toxa, plcn, phzm 유전자 (100%, 32/32) 가가장높은비율로확인되었으며, exot, phzi, phzs, lasb 유전자가각각 96.9% (31/32), phzh, apra 유전자가각각 93.8% (30/32) 의높은비율로확인되었다. 반면, pilb 유전자는 32균주모두에서확인되지않았으며, exou와 pila 유전자는각각 37.5% (12/32) 와 25.0% (8/32) 로비교적낮은비율로확인되었다. 또한, 32균주는각각 8 16 개의유전자를동시에가지고있는것으로확인되었으며, 그중 15개의유전자를가지고있는균주가 9균주 (28.1%) 로가장높은비율을보였다 (Table 5). 그다음으로 14 개의유전자를가지고있는균주가 8균주 (25.0%), 13개와 16개의유전자를가지고있는균주가각각 5균주 (15.6%) 로확인되었으며, 12개의유전자를가지고있는균주가 2균주 (6.3%), 8개와 9개, 11개의유전자를가지고있는균주가각각 1균주 (3.1%) 로확인되었다. 고찰 Carbapenem 내성 P. aeruginosa의증가는전세계적으로높은사망율의원인이되고있으며, 다제내성으로발달하고있어매우심각한실정이다 [9, 14, 18]. 본연구에서도 32균주의 carbapenem 내성 P. aeruginosa 중 14균주 (43.8%) 가다제내성균이었으며, 이중 71.4% (10균주) 가 ST235로확인되었다. 이전많은연구에서다제내성으로보고되고있는 ST235는 CC235의대표적인클론으로, 유럽, 아시아, 남아메리카등에서보고되고있다 [19, 20]. 우리나라의경우, IMP-6를생성하는 ST235의출현과확산에대해보고하고있으며, 최근에는 IMP-10을생성하는 ST235가보고되어 carbapenemases의다양화에대한우려를낳고있다 [21, 22]. 또한, 항균제감수성결과, 8개의항균제에대해모두 40% 이상의높은내성율을보임에따라, 향후다제내성으로의발달가능성과항균제의선택과사용에대한어려움이대두되고있다
5 Korean J Clin Lab Sci. Vol. 51, No. 3, September Table 4. Distribution of exo genes between MDR and non-mdr P. aeruginosa isolates Strain Source ST Virulence gene Resistance profile MDR (N=14) 26 Wound 235 exot, exou, exoy AMK, GEN, IPM, MEM, CIP, LEV 29 Sputum 235 exot, exou, exoy AMK, GEN, IPM, MEM, CIP, LEV, CAZ, CFP 31 Wound 235 exou AMK, GEN, IPM, MEM, CIP, LEV, CFP 38 Sputum 235 exot, exou, exoy AMK, GEN, IPM, MEM, CIP, LEV, CAZ, CFP 82 Urine 235 exot, exou, exoy AMK, GEN, IPM, MEM, CIP, LEV, CAZ, CFP 87 Sputum 245 exos, exot, exoy GEN, IPM, MEM, CIP, LEV, CFP 114 Wound 235 exot, exou, exoy AMK, GEN, IPM, MEM, CIP, LEV, CFP 169 Sputum 235 exot, exou AMK, GEN, IPM, MEM, CIP, LEV, CAZ, CFP 255 Sputum 654 exos, exot AMK, GEN, IPM, MEM, CIP, LEV 257 Urine 235 exot, exou, exoy AMK, GEN, IPM, MEM, CIP, LEV, CAZ, CFP 269 Sputum 589 exos, exot, exoy AMK, GEN, IPM, MEM, CIP, LEV 293 Urine 245 exos, exot, exoy AMK, GEN, IPM, MEM, CIP, LEV 308 Urine 235 exot, exou, exoy AMK, GEN, IPM, MEM, CIP, LEV, CFP 310 Sputum 235 exot, exou AMK, GEN, IPM, MEM, CIP, LEV non-mdr (N=18) 19 Sputum exos, exot, exoy IPM, MEM, CIP, LEV, CAZ, CFP 32 Blood exos, exot, exoy IPM, MEM 107 Sputum exos, exot, exoy IPM, MEM 184 Urine exos, exot, exoy IPM, MEM, CAZ, CFP 196 Sputum exos, exot, exoy IPM, MEM, CIP, LEV, CAZ, CFP 213 Sputum exos, exot, exoy IPM, MEM, CIP, LEV, CAZ, CFP 252 Bile exos, exot, exoy IPM, MEM, CIP, LEV 254 Pus exos, exot, exoy IPM, MEM 274 Sputum exos, exot, exoy IPM, MEM 275 Sputum exot, exou, exoy AMK, GEN, IPM, MEM, CAZ, CFP 279 Sputum exot, exou, exoy GEN, IPM, MEM, CAZ, CFP 300 Sputum exos, exot, exoy IPM, MEM, CIP, LEV 325 Sputum exos, exot, exoy IPM, MEM, CIP, LEV, CAZ 337 Sputum exos, exot, exoy IPM, MEM, CIP, LEV 346 Sputum exos, exot, exoy IPM, MEM 351 Sputum exos, exot, exoy IPM, MEM, CFP 369 Sputum exos, exot, exoy IPM, MEM 371 Sputum exos, exot IPM, MEM, CIP, LEV, CAZ Abbreviations: MDR, multidrug resistan; ST, sequence type; AMK, amikacin; GEN, gentamicin; IPM, imipenem; MEM, meropenem; CIP, ciprofloxacin; LEV, levofloxacin; CAZ, ceftazidime; CFP, cefepime. [23]. 최근 P. aeruginosa는많은항균제에내재된또는획득된내성관련연구뿐만아니라, 세포관련및세포외병독성인자에대한많은연구가보고되고있다 [2, 9]. 이러한병독성인자들은심각한조직손상, 혈액감염전파및질병의진행에관여하며, 현재사용가능한항균제의치료를제한하고있어그심각성이중요시되고있다 [24, 25]. 이전연구에서특정항균제인 fluoroquinolne 과일부병독성유전자인 exos와 exou의관계를확인한결과를토대로, 이번연구에서는동일지역의병원에서분리한 carbapenem 내성 P. aeruginosa를대상으로다양한세포관련및세포외병독성인자의분포및항균제내성과의관계를확인하였다. 18개의세포관련및세포외병독성인자를확인한결과, 32균주모두에서유전자가확인되었으며, toxa, plcn, phzm 유전자 (100%, 32/32) 가가장높은비율로확인되었다. 앞서발표된많은연구에서도 toxa 유전자는높은빈도로 확인되었는데, Badr RI 등 [26] 의연구에의하면, 화상환자로부터분리된 P. aeruginosa에서 89% 의높은비율로확인되었으며, Haghi 등 [9] 의연구에서도총 93균주의 P. aeruginosa 중 97.8% 에서확인되었다. toxa 유전자에의해암호화된 exotoxin A는 type II secretion system (T2SS) 의주요구성성분으로, 인체에서세포사멸, 심각한조직손상과괴사를일으키고있다. 이러한 exotoxin A는 ADP-ribosyl 부분을신장인자 2 로전달하는 ADP-ribosyl transferase 로서, 포유동물세포에서단백질합성을억제하고있다 [7, 8]. 또한, P. aeruginosa에서 rhamnolipid와 2종류의 phospholipases C ( 용혈성 phospholipase C (PlcH) 와비용혈성 phospholipase C (PlcN)) 는 3가지용해성단백질로써, 숙주세포의침입에관여하고있다. PlcH는적혈구막의분해를촉진하는데외막의인지질성분인 phosphatidylcholine 과 sphingomyelin 을분해하
6 306 Hye Hyun Cho. Virulence Factors of Carbapenem-Resistant Pseudomonas aeruginosa Table 5. Distribution of virulence genes among 32 CRPA isolates Genes Virulence genes profile No. of isolates (%) Total No. (%) 8 genes toxa, exou, plcn, phzi, phzm, phzs, lasa, lasb 1 (3.1%) 1 (3.1%) 9 genes toxa, exot, exou, plch, plcn, phzm, phzs, lasb, apra 1 (3.1%) 1 (3.1%) 11 genes toxa, exot, exou, plcn, phzi, phzii, phzh, phzm, phzs, lasa, lasb 1 (3.1%) 1 (3.1%) 12 genes toxa, exot, exou, exoy, plch, plcn, phzi, phzh, phzm, phzs, lasb, apra 1 (3.1%) 2 (6.3%) toxa, exot, exou, exoy, plcn, phzi, phzh, phzm, phzs, lasa, lasb, apra 1 (3.1%) 13 genes toxa, exos, exot, exoy, plch, plcn, phzi, phzii, phzh, phzm, phzs, lasa, apra 1 (3.1%) 5 (15.6%) toxa, exos, exot, exoy, plch, plcn, phzi, phzii, phzh, phzm, phzs, lasb, apra 1 (3.1%) toxa, exos, exot, plch, plcn, phzi, phzh, phzm, phzs, lasa, lasb, apra, pvda 1 (3.1%) toxa, exot, exou, exoy, plch, plcn, phzi, phzii, phzh, phzm, lasa, lasb, apra 1 (3.1%) toxa, exot, exou, exoy, plcn, phzi, phzii, phzh, phzm, phzs, lasa, lasb, apra 1 (3.1%) 14 genes toxa, exot, exou, exoy, plch, plcn, phzi, phzii, phzh, phzm, phzs, lasa, lasb, apra 5 (15.6%) 8 (25.0%) toxa, exos, exot, exoy, plch, plcn, phzi, phzii, phzh, phzm, phzs, lasa, lasb, apra 2 (6.3%) toxa, exos, exot, plch, plcn, phzi, phzii, phzh, phzm, phzs, lasb, pila, apra, pvda 1 (3.1%) 15 genes toxa, exos, exot, exoy, plch, plcn, phzi, phzii, phzh, phzm, phzs, lasa, lasb, apra, pvda 7 (21.9%) 9 (28.1%) toxa, exos, exot, exoy, plch, plcn, phzi, phzii, phzh, phzm, phzs, lasb, pila, apra, pvda 1 (3.1%) toxa, exos, exot, exoy, plcn, phzi, phzii, phzh, phzm, phzs, lasa, lasb, pila, apra, pvda 1 (3.1%) 16 genes toxa, exos, exot, exoy, plch, plcn, phzi, phzii, phzh, phzm, phzs, lasa, lasb, pila, apra, pvda 5 (15.6%) 5 (15.6%) 여내막을노출시키고, PlcN은내막에존재하는 phosphatidylserine 을가수분해함으로써, 2종류의 phospholipases 는상승작용을하고있다 [27]. Georgescu 등 [28] 은 plch 유전자만확인되었던루마니아의이전연구결과와달리, 혈액배양과상처부위로부터분리된 P. aeruginosa에서 plch와 plcn 유전자모두 84.6% 의높은빈도로확인된결과를보고하였다 년이란에서발표한 Faraji 등 [29] 은낭포성섬유증과화상감염을가진소아에서 P. aeruginosa의병독성인자를각각확인한결과, plch (87.7%, 79.0%) 와 plcn (60.0%, 63.1%) 유전자모두검출되었으며, 본연구에서도 plcn와 plch 유전자가 100% 와 84.4% 로확인되어, 이전연구보다높은결과를보였다. Phenazine 오페론 (phzi, phzii) 및유전자 (phzh, phzm, phzs) 는 P. aeruginosa에의해수동적으로분비되는 3 가지 phenazine 화합물의형성에관여하는전구단백질을암호화한다 [30]. 이러한 3가지 phenazine 화합물은 pyocyanin, 1-hydroxyphenazine, phenazine-1-carboxamide로써, 세포내산화스트레스를증가시키는원인이되고있으며, 2015년미국에서발표한 Goldufsky 등 [6] 은 P. aeruginosa 균주의 90% 이상이 pyocyanin 을생성함으로써만성폐감염에서관찰된폐조직손상에중요한역할을하는것으로보고하였다. 본연구에서는 5개의 phenazine 오페론및유전자가 84% 이상의높은빈도를보였으며, phzm 유전자가 32균주모두에서확인되었다. P. aeruginosa 감염에의한조직손상의또다른원인중하나는 type III secretion proteins로써, exo 유전자 (exos, exot, exou, exoy) 는 type III secretion systems의발현과분비에 관여하고있다 [31, 32]. Allydice-Francis 등 [33] 의연구에의하면, 대부분의많은 P. aeruginosa 균주들이여러 exo 유전자를동시에가지고있는것을보고하였다. 이와유사하게, 본연구에서는 exot 유전자가 96.9% 로가장높은빈도로확인되었고, 그다음으로 exoy 유전자가 84.4%, exos 유전자가 62.5%, exou 유전자가 37.5% 를보였으며, 1균주를제외한 31균주 (96.9%) 가 2개이상의 exo 유전자를가지고있었다. 이중 exou 유전자와 exos 유전자는유의한관계를보이는데, exou 유전자가확인된 12균주중 10균주는다제내성균 (83.3%) 인반면, exos 유전자가확인된 20균주중 16균주는다제내성이아닌균 (80.0%) 으로확인되었으며, 두유전자를모두가지고있는균주는한균주도확인되지않았다. 2019년이란에서발표한 Khodayary 등 [18] 은 exou 유전자의획득과항균제의높은내성에대한정확한기전은알려지지않았으나, exou 유전자의존재는 exos 유전자와비교하여항균제에대한내성이높다는점을확인하였고, 이러한결과는이란과한국, 인도, 호주등다른국가에서연구한결과와일치하였다. 그밖에 P. aeruginosa 는 lasa와 lasb 유전자가암호화하는 elastase 효소를가지고있는데, 이효소는사이토카인, 백혈구및방어세포를분해할수있으며, 폐와혈관조직의분해에중요한역할을하고있다 [34, 35]. 또다른병독성인자중하나로, apra 유전자가암호화하는 alkaline protease는각막염, 중이염, 낭포성섬유증및균혈증에서생성되며, 사이토카인, 보체, 인터페론및종양괴사인자와같이생물학적으로중요한단백질의가수분해에관여하고있다 [36]. 본연구에서 lasb와 lasa, apra 유전자는각각 96.9% 와
7 Korean J Clin Lab Sci. Vol. 51, No. 3, September %, 93.8% 의높은빈도로확인되었다. 또한, pyoverdine 생합성에관여하는 pvda 유전자는 50.0% 가확인되었으며, type IV pili의생합성에관여하는 pila 유전자는 25.0% 를보였고 pilb 유전자는한균주에서도검출되지않았다. 또한, 이전연구에서 Fazeli N 등 [2] 은다제내성 P. aeruginosa 균주에서병독성관련유전자의다양한범위와조합을확인하였다. 이와유사하게 32균주에서확인된 17개의세포관련및세포외병독성인자는 8개이상의유전자가다양한조합으로확인되었으며, 이중 15개의유전자를가지고있는 9균주 (28.1%) 는가장높은빈도로확인되었다. 2011년 3월부터 2012년 12월까지대전지역의 3차병원에서분리된 carbapenem 내성 P. aeruginosa를대상으로한항균제감수성결과, 43.8% 가다제내성균으로확인되었으며, 각항균제에대한내성율이 40% 이상을보임에따라다제내성으로의발달및확산, 항균제의선택과제한이심각한실정이다. 또한, 세포관련및세포외병독성인자의생성을확인한결과, 32 균주모두에서확인되었고 8개이상의유전자를가진다양한조합으로존재하는것을확인하였으며, 이중 exou 유전자와다제내성과의유의한관계를확인하였다 (P<0.001). 향후다제내성균에대한중요한예측마커로써활용되기위해 exou 유전자와다제내성균과의연관성에대한연구가지속적으로진행되어야할것으로사료된다. 요약다제내성 P. aeruginosa의출현과확산은전세계적으로중요한문제가되고있다. P. aeruginosa에의한발병은일부몇몇세포관련및세포외병독성인자의생성에기인한다. 본연구에서는대전지역의 3차병원에서분리된 carbapenem 내성 P. aeruginosa를대상으로병독성인자의분포와항균제내성양상을조사하였다. 항균제감수성시험은디스크확산법으로확인하였고, 병독성유전자의분석을위해 PCR과염기서열분석을수행하였다. 또한, 다제내성 P. aeruginosa의 sequence type (ST) 은 multilocus sequence typing (MLST) 을통해확인하였다. 32균주의 carbapenem 내성 P. aeruginosa 중, 14균주 (43.8%) 가다제내성이었으며, 주요 ST는 ST235 (10균주, 71.4.%) 임을확인하였다. 병독성유전자는 32균주모두에서확인되었고, 이중가장높은빈도로확인된병독성유전자는 toxa, plcn, phzm (100.%) 이었다. 또한, 32균주는모두 8개이상의병독성유전자를가지고있었으며, 9균주 (28.1%) 가 15개의병독성유전자를가지고있었다. exou 유전자는다제내성 P. aeruginosa 균주의 71.4% 에서확인되었다. 이러한결과는 exou 유전자가다제내성 P. aeruginosa 균주의지속성에대한예측표지자가될수있을것으로사료된다. Acknowledgements: None Conflict of interest: None Author s information (Position): Cho HH, Professor. REFERENCES 1. Kumari H, Balasubramanian D, Zincke D, Mathee K. Role of Pseudomonas aeruginosa AmpR on -lactam and non- -lactam transient cross-resistance upon pre-exposure to subinhibitory concentrations of antibiotics. J Med Microbiol. 2014;63: Fazeli N, Momtaz H. Virulence gene profiles of multidrug-resistant Pseudomonas aeruginosa isolated from Iranian hospital infections. Iran Red Crescent Med J. 2014;16:E Strateva T, Yordanov D. Pseudomonas aeruginosa - a phenomenon of bacterial resistance. J Med Microbiol. 2009;58: Lanotte P, Watt S, Mereghetti L, Dartiguelongue N, Rastegar- Lari A, Goudeau A, et al. Genetic features of Pseudomonas aeruginosa isolates from cystic fibrosis patients compared with those of isolates from other origins. J Med Microbiol. 2004; 53: Choy MH, Stapleton F, Willcox MD, Zhu H. Comparison of virulence factors in Pseudomonas aeruginosa strains isolated from contact lens- and non-contact lens-related keratitis. J Med Microbiol. 2008;57: / Goldufsky J, Wood S, Hajihossainlou B, Rehman T, Majdobeh O, Kaufman HL, et al. Pseudomonas aeruginosa exotoxin T induces potent cytotoxicity against a variety of murine and human cancer celllines. J Med Microbiol. 2015;64: Wolska K, Szweda P. Genetic features of clinical Pseudomonas aeruginosa strains. Pol J Microbiol. 2009;58: Kipnis E, Sawa T, Wiener-Kronish J. Targeting mechanisms of Pseudomonas aeruginosa pathogenesis. Med Mal Infect. 2006;36: Haghi F, Zeighami H, Monazami A, Toutouchi F, Nazaralian S, Naderi G. Diversity of virulenc egenes in multidrug resistant Pseudomonas aeruginosa isolated from burn wound infections. Microb Pathog. 2018;115: j.micpath Makedou KG, Tsiakiri EP, Bisiklis AG, Chatzidimitriou M, Halvantzis AA, Ntoutsou K, et al. Changes in antibiotic resistance of the most common Gram-negative bacteria isolated in intensive care units. J Hosp Infect. 2005;60: Tsukayama DT, van Loon HJ, Cartwright C, Chmielewski B, Fluit
8 308 Hye Hyun Cho. Virulence Factors of Carbapenem-Resistant Pseudomonas aeruginosa AC, van der Werken C, et al. The evolution of Pseudomonas aeruginosa during antibiotic rotation in a medical intensive care unit: the RADAR-trial. Int J Antimicrob Agents. 2004;24: Rossi Gonçalves I, Dantas RCC, Ferreira ML, Batistão DWDF, Gontijo-Filho PP, Ribas RM. Carbapenem-resistant Pseudomonas aeruginosa: association with virulence genes and biofilm formation. Braz J Microbiol. 2017;48: Khosravi Y, Tay ST, Vadivelu J. Analysis of integrons and associated gene cassettes of metallo- -lactamase-positive Pseudomonas aeruginosa in Malaysia. Med Microbiol. 2011;60: Cho HH. Molecular analysis of carbapenem-resistant Pseudomonas aeruginosa isolated from patients hospitalized in Daejeon between 2008 and 2014 year. Korean J Clin Lab Sci. 2018;50: Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; twentieth informational supplement, M100-S20. Wayne, PA: Clinical and Laboratory Standards Institute; Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012;18: /j x. 17. Finnan S, Morrissey JP, O'Gara F, Boyd EF. Genome diversity of Pseudomonas aeruginosa isolates from cystic fibrosis patients and the hospital environment. J Clin Microbiol. 2004;42: Khodayary R, Nikokar I, Mobayen MR, Afrasiabi F, Araghian A, Elmi A, et al. High incidence of type III secretion system associated virulence factors (exoenzymes) in Pseudomonas aeruginosa isolated from Iranian burn patients. BMC Res Notes. 2019;12: /s Samuelsen O, Toleman MA, Sundsfjord A, Rydberg J, Leegaard TM, Walder M, et al. Molecular epidemiology of metallo-beta-lactamase-producing Pseudomonas aeruginosa isolates from Norway and Sweden shows import of international clones and local clonal expansion. Antimicrob Agents Chemother. 2010;54: Cholley P, Thouverez M, Hocquet D, van der Mee-Marquet N, Talon D, Bertrand X. Most multidrug-resistant Pseudomonas aeruginosa isolates from hospitals in eastern France belong to a few clonal types. J Clin Microbiol. 2011;49: Hong JS, Yoon EJ, Lee H, Jeong SH, Lee K. Clonal dissemination of Pseudomonas aeruginosa sequence type 235 isolates carrying bla IMP-6 and emergence of bla GES-24 and bla IMP-10 on novel genomic islands PAGI-15 and 16 in South Korea. Antimicrob Agents Chemother. 2016;60: /AAC Wi YM, Choi JY, Lee JY, Kang CI, Chung DR, Peck KR, et al. Emergence of colistin resistance in Pseudomonas aeruginosa ST235 clone in South Korea. Int J Antimicrob Agents. 2017; 49: Kim D, Ahn JY, Lee CH, Jang SJ, Lee H, Yong D, et al. Increasing resistance to extended-spectrum cephalosporins, fluoroquinolone, and carbapenem in Gram-negative bacilli and the emergence of carbapenem non-susceptibility in Klebsiella pneumoniae: Analysis of Korean Antimicrobial Resistance Monitoring System (KARMS) data from 2013 to Ann Lab Med. 2017;37: Breidenstein EB, de la Fuente-Núñez C, Hancock RE. Pseudomonas aeruginosa: all roads lead to resistance. Trends Microbiol. 2011;19: Kerr KG, Snelling AM. Pseudomonas aeruginosa: a formidable and ever-present adversary. J Hosp Infect. 2009;73: Badr RI, Nagdy M, Sabagh A, Din AB. Pseudomonas aeruginosa exotoxin A as a virulence factor in burn wound infections. Egypt J Med Microbiol. 2008;17: Cotar AI, Chifiriuc MC, Banu O, Lazar V. Molecular characterization of virulence patterns in Pseudomonas aeruginosa strains isolated from respiratory and wound samples. Biointerface Res Appl Chem. 2013;3: Georgescu M, Gheorghe I, Curutiu C, Lazar V, Bleotu C, Chifiriuc MC. Virulence and resistance features of Pseudomonas aeruginosa strains isolated from chronic leg ulcers. BMC Infect Dis. 2016;16: Faraji F, Mahzounieh M, Ebrahimi A, Fallah F, Teymournejad O, Lajevardi B. Molecular detection of virulence genes in Pseudomonas aeruginosa isolated from children with cystic fibrosis and burn wounds in Iran. Microb Pathog. 2016;99: Jamunadevi S, Balashanmugam P, Muralitharan G, Kalaichelvan PT. Molecular characterization of pathogenic and non-pathogenic Pseudomonas aeruginosa with special reference to phenazine gene. J Mod Biotechnol. 2012;1: Galle M, Carpentier I, Beyaert R. Structure and function of the type III secretion system of Pseudomonas aeruginosa. Curr Protein Pept Sci. 2012;13: Hauser AR. The type III secretion system of Pseudomonas aeruginosa: infection by injection. Nat Rev Microbiol. 2009;7: Allydice-Francis K, Brown PD. Diversity of antimicrobial resistance and virulence determinants in Pseudomonas aeruginosa associated with fresh vegetables. Int J Microbiol. 2012;2012: Kruczek C, Kottapalli KR, Dissanaike S, Dzvova N, Griswold JA, Colmer-Hamood JA, et al. Major transcriptome changes accompany the growth of Pseudomonas aeruginosa in blood from patients with severe thermal injuries. PLoS One. 2016;11: E Islamieh DI, Afshar D, Esmaeili D. Effect of Satureja khuzistanica essential oil (SKEO) extract on expression of lasa and lasb genes in Pseudomonas aeruginosa. Iran J Microbiol. 2019;11: Andrejko M, Siemińska-Kuczer A, Janczarek M, Janik E, Bednarczyk M, Gagoś M, et al. Pseudomonas aeruginosa alkaline protease exhibits a high renaturation capability. Acta Biochim Pol. 2019;66: _2741.
< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770>
대한임상검사학회지 : 40권제2호, 75-79, 2008 ISSN 1738-3544 대구지역병원에서분리된 Acinetobacter baumannii와 Pseudomonas aeruginosa의항생제내성현황 대구보건대학임상병리과 1, 세명대학교임상병리학과 2 김수정 1 이재식 2 Antibiotic Resistance Patterns of Acinetobacter
untitled
ORIGINAL ARTICLE Korean J Clin Lab Sci. Vol. 45, No. 1, Mar. 2013 21 Korean J Clin Lab Sci. 2013, 45(1):21-25 ISSN 1738-3544 Errors of Antibiotic Susceptibility Testing from Automated and Manual Systems
untitled
210 Ji Youn Sung. PMQR Genes among CTX-M-14 Producing E. coli ORIGINAL ARTICLE Korean J Clin Lab Sci. 2016, 48(3):210-216 http://dx.doi.org/10.15324/kjcls.2016.48.3.210 pissn 1738-3544 eissn 2288-1662
ORIGINAL ARTICLE Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist
ORIGINAL ARTICLE http://dx.doi.org/10.15263/jlmqa.2015.37.4.209 Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resistance: MicroScan versus Etest Goeun Kang, Hyun Soo Kim,
386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
296 Korean J Lab Med 2010;30: S. maltophila 감염증치료에는낮은항균제내성률을보이는 trimethoprim/sulfamethoxazole (TMP/SMX) 이일차치료제로사용되고있으며, quinolone, moxalactam,
Korean J Lab Med 2010;30:295-300 DOI 10.3343/kjlm.2010.30.3.295 Original Article Clinical Microbiology Analysis of Acquired Resistance Genes in Stenotrophomonas maltophilia Jeong Hoon Song, M.D. 1, Ji
untitled
ORIGINAL ARTICLE Korean J Clin Lab Sci. 2017;49(4):427-434 https://doi.org/10.15324/kjcls.2017.49.4.427 pissn 1738-3544 eissn 2288-1662 Korean J Clin Lab Sci. Vol. 49, No. 4, December 2017 427 Distribution
untitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
untitled
Korean J Clin Microbiol Vol. 12, No. 1, March, 2009 Characterization of Class 1 Integrons in Metallo-βlactamase-producing Pseudomonas aeruginosa Ji Youn Sung, Sun Hoe Koo, Kye Chul Kwon, Jong Woo Park,
1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
Kang CI 문제가되고있는주요병원균으로는소위 ESKAPE 균주들 이있는데, 이는 Enterococci, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aerugino
DOI: 10.5124/jkma.2011.54.3.325 pissn: 1975-8456 eissn: 2093-5951 http://jkma.org Pharmacotherapeutics 다제내성그람음성균감염의치료전략 강철인 * 성균관대학교의과대학삼성서울병원감염내과 Therapeutic strategy for the management of multidrug-resistant
<B8F1C2F72E687770>
제1장 제17장 성홍열 및 사슬알균 감염증 사슬알균 (Streptococci)은 증식 중의 특징적으로 쌍 또는 사슬모양의 그람양성 알균 으로 catalase 음성, 통성혐기성균이며, 보통 한천배지에서는 발육이 어렵고 혈액이나 혈청 등을 첨가한 배지에서 잘 발육한다. 포도당이나 다른 탄수화물을 분해하나 포도당 을 분해하여 가스를 생성하지 않는다. 이들은 최소
1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
03(12-65)p fm
한국임상약학회지제 23 권제 1 호 Kor. J. Clin. Pharm., Vol. 23, No. 1. 2013 화상감염소아환자에서분리된주요균종에대한항생제의내성률 강주연 신혜순 * 덕성여자대학교약학대학 (2012 년 12 월 28 일접수 2013 년 3 월 2 일수정 2013 년 3 월 4 일승인 ) Antimicrobial Resistance of Clinically
03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
Can032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한
untitled
Korean J Clin Microbiol Vol., No., December, 20 http://dx.doi.org/0.55/kjcm.20...3 Chromosomal Mutations in oprd, gyra, and parc in Carbapenem Resistant Pseudomonas aeruginosa Ji Youn Sung, Hye Hyun Cho
KJFP Jeongsook Yoon. bla VIM-2 of Pseudomonas aeruginosa in primary hospitals in Korea Vitek(Biomerieux, Marcy 1 Etoile, France) 으로균을동정하였다. 항균제감수성검사는디
KJFPpISSN 2233-9019 eissn 2233-9116 Original Article 한국 1 차병원의 Pseudomonas aeruginosa 에서 blavim-2 유전자관찰 윤정숙 서울베스티안병원 bla VIM-2 of Pseudomonas aeruginosa in primary hospitals in Korea Jeong-sook Yoon Director
Lumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
<37375FB1E8C0E7C1DF2DC7F7BED7B9E8BEE7BFA1BCAD20BAD0B8AEB5C820C0D3BBF3C0FB2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 17, No. 5 pp. 653-659, 2016 http://dx.doi.org/10.5762/kais.2016.17.5.653 ISSN 1975-4701 / eissn 2288-4688 혈액배양에서분리된임상적주요균주의항균제사용량에따른내성률변화
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
KJFP Jeongsook Yoon. Bacterial Strains and Antimicrobial Resistance in Burn Patients 심부화상인경우 Clostridium, Bacteroides 등을감별하기위해무산소성배양을시행해야한다고권장하고있다. 6)
KJFP Original Article http://dx.doi.org/10.21215/kjfp.2016.6.3.179 pissn 2233-9019 eissn 2233-9116 화상창 감염의 균종 및 항균제 감수성률 윤정숙* 서울베스티안병원 진단검사의학과 Bacterial Strains and Antimicrobial Resistance of Wound Infection
DBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
<5BC0FAC0DABCF6C1A430355D434D30362D313320BEE7BAB4BCB12D E687770>
대한임상검사학회지 : 38 권제 3 호, 173-178, 2006 Multiplex Polymerase Chain Reaction 을이용한 Extended-Spectrum β-lactamase 생성 Klebsiella pneumoniae 균주의검출 진주보건대학임상병리과 양병선 Detection of Extended-Spectrum β-lactamase Producing
09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
DBPIA-NURIMEDIA
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic
04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
untitled
理 葉 CNFH-88-04 行 87 年 9 1 88 年 6 30 類 葉 Staphylococcus aureus Staphylococcus epidermidis Streptococcus mutans Streptococcus sanguis Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa Candida
03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
A 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
DBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
12_HM hwp
The Korean Journal of Microbiology (2010) Vol. 46, No. 3, pp. 303-307 Copyright c 2010, The Microbiological Society of Korea 단보 국내에서분리된 Acinetobacter baumannii 의 Integron 과연관된다제내성분석 김성환 최지혜 박은진 서인원 손승렬
미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
Drug-Resistant Bacteria: Tertiary Hospitals versus Smaller Medical Institutions resistant Pseudomonas aeruginosa (CRPA), carbapenem resistant Acinetob
Original Article Ewha Med J 2013;36(2):126-131 http://dx.doi.org/10.12771/emj.2013.36.2.126 pissn 2234-3180 eissn 2234-2591 전원온환자의의료기관별호흡기검체에서의균종류비교 김태형, 조경표, 이재성, 우용문, 성지석, 노창석 1 서울적십자병원내과, 1 서울특별시서남병원호흡기내과
2 - ceftazidime-clavulanate 디스크를이용하여 ESBL 생성균주를확인하였다. 또한 2009년도에수집된균주인 P. aeruginosa(386주 ), A. baumannii(349주 ) 를대상으로 imipenem에대한감수성을확인하였고 imipenem-h
1 - 국내종합병원을대상으로한항균제내성모니터링 Monitoring of antimicrobial resistance on general hospitals in Korea 질병관리본부국립보건연구원감염병센터약제내성과 연세대학교의과대학진단검사의학교실, 세균내성연구소 Ⅰ. 들어가는말 항균제내성세균의출현과확산으로인하여세균감염증치료는점점어려워지고있다 [1-4]. 항균제내성률은흔히국가간,
untitled
Korean J Clin Microbiol Vol. 13, No. 1, March, 2010 DOI: 10.5145/KJCM.2010.13.1.27 Carbapenem Resistance Mechanisms and Molecular Epidemiology of Acinetobacter spp. from Four Hospitals in Seoul and Gyeonggi
03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
untitled
Ann Clin Microbiol Vol., No., September, http://dx.doi.org/./acm... ISSN - Loss of bla and bla IMP- during the Storage of Gram- Bacilli, Antimicrobial Susceptibility of the Gene-Lost Strain, and Location
< D34312D303628BEE7BAB4BCB12CC0B0B1D9B5B9292E687770>
대한임상검사학회지 : 41권제4호, 153-157, 2009 ISSN 1738-3544 SHV ESBL 생성 Klebsiella pneumoniae 균주의실시간중합효소반응분석 진주보건대학임상병리과 1, 대전보건대학임상병리과 2 양병선 1 육근돌 2 Real-Time PCR Analysis of SHV Extended-Spectrum beta-lactamases
232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특
한국도시행정학회 도시행정학보 제25집 제4호 2012. 12 : pp.231~251 생활지향형 요소의 근린주거공간 분포특성 연구: 경기도 시 군을 중심으로* Spatial Distribution of Daily Life-Oriented Features in the Neighborhood: Focused on Municipalities of Gyeonggi Province
歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
untitled
ORIGINAL ARTICLE Korean J Clin Lab Sci. 2016, 48(3):217-224 http://dx.doi.org/10.15324/kjcls.2016.48.3.217 pissn 1738-3544 eissn 2288-1662 Korean J Clin Lab Sci. Vol. 48, No. 3, September 2016 217 An Analysis
Microsoft PowerPoint - PDFCoTemp.PPT
주요유방염세균의검출및 항생제감수성검사 임숙경 1. 검사시료 1. 시료채취 유방염우유 2. 체세포수측정 3. 대상세균 - Staphylococcus aureus - Coagulase negative staphylococci -Escherichia coli 3. 균분리방법 E. coli CHEC Agar 직접도말 (37 18-24h) 보라색집락 EMB Agar
Çмúº¸°í6ÇÏÇý¹Î
병원약사회지 (27), 제 34 권제 4 호 J. Kor. Soc. Health-syst. Pharm., Vol. 34, No. 4, 433 ~ 442 (27) Original Article 국내지역사회획득폐렴원인균의경험적항균제에대한내성현황 하혜민 a, 김윤숙 b, 안정미 c, 천부순 a, 인제대학교약학대학 a, 인제대학교해운대백병원약제부 b, 인제대학교상계백병원약제부
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)
약수터2호최종2-웹용
Contents 06 08 11 14 17 17 18 19 23 28 28 33 37 41 45 45 51 56 59 64 66 72 80 26 29 31 34 35 35 38 39 40 42 43 43 46 46 47 49 50 51 52 53 54 56 57 59 60 61 62 69 73 74 77 78 79 14 15 25 36 48 06 07 08
012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
한수지 49(5), , 2016 Original Article Korean J Fish Aquat Sci 49(5), ,2016 창선해역의지중해담치 (Mytilus galloprovincialis) 양식장및육상오염원에서분리한대장균 (Escheri
한수지 49(5), 564-572, 2016 Original Article Korean J Fish Aquat Sci 49(5),564-572,2016 창선해역의지중해담치 (Mytilus galloprovincialis) 양식장및육상오염원에서분리한대장균 (Escherichia coli) 의항생제내성 권순재 이가정 * 정연중 박상기 고경리 양지혜 목종수 국립수산과학원남동해수산연구소
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
..........5-45..
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals
석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
DBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
특허청구의 범위 청구항 1 앵커(20)를 이용한 옹벽 시공에 사용되는 옹벽패널에 있어서, 단위패널형태의 판 형태로 구성되며, 내부 중앙부가 후방 하부를 향해 기울어지도록 돌출 형성되어, 전면이 오 목하게 들어가고 후면이 돌출된 결속부(11)를 형성하되, 이 결속부(11
(51) Int. Cl. (19) 대한민국특허청(KR) (12) 등록특허공보(B1) E02D 29/02 (2006.01) E02D 17/20 (2006.01) E02B 3/14 (2006.01) (21) 출원번호 10-2010-0089517 (22) 출원일자 2010년09월13일 심사청구일자 (56) 선행기술조사문헌 JP2006037700 A* KR100920461
<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>
J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2
°Ç°�°úÁúº´5-44È£ÃÖÁ¾
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis
???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
(59-69)Kjcm13.hwp
Korean J Clin Microbiol Vol. 10, No. 1, April, 2007 Antimicrobial Resistance of Clinically Important Bacteria Isolated from 12 Hospitals in Korea in 2005 and 2006 Hyukmin Lee 1, Chang Ki Kim 2, Jongwook
Table 1. Allelic profiles of 194 C. jejuni analyzed in this study Gene locus Fragment length (bp) No. of alleles No. of polymorphic sites (%) Ave. p d
연구논문, Research article 국내설사환자분리캄필로박터제주니의유전형분석 질병관리본부감염병분석센터세균분석과정수미, 강병학, 홍사현, 김재옥 * * 교신저자 : kimjo70@korea.kr, 043-719-8110 Genetic analysis of Campylobacter jejuni isolates from diarrheal patients in
84 계명의대학술지제 31 권 1 호 2012 μg /ml). Isolation frequency of MDRAB strains was 97.7% (172 strains) and was highly prevalent. Fifty eight (33.0%) strains
계명의대학술지제 31 권 1 호 Keimyung Med J Vol. 31, No. 1, June, 2012 다약제내성 Acinetobacter baumannii 의 유병율과항균제감수성 계명대학교의과대학미생물학교실, 의과학연구소 서성일 백원기 서민호 High Prevalence and Antimicrobial Drug Susceptibility of Multidrug
A. baumannii 와 P. aeruginosa 의 ESBL 생성현황 15 인하여광범위 -lactam 제제일부를포함한여러항균제에내재적내성이지만, ceftazidime, piperacillin, ticarcillin 등은이들세균에비교적강한항균력을지닌다 [3]. Cla
대한진단검사의학회지제 26 권제 1 호 2006 Korean J Lab Med 2006;26:14-20 원저 임상미생물학 임상검체에서분리된 Acinetobacter baumannii와 Pseudomonas aeruginosa의 Class A Extended-Spectrum -Lactamase 생성현황 오세진 이상욱 황현용 1 배일권 1 조현수 1 이병호 1
09구자용(489~500)
The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal
433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
http://www.kbc.go.kr/pds/2.html Abstract Exploring the Relationship Between the Traditional Media Use and the Internet Use Mee-Eun Kang This study examines the relationship between
2101
대한진단검사의학회지제 28 권제 3 호 2008 Korean J Lab Med 2008;28:185-90 DOI 10.3343/kjlm.2008.28.3.185 원저 임상미생물학 Escherichia coli, Klebsiella spp., Proteus mirabilis에서 Phoenix Automated Microbiology System의 Extended-Spectrum
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 28(3),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2017 Mar.; 28(3), 163 169. http://dx.doi.org/10.5515/kjkiees.2017.28.3.163 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) PCB
untitled
Korean J Clin Microbiol Vol. 11, No. 2, October, 2008 Characteristics of Acquired β-lactamase Gene in Clinical solates of Multidrug-resistant Pseudomonas aeruginosa un Yang Chung 1, Ji Youn ung 2, Kye
-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
<353420B1C7B9CCB6F52DC1F5B0ADC7F6BDC7C0BB20C0CCBFEBC7D120BEC6B5BFB1B3C0B0C7C1B7CEB1D7B7A52E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 13, No. 2 pp. 866-871, 2012 http://dx.doi.org/10.5762/kais.2012.13.2.866 증강현실을 이용한 아동교육프로그램 모델제안 권미란 1*, 김정일 2 1 나사렛대학교 아동학과, 2 한세대학교 e-비즈니스학과
untitled
대한내과학회지 : 제 72 권제 1 호 27 Streptococcus pneumoniae와 Haemophilus influenzae 임상분리주에대한 Cefditoren의시험관내항균력 인제대학교의과대학일산백병원감염내과, 울산대학교의과대학서울아산병원감염내과 2, 울산대학교항균제내성ㆍ미생물유전학연구센터 3 곽이경 추은주 2, 3 박수진 3 이정은 3 정진용 2,
878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
A Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
Kor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on
- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
歯49손욱.PDF
2002 14 C Inventory An Estimation of 14 C Inventory on Each Unit of Wolsong NPP,,, 103-16 14 C 14 C Inventory 14 C Inventory 14 C 14 C, [Inventory] = [ 14 C ] - [ 14 C ] 14 C 14 C 13 C, 14 N 17 O [ 13
<C7D1B1B9B1B3C0B0B0B3B9DFBFF85FC7D1B1B9B1B3C0B05F3430B1C733C8A35FC5EBC7D5BABB28C3D6C1BE292DC7A5C1F6C6F7C7D42E687770>
기혼 여성이 사이버대학에서 상담을 전공하면서 겪는 경험 방기연 (고려사이버대학교 상담심리학과 부교수) * 요 약 본 연구는 기혼 여성의 사이버대학 상담전공 학과 입학에서 졸업까지의 경험을 이해하는 것을 목적으로 한 다. 이를 위해 연구참여자 10명을 대상으로 심층면접을 하고, 합의적 질적 분석 방법으로 분석하였다. 입학 전 에 연구참여자들은 고등교육의 기회를
1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.
400 김정민 신경섭 집락을쉽게형성하여장기입원환자나비뇨기계질환이있는노인에서흔히감염을일으킬수있다 [2, 3]. P. rettgeri는 P. stuartii보다 aminoglycoside, cephalosporin 및페니실린계항균제에대한내성률이낮으며, 다제내성인경우도드물다
대한진단검사의학회지 : 제 25 권제 6 호 2005 Korean J Lab Med 2005; 25: 399-405 임상미생물학 요검체에서분리된 Providencia rettgeri 에서 VIM-2형 Metallo- -Lactamase의생성 김정민 신경섭 1 경북대학교의과대학미생물학교실, 충북대학교의과대학진단검사의학교실 1 Production of VIM-2
<303120C6AFC1FD20B9E8C7F6C1D62E687770>
대한내과학회지: 제 81 권 제 6 호 2011 특 집(Special Review) - 흔한 감염질환에서의 항생제 내성 및 최신 치료 지역사회 단순 요로감염에서의 항생제 내성 및 최신 치료 한양대학교병원 감염내과 배 현 주 Treatment of Community-Acquired Uncomplicated Urinary Tract Infection Hyunjoo
<30382EC0C7C7D0B0ADC1C22E687770>
대한내과학회지: 제 76 권 제 2 호 2009 의학강좌-개원의를 위한 모범처방(Current Clinical Practice) 간기능검사의 이해와 적용 인제대학교 의과대학 일산백병원 내과학교실 김 경 아 Understanding and application of liver function tests Kyung-Ah Kim, M.D. Department of
untitled
Ann Clin Microbiol Vol. 19, No. 2, June, 2016 http://dx.doi.org/10.5145/acm.2016.19.2.48 pissn 2288-0585 eissn 2288-6850 Distribution and Antimicrobial Resistance of Streptococcus pneumoniae at Four University
Trd022.hwp
김신태, 이선녕, 이석정, 정필문, 박홍준, 신명상, 김종환, 이부길, 김상하, 리원연, 신계철, 용석중 Shin-Tae Kim, M.D., Shun Nyung Lee, M.D., Seok Jeong Lee, M.D., Pil Moon Jung, M.D., Hong Jun Park, M.D., Myung Sang Shin, M.D., Chong Whan Kim,
04김호걸(39~50)ok
Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*
7.ƯÁýb71ÎÀ¯È« š
J KMA Special Issue Myelodysplastic Syndrome June Won Cheong, MD Yoo Hong Min, MD Department of Internal Medicine, Yonsei University College of Medicine E mail : jwcheong70@yumc.yonsei.ac.kr minbrmmd@yumc.yonsei.ac.kr
<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
<31335FB1C7B0E6C7CABFDC2E687770>
에너지기후변화교육 4(2):203~211(2014) 203 초등학교 교과서 에너지 단원의 탐구활동과 시각자료 기능 분석 사례 연구 신명경 권경필 * 경인교육대학교 Abstract : This study aimed to analyze energy related inquiry activity and visual materials in elementary textbook.
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jun.; 27(6),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Jun.; 27(6), 495 503. http://dx.doi.org/10.5515/kjkiees.2016.27.6.495 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Design