<C6EDC1FD2D32382D34C8A32DBEC8C0CCBAF1C0CEC8C4B0FAC7D0C8B8C1F62E687770>
|
|
- 우빈 우
- 7 years ago
- Views:
Transcription
1 J Korean Med Ophthalmol Otolaryngol Dermatol 2015;28(4):51-61 pissn eissn Original Article / 원저용담화에탄올추출물의항염증효과에관한연구 최형욱 1 인명희 2 리순화 3 김은주 4 임규상 1,6 우원홍 5,6* 1 원광대학교한의학전문대학원한약자원개발학과, 2 원광대학교한의학전문대학원 BK21-plus 팀, 3 건국대학교교육대학원미용교육학과, 4 열린사이버대학교뷰티건강디자인학과, 5 원광대학교한의과대학해부학교실, 6 원광대학교한국전통의학연구소 Study on Anti-inflammatory Effect of Ethanol Extract of Gentianae sino-ornata Hyung-Wook Choi 1 Myung-Hee In 2 Shun-Hua Lee 3 Eun-Joo Kim 4 Kyu-Sang Lim 1,6 Won-Hong Woo 5,6* 1 Dept of Herbal Resources, Professional Graduate School of Oriental Medicine, Wonkwang 2 BK21-plus Team, Professional Graduate School of Oriental Medicine, Wonkwang University 3 Dept. of Beauty Education, Graduate School of Education, Konkuk University 4 Dept of Beauty Health Design, Open Cyber University 5 Dept. of Anatomy, College of Oriental Medicine, Wonkwang University 6 Research Center of Traditional Korean Medicine, Wonkwang University Abstract Objective : This research has been conducted to comparative analysis of anti-inflammatory effects to suggest a usefulness of ethanol extracts from Gentianae sino-ornata (GSO) as a functional material for inflammatory activities. Methods : Cell viability was measured by neutral red (NR) assay, and nitric oxide (NO) production in RAW264.7 cells was monitored by measuring the nitrite content in culture medium. The expressions of cyclooxigenase-2 (COX-2) was determined by western blot analysis, and Inducible nitric oxide syntase (inos) and cytokine were determined by reverse transcriptase-polymerase chain reaction (RT-PCR). Results : When the GSO extract was added the concentration of 5-20 μg / μl, the viability of cells was maintained 90% or more at all levels. NO production was suppressed by the treatment of GSO in LPS-stimulated RAW264.7 cells. GSO inhibited the expression of inos, COX-2, IL-1β and IL-6 in LPS-stimulated RAW264.7 cells. Conclusions: From this results, we consider that GSO can be a useful therapeutic and preventive approach to various inflammatory diseases as a functional material for inflammatory activities. Key words : Gentuanae sino-ornata; LPS; COX-2; inos; IL-6 c 2015 the Society of Korean Medicine Ophthalmology & Otolaryngology & Dermatology This is an Open Access journal distributed under the terms of the Creative Commons Attribution Non-Commercial License ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. 51
2 Ⅰ. 서론 염증반응이란체내에외부로부터물리적, 화학적자극이나세균감염에대해면역세포가이를인지하여다양한염증매개물질을분비함으로써손상된조직을수복하거나재생하려는기전이다 1). 이과정은 Lipopolysaccharide(LPS) 와같은외부자극원또는 arachidonic acid 대사체같은내부자극원들을주요매개로하여 macrophages, granulocytes, fibroblasts 와같은염증성세포의염증부위로의유입과축적을주요특징으로한다 2). 그러나지속적으로또는과도하게발생된만성염증반응은조직의손상을유발하며이와관련한 Reactive oxygen species(ros) 와염증성 cytokine은내독소자극을포함한다양한질병의매개체로써중요한역할을한다 3). 특히염증반응은치매, 심혈관질환, 암, 비만, 대사성증후군등의만성질환의원인이되고 4), 이는염증반응을촉진하는인자들과신호달경로가염증반응뿐아니라만성질환에도깊숙이관여하고있기때문이며 5) 따라서염증반응을억제하는물질은만성질환을예방하거나억제하기위한기능성물질로사용될가능성이높다고볼수있다. 현재사용하고있는대부분의항염증제들은장기복용할경우출혈성소화관궤양, 신장기능저하및혈압상승등의부작용과함께심근경색및혈전형성등의순환계질환도유발할수있다는것이보고되었으며 6) 이에따라효능과안전성이우수한새로운항염증제의개발에대한관심이한층더높아졌으며천연물을이용한항염증제개발을위한많은연구들이수행되었다 7-10). 용담초 (Gentiana scabra Bunge) 는다년생초본으로용담의꽃을용담화 (Gentiana sino-ornata) 라고한 Corresponding author : Won Hong Woo, Department. of Anatomy, College of Oriental Medicine, Wonkwang University, 344-2, Sinyong-dong, Iksan-si, Jeollabuk-do, Korea(Tel : , whwoo@wku.ac.kr) Recieved 2015/9/24 Revised 2015/10/26 Accepted 2015/11/4 다. 한방에서사용되는뿌리의성미 ( 性味 ) 는고한 ( 苦寒 ) 으로간담 ( 肝膽 ) 의실화 ( 實火 ) 를사 ( 瀉 ) 하고청열 ( 淸熱 ), 조습 ( 燥濕 ), 하초 ( 下焦 ) 의습열 ( 濕熱 ) 을제거하는효능이있어두통, 협통 ( 脇痛 ), 습진, 피부및음낭소양 ( 搔痒 ), 황달, 만성위장질환에사용하며 11), 대장간균, 백선균, 피부진균에대하여억제작용이있는것으로알려져있다 12). 용담은 secoridoid 배당체를함유하고있는식물로서, 용담이가지는항염증효과에관한것으로는 Gentiana scabra Bunge에서분리된 5-(hydroxymethy1)-2-furfural 가 LPS로활성화시킨 RAW264.7 세포에서농도의존적으로 NO생성을저하시킨다는것을확인하였으며 gentiopicroside가 carrageenin 으로유발시킨흰쥐족적부종시험에있어서항염증효과가있고 13,14) 한방에서는용담이가지는차가운성질로인하여열을내리고염증을억제하는작용이있으며, 위와장의운동기능을항진시키고소화액의분비를촉진하는성질이있는것 15) 으로보고되었다. 본연구에서는항염증효과가우수한제품을개발하기위한기초연구의일환으로용담화추출물을처리한 RAW264.7 세포에 LPS를처리한후 COX 2와 inos 발현및전염증성 cytokines 들의생산량을조사하여 in vitro에서용담화추출물의항염증효과를조사하였다. Ⅱ. 재료및방법 1. 실험재료 1) 약재본연구에서실험에사용된용담화 (Gentiana sino ornata) 는중국티벳중약점 ( 西藏拉萨市藏源中药材公司 ) 에서구입하여사용하였다. 52
3 최형욱외 5 인 : 용담화에탄올추출물의항염증효과에관한연구 2) 시약 Dulbecco's modified Eagle's medium (DMEM), fetal bovine serum (FBS), penicillin, phosphate buffered saline solution (PBS), lipopolysaccharide (LPS), formaldehyde, Tween 20, Blocking buffer (BSA), Griess reagent, p-nirophenylphosphate (pnpp), diethyl pyrocarbonate (DEPC) 는 Sigma사 (St. Louis, MO, USA) 제품을, trizol reagent는 Invitrogen 사 (USA) 제품을, chloroform, isopropanol는 Biopure사 (Canada) 제품을, inos, IL-1β, IL-6 primer는 Bioneer사 (Korea) 제품을, trizol reagent 는 intron 사 (Biotechnology, Korea) 제품을, western blotting detection reagent는 Thermo 사 (USA) 제품을 M-MLV reverse transcriptase (Enzynomics, Korea), Acco Power Hot Start PCR premix 은 Bioneer사 (Korea) 제품을, super signal west pico solution은 Pierce사 (USA) 제품을, protease inhibitor cocktail 은 Roche 사 (Switzerland) 제품을, anti-cox-2 primary antibody 는 Cell signaling Tech사 (Beverly, Ma, USA) 제품을구입하여사용하였다. 3) 사용기기원심분리기는 Hanil 사 (Science Industrial, Korea) 제품을, clean bench는동의과학사 (Korea) 제품을, CO 2 incubator 는 Samyo 사 (Japan) 제품을, microplate reader 는 Synergy-HT 사 (BIO-TEK instruments, USA) 제품을, 감압농축기는 Eyela 사 (Japan) 제품을, icycler Q system 은 Bio-Rad사 (USA) 제품을, Nanodrop은 Nanodrop사 (USA) 제품을, ultraviolet transilluminator 는 Htech 사 (Korea) 제품을, 자동현상기는 QX-130II사 (Konica) 제품을사용하였다. 4) 세포주실험에사용된세포주인 RAW264.7 macrophage 는한국세포주은행 (Korea) 에서구입하여사용하였다. 2. 실험방법 1) 시료추출용담화는각시료중량에 10배의 95% 에탄올을가하여상온에서 72시간방치하고그추출액을 9,000 rpm으로 15분간원심분리하여얻은상층액을여과지 (Whatman No. 2) 로여과한후필터링한다음감압농축하여 3일동결건조한후그분말을본실험에사용하였다. 2) 세포배양분양받은 RAW264.7 macrophage 세포는 10% FBS, 1% antibiotic-antimycotic을첨가한 DMEM을사용하여 37, 5% CO 2 배양기에서배양하였다. 3) 세포생존율측정실험에서사용된시료의세포독성을나타내는농도범위는 neutral red (NR) assay 를이용하여확인하였다 16). 연구에사용한세포주는 RAW264.7 세포를사용하였으며, 96 well plate 에 well 당 3 10⁴세포로분주하여 24시간동안전배양하였다. 세포가 well plate에충분히부착된것을확인한후무혈청배지를이용하여용담화를 5, 10, 20, 50, 100 μg / ml로농도별로첨가하고 48시간동안 37, 5% CO 2 배양기에서배양하였다. 배양한세포는배양액을 NR solution이 1% 포함된무혈청배지로교환하여 3시간배양한다음현미경으로 NR의결정화유무를확인하였다. Formaldehyde 용액 10% 가첨가된 phosphate buffered saline (PBS) 을각 well에 100 μl로 20분처리하여세포를고정하였다. NR desorb solution (1% glacial acetic acid, 49% ethanol, 50% distilled water) 을각 well에 100 μl분주하여세포내의 NR을추출하고 540 nm에서흡광도를측정하였다. 세포생 53
4 존율은아래의식에따라계산하였다. 세포생존율 (%) = 시료첨가군흡광도 100 시료무첨가군흡광도 4) Nitric oxide (NO) 생성저해능측정 용담화추출물이 RAW264.7 세포배양에서 NO 생성에미치는영향을측정하기위해 Green 등의방법 17) 에따라세포배양액내 NO 양을 nitrite (NO - 2 ) 와 nitrate (NO - 3 ) 형태로측정하였다. RAW264.7 세포를 96 well plate 에 5 10⁴/well로분주하고 24시간동안전배양후배지를제거하고 LPS가 1 μg / ml이포함된무혈청배지에용담화를 1.25, 2.5, 5, 10, 20 μg / ml의농도별로가하여 48시간동안후배양하였다. 새로운 96 well plate 에배양된세포배양상층액 100 ml와 Griess reagent 100 ml을첨가하여차광된상태에서 10분간반응시키고 540 nm에서흡광도를측정하였으며 LPS 처리군과비교하여백분율로표시하였다. NO 생성저해능 (%) = 시료첨가군의 O.D. at 540 nm 100 시료무첨가군의 O.D. at 540 nm 5) 역전사중합효소연쇄반응 (Reverse transcription polymerase chain reaction, RT-PCR) 용담화추출물이 RAW264.7 세포내의염증사이토카인인 inos, IL-1β, IL-6 의발현억제효과를확인하기위하여 RT-PCR 을수행하였다. 1 RNA 추출단계 LPS 1 μg / ml와용담추출물 5, 20 μg / ml로처리된 RAW264.7 세포를수거한후 phenol 성분이첨가된 trizol reagent 를이용하여 RNA를추출하였다. 수거한 RAW264.7 세포가들어있는 tube에 1 ml trizol reagent를넣고현탁한 후상온에 5분간반응시켜세포를용해하였다. 여기에 0.2 ml chloroform (Biopure, Canada) 을첨가하고강하게 15초간흔들어준뒤 3분간상온에서반응시킨후 12,000 rpm, 4 의조건에서 20분간원심분리를실시하여단백질을포함하는하단부의 phenol층과 RNA를포함하는상단부의수용성층으로분리하였다. 상단부의수용성층만수거하여 0.5 ml isopropanol (Biopure, Canada) 을첨가하고상온에 10분간반응시킨후 12,000 rpm, 4 에서 15분간원심분리를실시하여 RNA를침전시켰다. 침전된 RNA는 75% ethanol로세척한후 ethanol 성분을제거하고상온에서건조하였다. 건조된 RNA는 DEPC water 로녹여실험에사용하였으며추출된 RNA는순도확인을위해 Nanodrop (Nanodrop, USA) 을이용하여 260/280 nm의파장에서흡광도를측정후 260/280 nm의 ratio를확인하여사용하였다. 비율이 1.8 이상이면단백질이함유되지않은것이기때문에비율 1.8 이상의 RNA만을실험에사용하였다. 2 cdna 합성및 polymerase chain reaction 단계 cdna 는 1 μg의 RNA를대상으로 M-MLV reverse transcriptase (Enzynomics, Korea) 을사용하여제조하였다. 1 μg RNA와 0.5 μg oligo dt 18 μg에 DEPC water 를첨가한 10 μl의용액을 70 에서 10분간반응시켜 RNA를 denaturation 시킨후여기에 buffer, 10 mm dntp, 200 unit/ μl reverse transcriptase 를첨가하여 37 에서 1시간반응시켜 cdna를제조하여실험에사용하였다. 확보한 cdna 는 Acco Power Hot Start PCR premix (Bioneer, Korea) 와 inos, IL-1β, IL-6 primer 를혼합하여총 volume 이 20 μl가되도록 DEPC 처리된 water 로조정한후실행하였다. PCR 은 icycler Q system (Bio-Rad, 54
5 최형욱외 5 인 : 용담화에탄올추출물의항염증효과에관한연구 USA) 로수행하였고 PCR products 는 ethidium bromide (EtBr) 이포함된 1.5% agarose gel에서전기영동을시행한후 ultraviolet transilluminator (Htech, Korea) 로확인하였다. 본연구에사용한 primer 는 housekeeping 유전자인 β-action 유전자를사용하였다 (Table 1). 6) Western blot 분석용담화추출물이 COX-2 발현에미치는영향을확인하기위하여 Western blot 방법을이용하여단백질발현양을측정하였다. LPS 처리에의하여활성화된 RAW264.7 세포에용담화추출물을 5, 20 μg / μl의농도로처리하고 3시간배양한세포를수거하여 PBS 로세척후 RIPA buffer (50 mm Tris-Cl (ph 7.5), 50 mm NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, proteaseinhibitor cocktail (Roche, Switzerland)) 로 30분간용해시킨후 12,000 rpm, 4 에서 30분간원심분리하여상등액을회수하였다. 회수된상등액은 SDS sample buffer (60 mm Tris (ph 6.8), 14.4 mm 2-mercaptoethanol, 25% glycerol, 2% SDS, 0.1% bromo-phenol blue) 를첨가하고 100 에서 5분간 denaturation 시킨후단백질을 SDS-PAGE 로분자량별로분리하였다. 분리된단백질은 100 V의조건에서 1시간동안 nitrocellulose membrane (Whatman, UK) 으로전이 시키고 0.1% BSA 용액으로 blocking 시킨후 membrane 을 anti-cox-2 primary antibody 용액에담가 4 에서 18시간반응시켰다. TBS/T (10 mm Tris-Cl (ph 7.5), 150 mm NaCl, 0.2% Tween 20) 로 5분씩 3회세척하였다. 세척된 membrane 을화학적형광을낼수있는 horse radish peroxidase (HRP) 가결합되어있는 anti-mouse IgG antibody 용액에담가상온에서 2시간처리후다시 TBS/T 로 5분씩 3회세척하였다. 이차항체가처리된 membrane 은 super signal west pico solution (Pierce, USA) 을처리하고암실에서실험용필름 (Konica, Japan) 으로덮어필름에감광을유도한후자동현상기 (QX-130II, Konica) 를이용하여현상하였다. 현상된필름상에있는단백질 band는 densitometer program 인 Image J (NIH, USA) 를이용하여 band 크기의변화를측정하였다. 7) 통계처리모든실험은 3회반복하였으며, 분석수치는 Mean ± S.D로표시하였고SPSS (Statistical Package for the Social Science) WIN 17.0 프로그램을이용하였으며통계분석은 ANOVA Test 에의해분석하였다. 통계적유의성은 *p<0.01, **(##)p<0.001로표기하여유의성의차이가있는것으로판단하였다. Table 1. Lists of Primers Used in This Study Gene Forward primer Reverse primer inos CCCTTCCGAAGTTTCTGGCAGCAGC GGCTGTCAGAGCCTCGTGG CTTTGG IL-1β CAGGATGAGGACATGAGC CTCTGCAGACTCAAACTCCA ACC C IL-6 GTACTCCAGAAGACCAGA GG TGCTGGTGACAACCACGGCC β-actin GTGGGCCGCCCTAGGCACC GGAGGAAGAGGATGCGGCAG AG T 55
6 Ⅲ. 실험결과 1. Neutral Red (NR) 에의한세포생존율측정 1) RAW264.7 세포에서세포생존율 RAW264.7 세포에용담화에탄올추출물의세포독성을알아보기위해 5, 10, 20, 50, 100 μg / μl로농도별로처리하여 48시간동안배양한후 NR assay 를수행하였다. 용담화추출물의세포생존율을측정한결과세포에에탄올추출물을 5-20 μg / μl의농도로첨가하였을때, 추출물은대체로모든농도에서 90% 이상의생존율을유지하였다. 그러나농도가 μg / μl에서는세포의생존율이현격히줄어드는것을확인할수있다. 따라서향후실험은 20 μg / μl이내에서실시하였다 (Fig. 1). 5, 10, 20 μg / μl의농도로처리하였을때, LPS 처리군에비해농도의존적으로 NO 생성이억제되는것으로나타났다 (Fig. 2). 특히용담화추출물 20 μg / μl의농도에서 NO 생성이 80% 이상억제되는것으로나타나항염작용이매우우수한것으로나타났다. Fig. 2. Effect of Gentianae sino-ornata extract on NO production in RAW264.7 cells. RAW264.7 cells were treated with LPS (1 μg / μl ) and combined with GSO for 48h. Nitrite was measured by Griess reagent. The results were expressed as the average of triplicate samples with S.D. ##p<0.001 compared with control, and *p<0.01, **p<0.001 compared with LPS treated group. 3. 세포내 Cyclooxygenase-2 (COX-2) 발현저해능 Fig. 1. Effect of Gentianae sino-ornata extract on cell viability in RAW264.7 cells. Cells were plated at 3 10⁴cells/well and incubated in media containing from 5 to 100 μg / μl for 48 hours. Cell viabilities were measured by NR assay as described in materials and methods. The results were expressed as the average of triplicate samples with S.D. *p<0.01, **p<0.001 compared with control. 2. NO 생성억제효과 용담화에탄올추출물을이용하여 RAW264.7 cell 에서 LPS에의해유도되는 NO의생성을억제시키는지의여부를평가한결과용담화추출물 1.25, 2.5, 용담화추출물이 NO 생성과관련된주요효소인 COX-2 발현에미치는영향은 Western blot 분석으로조사하였다. 실험결과 RAW264.7 세포에서 LPS 를첨가하면 COX-2 의발현이증가하였고, 용담화추출물 5, 20 μg / μl의농도에서농도의존적으로감소하는경향을나타냈다 (Fig. 3). 이상의결과용담화추출물은 RAW264.7 세포에서 COX-2의발현을억제하여 NO 생성을감소시키는것으로보인다. 56
7 최형욱외 5 인 : 용담화에탄올추출물의항염증효과에관한연구 Fig. 3. Effect of Gentianae sino-ornata extract on protein expression level of COX-2 in RAW264.7 cells. RAW264.7 cells are treated with LPS (1 μg / μl ) and combined with Gentiane sino-ornata (GSO) extract. Cells were lysed and cellular proteins were then separated by SDS-PAGE, followed by Western blot analysis using antibody against COX-2. Actin was used as an internal control. Fig. 4. Effect of Gentianae sino-ornata extract on inos, IL-1β and IL-6 mrna expressions in RAW264.7 cells. RAW264.7 cells are treated with LPS (1 μg / μl ) and combined with Gentiane sino-ornata (GSO) extract. After 24 hours, cells were analyzed using RT-PCR as described in marerials and methods. 4. 세포내 inos 및 cytokine 발현억제능 용담화추출물이 NO 생성과관련된효소인 inos 와염증사이토카인인 IL-1β 및 IL-6의 mrna 발현에미치는영향은 RT-PCR을수행하여조사하였다. 실험결과 RAW264.7 세포에서 LPS 처리시 inos 의발현이현저히증가하였고, 또한용담화추출물 20 μg / μl의농도에서다소감소하였다. IL-1β와 IL-6는용담화추출물 20 μg / μl농도에서감소하는경향을나타냈으나그효과는크지않았다 (Fig. 4). 이상의결과용담화추출물은 RAW264.7 세포에서 inos, IL-1β 와 IL-6의발현을억제하여 NO 생성을감소시키는것으로사료된다. Ⅳ. 고찰염증반응 (inflammation) 은세균및바이러스등의미생물들과생체이물질들에의해활성화된면역세포혹은염증매개인자 (pro-inflammatory mediators) 들의발현에서부터시작되며, 병원균들의감염, 화학적자극및상처등과같은외부자극에대한생체조직의방어기작이다 18). Macrophages 는염증반응에관여하는대표적인면역세포로써 LPS와같은염증유발물질에의해활성화되며 19), 활성화된 macrophages 로부터분비되는각종염증물질들은염증반응을유발하여기관지천식, 기관지염, 류마티스관절염, 동맥경화증, 그리고알츠하이머병이나파킨슨병과같은퇴행성뇌질환과뇌졸중, 바이러스감염등의발병에관여한다 20,21). 따라서최근에는각종염증물질들을효과적으로감소시킬수있는항염증제제개발에대한연구가활발히진행되고있으며한약재에서얻은생리활성성분이염증치료물질이되고있다. 용담초 (Gentiana scabra Bunge) 는다년생초본으로초용담 ( 草龍膽 ), 지담초 ( 地膽草 ) 등여러가지이름으로불리고있으며용담의꽃을용담화 (Gentiana sino-ornata) 라고한다. 한방에서사용되는뿌리의성미 ( 性味 ) 는고한 ( 苦寒 ) 으로간담 ( 肝膽 ) 의실화 ( 實火 ) 를사 ( 瀉 ) 하고청열 ( 淸熱 ), 조습 ( 燥濕 ), 하초 ( 下焦 ) 의습열 ( 濕熱 ) 을제거하는효능이있어두통, 협통 ( 脇痛 ), 습진, 피부및음낭소양 ( 搔痒 ), 황달, 만성위장질환에 57
8 사용하며 11), 대장간균, 백선균, 피부진균에대하여억제작용이있는것으로알려져있다 12). Lipopolysaccharide(LPS) 는병원균의내독소로서그람음성세균의막구조물로다당류, 인지질및소량의단백질로구성되어있으며, 여러종류의염증세포및조직구성세포들이생산하는 cytokine들의생산을촉진한다 22). 또한 Raw cell 과같은 macrophage 또는 monocyte 에서는 tumor necrosis factor-α(tnf-α), interleukin-6 (IL-6), interleukin-1β (IL-1β) 와같은 pro-inflammatory cytokine들을증가시키는것으로알려저있다 23,24). Nitric oxide (NO) 는아르기닌 (L-arginine) 으로부터산화질소합성효소 nitric oxide synthase (NOS) 에의하여생성되는물질로 NO synthases (NOS) 인 inducible nitric oxide synthase (inos), endothelial nitric oxide synthase (enos) 및 constitutive nitric oxide synthase (cnos or nnos) 에의해생성된다. cnos 는내피세포, 신경세포, 심근세포와같은세포내에상존하며칼슘에의하여활성화되어소량의 NO를계속생성한다. 반면 inos 는간세포, 혈관평활근세포, 섬유아세포, 마우스의대식세포와같은세포들에서면역학적자극이나염증성자극에의해합성되고이들세포에서는다량의 NO를생성한다. 또한혈관계에존재하는 enos 는염증을억제하지만 inos 는염증을촉진하는것으로알려져있다. 과잉생산된 NO는그자체로도유전자및단백질에독성을나타내지만활성산소의하나인 superoxide anion과반응해맹독성을가진 peroxynitrite 를생성하므로더욱강력한독성물질로변화되어암형성과진행에중요한역할을하는것으로보고되고있다 25). Cyclooxygenase (COX) 는 COX-1 과 COX-2 의두가지이성체가존재하는데 26), 세포가병적스트레스를받으면세포막에서지방산의일종인 Arachidon 산이유리되고이를원료로하여 COX-1 효소와 COX-2 효소가스트레스를해결하기위하여염증매개물질인각 prostaglandins (PGs) 을만들어낸다. COX-1 은 혈관, 위, 신장의정상조직에서발견되며, 혈류의유지나점액과중탄산염의생성, 신장기능조절과같은신체의항상성유지에관여하는반면 COX-2 는염증반응뿐만아니라혈액응고, 신장기능, 혈관조절및면역반응등에관여하고, 염증성 cytokine이분비되면 COX-2 가활성화된다 27). 또한 COX-2 는염증조직, 악성종양조직에서정상세포에비해많은양의 prostaglandin (PG) 의생성을유도하여혈관생성을촉진하고세포의증식을도울뿐아니라면역능력을억제함으로써암세포성장에좋은환경을제공하여또다른질병의병원성과의직접적인연관성을시사하고있다 28). COX-2 가발현되면류마티스관절염같은만성염증질환과대장, 두경부, 폐, 방광, 전립선, 위등인체에악성종양이발견된연구결과들이보고되었다 29,30). COX 에의해생성되는 PGs는염증, 유사분열생식, 세포의유착, 면역감시기구등에서중요한기능을수행하고세포분열이나증식에영향을줌으로서유방암, 대장암, 위암, 폐암등각종인체암의발생및진행에역할을한다는실험적증거들이보고 31) 되고있다. 이상의연구결과용담화에탄올추출물은 LPS로활성화시킨 RAW264.7 세포에서농도의존적으로 NO생성을저하시키고염증반응에관련된사이토카인의발현을억제시켜높은항염증효능을나타냈으며, 향후항염증전략으로개발하기위한기초자료로응용될수있을것으로기대한다. Ⅴ. 결론용담화에탄올추출물의항염증효과를알아보기위하여 RAW264.7 세포를활용하여세포독성과세포내 NO (Nitric Oxide) 생성량을측정하였다. Western blot 분석으로단백질발현양을측정하였으며아울러 RT-PCR을수행하여 RAW264.7 세포내에서용담화추출물의염증사이토카인발현억제효 58
9 최형욱외 5 인 : 용담화에탄올추출물의항염증효과에관한연구 과를확인하여다음과같은결론을얻었다. 1. 용담화추출물은 5-20 μg / μl의농도로첨가하였을때, 대체로모든농도에서 90% 이상의생존율을유지하여세포독성이없는것을확인하였다. 2. 용담화에탄올추출물은 20 μg / μl의농도에서 NO 생성이 80% 이상억제되는것으로나타나항염작용이매우우수한것으로나타났다. 3. 용담화에탄올추출물은 COX-2, inos, IL-1β, IL-6의발현을농도의존적으로감소시켰다. 이상의결과용담화추출물은본실험에서세포에대해독성을나타내지않으면서항염효능을가지고있는것으로보아항염증제품을개발하기위한기초연구의일환으로활용할수있을것이라사료된다. References 1. Willoughby DA. Human arthritis applied to animal models. Towards a better therapy. Ann Rheum Dis. 1975;34: Trowbridge HO, Emling RC. Inflammation: a review of the process, 5th ed. Chicago: Quintessence Pub.Co. 1997; Chung EK, Seo EH, Park JH, Shim JH, Kim KH, Lee BR. Anti-inflammaatory and anti-allergic effect of extracts from organic soybean. Korean J Organic Agric. 2011;2: Medzhitov R. Origin and physiological roles of inflammation. Nature. 2008;454: Chung HY, Cesari M, Anton S, Marzetti E, Giovannini S, Seo AY et al. Molecular inflammation: underpinnings of aging and age-related diseases. Ageing Res Rev. 2009;8: Boumpas DT, Chrousos GP, Wilder RL, Cupps TR, Balow JE. Glucocorticoid therapy ofimmune-mediated diseases:basic and clinical correlates. AnnInternMed. 1993;119: Barton CC, Barton EX, Ganey PE, Kunkel SL, Roth RA. Bacterial lipopolysaccharide enhances aflatoxin B1 hepatotoxicity in rats by a mechanism that depends on tumor necrosis factor-α. Hepatology. 2001;33: Byun BH. Effects of Inonotus obliquus EthanolExtract on Cytokine Expression in Raw 264.7Cell. Kor.J.Herbology. 2005;20(2): Lee E. Anti-inflammatory effect of Scutellariae Radix. Korean J.Plant Res. 2007;20(6): Yun HJ, Heo SK, Yi HS, Kim CH, Kim BW, Park SD. Anti-inflammatory effect of Injinho-tang in RAW Cells. Kor.J.Herbology. 2008;23(2): Seo JW. The anti-oxidative activities and separation of the Gentiana scabra var. buergeri extracts. Wonkwang University Kim MS, Kim SC, Jee SY, Hwang SY, Cho WJ, Lee JR et al. Inhibitory effect of Gentianae Radix MeOH extract on pro-inflammatory mediator production in lipopolysaccharide activated Raw264.7 cells. J Korean Med Ophthalmol Otolaryngol Dermatol. 2008;21(1): Kim NY, Kang TH, Kim DH, Kim YC. Anitric oxide synthesis inhibitor from the roots of Gentiana scabra in RAW cells. J Kor Pharmacogn. 1999;30(2): Zhu YP. Harwood academic publishers. 59
10 Amsterdam, Chin. Mat. Med. 1998; Huh H, Kim HK, Lee HK. PAF antagonistic activity of 2-hydroxy-3-methoxybenzoic acid glucose ester from Genyiana scabra. Arch Pharm. 1988;21(4): Borenfreund E, Puerner JA. Toxicity determined in vitro by morphological alterations and neutral red absorption. Toxicol Lett. 1984;24(2-3): Green strok CL. Radiation and aging free radical damage, biological response and possible antioxidant intervention. Med Hypotheses. 1993;41(5): Abul K. Celluar and Molecular Immunology. 6th edition. Saunders Elsevier. 2006; Iontcheva I, Amar S, Zawawi K H, Kantarci A, Dyke TE. Role for moesin in lipopolysaccharide-stimulated signal transduction. Infect. Immun. 2004;72: Abreu MT, Arditi M. Innate immunity and toll-like receptors: clinical implications of basic science research, J. Pediatr. 2004;144: Hanada T, Yoshimura A. Regulation of cytokine signaling and inflammation, Cytokine Growth Factor Rev. 2002;13: Marriot JB, Westby M, Cookson S, Guckian M, Goodbourn S, MullerG. CC-3052: a water-soluble analog of thalidomide and potent inhibitor of activation-induced TNF-α production. J Immunol 1998;161: Willeaume V, Kruys V, Mijatovic T, Huez G. Tumor necrosis factor-alpha production induced by viruses and by lipopolysaccharidesin macrophages: similarities and differences. J. Inflamm. 1996;46: Bhattacharyya A, Pathak S, Datta S, Chattopadhyay S, Basu J, KunDu M. Mitogenactivated protein kinases and NF-kappaB regulate H. pylori-mediated IL-8 releasefrom macrophages. Biochem J. 2002;366: Nathan C. Nitric oxide as a secretory product of mammalian cell. The FASEB J. 1992;6: Vane JR, Bakhle YS, Botting RM. Cyclooxygenase and 2. Anu Rev Pharmacol Toxicol. 1998;38: Sato T, Nakajima H, Fujio K, Mori Y. Enhancement of prostaglandin E2 production by epidermal growth factor requires the coordinate activation of cytosolic phospholipase A2 and cyclooxygenase 2 in human squamous carcinoma A431 cells. Prostaglandins. 1997;53: Huang M, Stolina M, Sharma S, Mao JT, Zhu LP, Miller W et al. Non-small cell lung cancer cyclooxygenase-2-dependent regulation of cytokine balance in lymphocytes and macrophage Up-regulation of interleukin 10 and down-regulation of interleukin 12 production. Cancer Res. 1998;58: Kelly LM, Hill AD, Kennedy S, Connolly EM, Ramanath R, Teh S et al : Lack of prognostic effect of Cox-2 expression in primary breast cancer on short-term follow-up. Eur J Surg Oncol. 2003;29: Park K, Han S, Shin E, Kim HJ, Kim JY. Cox-2 expression on tissue microarray of breast cancer. Eur J Surg Oncol. 2006;32: Seo YJ. Role of Cyclooxygenase-2 in 60
11 최형욱외 5 인 : 용담화에탄올추출물의항염증효과에관한연구 Carcimogenesis and Its Selective Inhibition for Cancer Chemoprevention. Molecules and cells. 2002;13(4):
( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
α α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
Journal of Life Science 2011, Vol. 21. No μ μ
Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,
γ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
Lumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
Microsoft Word - 04-김택중.doc
J. Exp. Biomed. Sci. 2010, 16(2): 91~95 Anti-inflammatory Properties of Meso-dihydroguaiaretic Acid in Lipopolysaccharide-induced Macrophage Yong-Jae Kim *, Yeo-Jin Kang * and Tack-Joong Kim Division of
DBPIA-NURIMEDIA
Korean Society for Biotechnology and Bioengineering Journal 33(3): 155-160 (2018) http://dx.doi.org/10.7841/ksbbj.2018.33.3.155 ISSN 1225-7117 / eissn 2288-8268 Research Paper 제주산애기수영추출물의항염증효과 양은진 1, 현광희
Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot
EZ-LDH Cell Cytotoxicity Assay Kit Cat. No. DG-LDH500 DG-LDH1000 FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. 1 ( 주 ) 대일랩서비스부설두젠생명공학연구소 Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는
5
26 3 (2005 9 ) J Korean Oriental Med 2005;26(3):55-65 The Effcects of Psoraleae fructus Extract on Melanin Synthesis of B16 Melanoma Cells Jae-Ho Chung, Hyung-Sik Seo Dept. of Ophthamology, Otolaryngology
1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
224 H. W. Choi et al 용담초에대한연구에서서 9) 는용담초추출물의항산화효과를 입증하였고, 김 10) 은용담초메탄올추출물이염증질환, 면역질환의 조절에효과가있다고하였다. 또한한 11) 은 CCl₄ 흰쥐의손상된간에 용담초약침을처치하여회복시키는효과를입증하였고,
J Physiol & Pathol Korean Med 29(3):223~229, 2015 용담초추출물의화장품소재로서약리활성에관한연구 최형욱 1 인명희 1 문연자 1,2 임규상 1,3 우원홍 3,4* 1 : 원광대학교한의학전문대학원한약자원개발학과, 2 : 원광대학교한의학전문대학원 BK21-plus 팀, 3 : 한국전통의학연구소, 4 : 한의과대학해부학교실 Study
l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
DBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
KISEP Otology Korean J Otolaryngol 2000;43: 마우스대식세포주에서항산화제및 Dexamethasone 이유발형산화질소합성효소발현과산화질소생성에미치는효과 강준명 여상원 이흥엽 장기홍 서병도 Effect of Antioxidants
KISEP Otology Korean J Otolaryngol 2000;43:136-42 마우스대식세포주에서항산화제및 Dexamethasone 이유발형산화질소합성효소발현과산화질소생성에미치는효과 강준명 여상원 이흥엽 장기홍 서병도 Effect of Antioxidants and Dexamethasone on inducible Nitric Oxide Synthase
Jkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
목차 1. 서론 줄기세포의간세포분화능평가시고려사항 간세포분화능평가시험법 분
세포치료제시험정보집 7 줄기세포치료제의 간세포분화능평가시험 2015. 4. 30. 식품의약품안전평가원 차세대줄기세포기반제제평가연구사업단 목차 1. 서론 --------------------------------------------- 1 2. 줄기세포의간세포분화능평가시고려사항 --------------- 2 3. 간세포분화능평가시험법 -----------------------------
달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
( )Jkstro011.hwp
비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy
03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
untitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
[00]_목차.hwp
Korean J. Plant Res. 27(5):439-446(2014) http://dx.doi.org/10.7732/kjpr.2014.27.5.439 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article Murine Macrophage RAW 264.7 세포에서구실잣밤나무추출물의항염증효과
03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
Ⅰ. 서 론 鼻 茸 은 비강과 부비동의 점막이 염증성, 부종성 변 화로 돌출되어 발생하는 질환으로 비교적 흔하며 그 표면이 매끄럽고 회백색 혹은 회적색을 띠고 있다. 감 염과 알레르기가 중요한 발병원인으로 생각되고 있으 며, 치료 후에도 잘 재발하는 만성 염증성 질환이
J Korean Med Ophthalmol Otolaryngol Dermatol 2015;28(2):85-92 pissn 1738-6640 eissn 2234-4020 http://www.ood.or.kr http://dx.doi.org/10.6114/jkood.2015.28.2.085 Case Report / 증례 지혈겸자 적출술을 이용한 비용종 환자의 치험
환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
A Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
(01) hwp
Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of
Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세
본문제에대한지적소유권은동국대학교에있습니다. 본교의서면허락없이무단으로출판, 게재, 사용할수없습니다. 문제 2 2016 학년도약학대학면접문제 아래의질문에 3-4 분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신 인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세포의생존과증식
Statistical Data of Dementia.
Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
Korean J. Plant Res. 31(2): (2018) Print ISSN Online ISSN Original Research Artic
Korean J. Plant Res. 31(2):117-123(2018) https://doi.org/10.7732/kjpr.2018.31.2.117 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 박수빈 1, 송훈민 1,3, 김하나 1, 박광훈 2, 손호준 2, 엄유리 2, 박지애
<C6EDC1FD2D32382D34C8A32DBEC8C0CCBAF1C0CEC8C4B0FAC7D0C8B8C1F62E687770>
J Korean Med Ophthalmol Otolaryngol Dermatol 2015;28(4):156-164 pissn 1738-6640 eissn 2234-4020 http://www.ood.or.kr http://dx.doi.org/10.6114/jkood.2015.28.4.156 Report Case / 중례 한양방 치료를 병행한 삼출액을 주소로
- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
Can032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
( )Kjhps043.hwp
Difference of Fistula Maturation Degree and Physical Property by the Types of Tube Material: An Experimental Study Sang Koo Kang, M.D. 1, Hee Chul Yu, M.D. 1,4, Woo Sung Moon, M.D. 2,4, Ju Hyoung Lee,
MHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한
Microsoft Word - Genolution RNAi Manual.doc
1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000
<30322EBABBB9AE2E687770>
대한내과학회지 : 제 79 권부록 2 호 2010 청람연구비결과보고 대장암발생과정에서 Prostaglandin 의조절기전규명및암예방약제의반응성표지자로 15-hydroxyprostaglandin dehydrogenase의역할 울산대학교의과대학내과학교실 명승재 서 론 2. 병리조직학적분석 (Histopathologic analysis) 과제는인체에서대장암병기의각단계에서
27 2, 17-31, , * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** ( :
27 2, 17-31, 2009. -, * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** (: dminkim@cau.ac.kr) 18 한국교육문제연구제 27 권 2 호, 2009. Ⅰ. (,,, 2004). (,, 2006).,,, (Myrick,
27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: * The
Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.243-268 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.243 * - 2001 2015 - The Research Trends on Peer Counseling in Elementary and
DBPIA-NURIMEDIA
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic
농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다 년 2 월 11 일 - 1 -
농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다. 2013 년 2 월 11 일 - 1 - 연구기관명 : 부산대학교 연구책임자 : 정명호 연구원 : 손용해 연구원 : 장민경 - 2 - Ⅰ. 제목 팥의대사성질환개선및기능성규명 Ⅱ. 연구개발의목적및필요성 팥의대사성질환개선소재발굴과그기능성을과학적으로증명하기위해, 팥의당뇨,
RAW264.7 대식세포에서 장대나물 추출물의 Nitric oxide 및 Prostaglandin E 2생성 저해효과 의해 활성화되어, 염증성 사이토카인, nitric oxide (NO)와 prostaglandine 2 (PGE 2 )를 생성함으로써 통증, 부종, 기능
Korean J. Plant Res. 28(5):568-573(2015) http://dx.doi.org/10.7732/kjpr.2015.28.5.568 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article RAW264.7 대식세포에서 장대나물 추출물의 Nitric oxide 및 Prostaglandin
<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>
J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2
Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
Pierce-Plus-Alpha.pdf
Save 40% on antibodies Primary antibody 전제품 40% 할인가로만나보세요 Count on Invitrogen 42,000 antibodies highly validated primary and secondary antibodies in our portfolio and growing 4,500 primary conjugated antibodies
DBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
A 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
mau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
DBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285
13 2 ( 25 ) 2004 12 Korean J Med Hist 13 284 296 Dec 2004 ISSN 1225 505X 1) * ** ** 1 1920 1930 40 ( 1896-1973) 80 * ** 1) 2003 284 2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914
Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp DOI: Awareness, Supports
Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp.335-363 DOI: http://dx.doi.org/10.21024/pnuedi.26.3.201612.335 Awareness, Supports in Need, and Actual Situation on the Curriculum Reconstruction
歯5-2-13(전미희외).PDF
The Korean Journal of Counseling 2004, Vol. 5, No. 2, 423-434,. 4 5 18 9, 9.,,,,,.,,, t-.. :,,, (,, 1996),.,,. (, 2001),... 88 98 2000, 88 12.5%(250 )98 35.6%(712 )2.8 (,,, 2001) (Corresponding Author)
12이문규
Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., Vol. 13 No. 2, , April 2015 스피루리나추출물의항염증및항노화, 멜라닌합성억제효과 장혜진, 최은영 * 건국대학교일반대학원생물공학과 Effects of Spir
RESEARCH ARTICLE 장혜진, 최은영 * 건국대학교일반대학원생물공학과 Effects of Spirulina Platensis Extract, the Act of which are Antiinflammation, Anti-aging, As well as Suppressing Melanin Synthesis Hye-Jin Jang, Eun-Young Choi*
대한한의학원전학회지24권6호-전체최종.hwp
小兒藥證直訣 의 五臟辨證에 대한 小考 - 病證과 處方을 중심으로 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 ㆍ 韓醫學古典硏究所 白裕相1,2*1)2) A study on The Diagnosis and Treatment Using The Theory of Five Organs in Soayakjeungjikgyeol(小兒藥證直訣) 1 Dept. of Oriental
09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012). (2007) 26%., (,,, 2011;, 2006;
,,.. 400,,,,,,.,,, -, -, -., 3.. :, Tel : 010-9540-0640, E-mail : sunney05@hanmail.net ,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012).
Jkbcs032.hwp
Clinical Correlation of HER-2/neu Overexpression in Patients with Breast Cancer Sung Yong Kim, Tae Yoon Kim, Jae Jun Kim, Chang Ho Kim, Ok Pyung Song, Min Hyuk Lee, Eui Han Kim 1, and Moo Sik Cho Departments
<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
Abstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
Kor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on
미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
(....).hwp
sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial
Jksvs019(8-15).hwp
Grade I Grade II Grade III 12 대한혈관외과학회지 : 제 20 권 제 1 호 2004 Control Group A Group B Fig. 4. Microscopic findings of vein wall in control, group A and group B on the day of 7 after venous occlusion. The
율촌 인쇄.xps
플라보노이드리나린배당체의염증제어능탐색 김우기경희대학교식품생명공학과 1. 서론 1.1. 연구배경 만성염증성질환의치료및완화를위하여전통적으로괴곽( 회화나무) 추출물을사용하여왔으나, 그효과물질및작용기작에대한규명은미흡한실정이다. 일부연구에서는플라보노이드류인 리나린(Linarin) 및그배당체가괴곽에다량존재하며다양한생리활성을나타냄이보고되었으나, 항산화능을비롯한일반적플라보노이드류의분석연구에집중되어왔다.
기관고유연구사업결과보고
기관고유연구사업결과보고 μ μ 해당년도 2008년 2009년 2010년 의뢰부서 과제의뢰의뢰총 Sample reaction 수책임자건수 sample수 (Assay * sample수 ) 암코호트과 성ㅇㅇ 1 936 31,824 기능유전체연구과 이ㅇㅇ 1 948 11,376 유방암연구과 이ㅇㅇ 1 344 344 폐암연구과
PowerPoint 프레젠테이션
Glutathione Excellose handbook - Purification of GST fusion proteins - Looking for more detail Purification protocol? - Glutathione Excellose Spin Kit - Glutathione MiniExcellose - Glutathione Excellose
878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and
Effects of baseball expertise and stimulus speeds on coincidence-anticipation timing accuracy of batting Jong-Hwa Lee, Seok-Jin Kim, & Seon-Jin Kim* Seoul National University [Purpose] [Methods] [Results]
04조남훈
Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache
<31335FB1C7B0E6C7CABFDC2E687770>
에너지기후변화교육 4(2):203~211(2014) 203 초등학교 교과서 에너지 단원의 탐구활동과 시각자료 기능 분석 사례 연구 신명경 권경필 * 경인교육대학교 Abstract : This study aimed to analyze energy related inquiry activity and visual materials in elementary textbook.
Journal of Educational Innovation Research 2016, Vol. 26, No. 2, pp DOI: * The Mediating Eff
Journal of Educational Innovation Research 2016, Vol. 26, No. 2, pp.159-177 DOI: http://dx.doi.org/10.21024/pnuedi.26.2.201608.159 * The Mediating Effects of Self-esteem on the Relationship between Social
(Establishment and Management of Proteomics Core Facility)
(Establishment and Management of Proteomics Core Facility) 1 sample running on SDS-PAGE Gel (10well) 163570 10 16357 1D size marker 225500 100 2255 Buffer(20X, 500ml) 119900 20 5995 Staining
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
Rheu-suppl hwp
Objective: This paper reviews the existing Korean medical and public health, and nursing academy articles on disease-specific and domain-specific quality of life, and provides recommendations for the universally
2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, )
Abstract Kim Dal-Rae, Kim Sun-Hyung* Dept. of Sasang Constitutional Medicine, College of Oriental Medicine, Kyung-Hee Univ. *Dept. of Sasang Constitutional Medicine, East-West Neo Medical Center, Kyung-Hee
서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소
2012 년도기초과학연구소 대학중점연구소심포지엄 마이크로파센서를이용한 혈당측정연구 일시 : 2012 년 3 월 20 일 ( 화 ) 14:00~17:30 장소 : 서강대학교과학관 1010 호 주최 : 서강대학교기초과학연구소 Contents Program of Symposium 2 Non-invasive in vitro sensing of D-glucose in
(5차 편집).hwp
(215), 54(1), 17-3 211 STEAM,.. STEAM, STEAM, 5~6 11.,., 5~6...,. (, 21)., 29. (,, 212). 211 STEAM * :, E-mail: njkwon@hanmail.net http://dx.doi.org/1.15812/ter.54.1.2153.17 (215), 54(1), 17-3,. (Arts)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3
27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,