07(JLS_140171).hwp

Size: px

Start display at page:

Download "07(JLS_140171).hwp"

부자 장곡
7 years ago
Views:

1 Journal of Life Science 2014 Vol. 24. No ~1091 ISSN (Print) ISSN (Online) DOI : Effects of Selenate on dipocyte Differentiation and the Expression of Selenoproteins in 3T3-L1 Cells Seol Hui Park 1 and Yang Soo Moon 2 * 1 School of Medicine, Kyung Hee University, Seoul , Korea 2 Department of nimal Science & iotechnology, Gyeongnam National University of Science and Technology, Jinju , Korea Received September 11, 2014 /Revised October 8, 2014 /ccepted October 14, 2014 The purpose of this study was to determine the effect of selenate on adipocyte differentiation and to identify genes involved in the modulation of adipogenesis in 3T3-L1 cells. To test the effect of selenate on adipocyte differentiation, adipogenesis was induced in cells using various concentrations (0 00 μ M) of selenate. Various phases of adipogenesis were induced: postconfluent (PC), early phase (EP, d0-d2), postmitotic growth arrest (PM, d2-d4), and all period (P). The PC cells exposed to selenate for 24 h displayed dose-dependent inhibition of intracellular lipid droplet accumulation on day 6 of adipogenesis. Two days of selenate treatment at EP or P inhibited adipogenesis, with an approximately 20 80% reduction in lipid accumulation compared to that of a control (p<0.05). When preadipocytes were exposed to selenate during the PM period, the antiadipogenic effect of selenate was attenuated. Two types of selenoprotein genes (Seps1 and Sepp1) were up-regulated by the selenate treatment during mitotic clonal expansion, whereas these genes were down-regulated during PM growth arrest (p<0.05). The findings demonstrate the antiadipogenic function of selenate and the possible involvement of Sepp1 and Seps1 genes in selenate-inhibited adipogenesis in 3T3-L1 cells. Key words : 3T3-L1 cells, adipocyte differentiation, gene expression, selenate, selenoprotein 서 Selenium 은필수미량광물질로서오래전부터여러효소의 구성요소로알려져왔다 [18]. 최근에는저농도에서항산화제 로서 [3], 고농도에서는항암제로서 [17] 그기능이알려짐에따 라영양첨가제로서이용되고있다 년대에는 selenate 가 인슐린과유사한기능을하여당뇨질환동물에서지방합성에 주요역할을하는효소인지방합성효소 (FS) 와 glucose-6- phosphate dehydrogenase (G6PDH) 의발현에관여하는것으 로보고되었다 [1]. 또한지방세포배양실험과동물실험에서도 selenate 은강력한인슐린유사기능이확인되었다 [5, 13]. 이와 같이 selenium 이지방대사와연관되는효소와호르몬의기능 이알려짐에따라 selenium 이지방세포의분화에어떤영향을 미치는지에대한연구에관심을가지게되었다. 최근에 selenium 이지방세포의분화억제효과가있으며이는 TGF-ß 의 *Corresponding author *Tel : , Fax : * ysmoon@gntech.ac.kr This is an Open-ccess article distributed under the terms of the Creative Commons ttribution Non-Commercial License ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. 론 유도에의한결과임을보고하였다 [7]. 이연구에의하면 selenium 에의한지방분화억제효과는 selenium 의형태중 selenite은 세포에독성을나타내거나세포분화억제능력을나타내지않았으며, selenate는지방전구세포에서 TGF-ß 발현을촉진하고효과적으로지방세포분화억제를유도하였다고한다. 비만유도모델쥐를이용한 selenium 급여효과실험에서, selenium은지방산의 ß-산화 (ß-oxidation) 를통하여지방세포의증대 (hypertrophy) 와복부지방의축적을억제한다고하였다 [7]. 이연구에서 selenium은쥐의혈중포도당의농도를낮춤으로서인슐린과유사한기능을보였으며, 복부지방함량과지방세포의크기도감소하였다고한다. Selenium은생체내 selenoprotein으로전환되어이용된다 [15]. 지금까지약 25종의 selenoprotein이알려졌으며, 이들중 7가지가소포체 (ER, endoplasmic reticulum) 에내재되어있는것으로알려져있다 [12]. 이들중 selenoprotein S 로알려진 Seps1은 plasma membrane과 ER membrane에위치에있다 [6, 10]. Seps1의기능중하나는 ER stress를조절하는것으로 ER의항상성유지에중요한기능을한다고한다 [20]. 포도당결핍유도혹은 ER stress을세포에가할경우 Seps1의발현이유도되고, 대식세포에서 ER stress 유도제에의한세포의 apoptosis가유도된경우 Seps1는이를억제하는기능을나타낸다 [6, 9]. Selenium을급여한동물실험에서체중감소효과가보고된바 [2] 있으나 selenium이지방세포분화와연관된구체적기작에대해서는아직잘알려진바가없다. Sepp1은 selenoprotein P의대표적 isoform중의하나로비만과인슐린내성과관련있는것으로알려져있으며지방세포에서의 Sepp1의발현은비만과인슐린

2 1086 생명과학회지 2014, Vol. 24. No. 10 내성과역의상관관계이다 [21]. 3T3-L1세포에서 Sepp1의발현을억제 (knocking down) 하였을때지방세포로의분화가감소하였다고한다. 즉 selenoprotein P의발현을억제는지방세포의분화를감소시킨다. 이와같이 selenium은세포배양실험뿐만아니라동물실험에서도지방세포의분화혹은지방조직의양적감소를유도함을보여주었다. 그러나 selenate이지방세포의분화단계에서어떤시점에영향을주는지, 그리고어떤유전자들의발현이지방세포의분화에관여하는지에대한연구는거의없는실정이다. 따라서본연구는 selenate의지방세포분화가어떤시점에가장효과적으로작용하는지그리고 selenate이지방세포분화에관여하는 selenoprotein 유전자들의발현양상을알아보고자마우스 3T3-L1 세포를이용하여본연구를실시하였다. 재료및방법 세포배양, 지방세포분화유도및 selenate 처리마우스3T3-L1 세포주는 TCC (merican Type Culture Collection, Manassa, V, US) 에서분양받아사용하였다. 3T3-L1 지방전구세포는 Dulbecco s Modified Eagle s Medium (DMEM) (Gibco RL, Grand Island, NY, US) 에 10% fetal bovine serum (FS) 에유지하였다. 3T3-L1세포가 confluent된다음 2일후 (day 0) 에 10% FS에지방세포분화유도배지성분 (insulin 167 nm, IMX 0.5 mm, DEX 5 μm) 이함유된 DMEM 에세세포의분화를유도하였다. 세포는 10%-FS와 insulin이첨가된배지에서 2일간배양하였으며, 이후 10%FS-DMEM 배지에서추가로 2일간배양하여성숙된지방분화세포를유도하였다. 모든배지에는 penicillin 100 U/ml과 streptomycin 100 μg/ml이포함되도록하였다. 세포는 37 로유지되는 5% CO 2 조건의배양기에서배양하였다. 세포내지방구형성을확인하기위하여 Oil-red O (ORO) (Sigma Co, St Louis, Fig. 1. Pre-treatment of selenate inhibits adipocyte differentiation in a dose-dependent manner on 3T3-L1 cells. One-day post-confluent (day-1) 3T3-L1 preadipocytes were subjected to a 24 hr selenate treatment with various concentrations. fter differentiation, cells were measured to Oil-red O staining for photographic analysis of lipid accumulation (), followed by a quantitative analysis of ORO-stained intracellular lipids among differentiated 3T3-L1 cells (). The amount of ORO-stained intracellular lipid was expressed as relative fold of control (0 μm). a, b, c Values (means ± S.D) with different letters represent significant differences at p<0.05. MO, US) 염색을실시하였다. ORO 염색은세포분화유도 6 일 (day 6) 후에실시하였으며, 염색된세포는광학현미경으로 Table 1. Primer pairs used to analyze gene expression by real-time RT-PCR and size of product Genes Primer sequence (5'-3') Size of product (bp) ß-ctin Xbp1 Grp78 Chop Seps1 Sepp1 Forward: GGGGGTGCGCTTG Reverse : TGGTTTGGCGGGTT Forward: GGTTTGGGGGCCC Reverse : CCGTGGTTTTCTCCCGT Forward: CGGCGCCTTGGTGC Reverse : CCCCTTGTGGCG Forward: GTCCTGTCCTCGTGTTGG Reverse : GGTTTTTGTTCTTCCTCTTCGT Forward: GCTGGCCGCCGGCT Reverse : GCTGCCTCTTGCCGCTT Forward: CGGGTGGCT Reverse : TGTGGGGGGT ccession number (Genank) 77 NM_ NM_ NM_ NM_ NM_ NM_

Journal of Life Science 2014, Vol. 24. No. 10 1087 관찰한후지방의축적정도를측정하기위하여 isopropanol 을이용하여염색을세포로부터추출한다음분광광도계 490 nm에서흡광도를측정하였다.

3 Journal of Life Science 2014, Vol. 24. No 관찰한후지방의축적정도를측정하기위하여 isopropanol 을이용하여염색을세포로부터추출한다음분광광도계 490 nm에서흡광도를측정하였다. Selenate의처리효과를조사하기위하여 selenate을농도별 (0-100 μm) 로 3T3-L1지방전구세포가 confluent 1일전에처리를한다음지방분화유도배지를이용하여분화유도를하고분화유도 6일후 ORO 염색을실시하였다. RN추출은분화유도 4일후에실시하여유전자들의발현을비교분석하였다. Selenate의농도별결과중에서 50 μm을선택하여지방전구세포의 confluent 이전 24시간처리, 분화유도전기, 분화유도중기, 그리고전분화기간을 selenate을처리하여지방세포의분화에어떤영향을미치는지조사하였다. 지방세포분화또는 ER-stress 지표유전자들의발현은 quantitative real-time PCR (qrt-pcr) 로분석하였다. Total RN 추출과 quantitative RT-PCR 분석 3T3-L1세포로부터 total RN의추출은 Trizol (Invitrogen, Carlsbad, C) 을이용하여제조사의이용안내에따라 total RN를추출하였다. cdn 합성은 1 μg의추출된 total RN 를 Improm-II Reverse Transcription System (Promega, Madison, US) 를이용하여합성하였다. 합성된 cdn는 qrt-pcr을위하여이용되었다. qrt-pcr은 MyiQ (io-rad, Hercules, US) 을이용하여시행하였다. qrt-pcr을위한 primer 의정보는 Table 1에제시하였다. PCR 반응물은 cdn (10 ng) 5 μl, primer (5 pmole) 는각각 0.5 μl, SYR Green (pplied iosystems, US) 10 μl, ddh 2O 4 μl 를넣어총 20 μl 가되도록혼합하고 95 3분간최초변성을시킨다음 95 15초간변성, 60 에서 15초간접합, 72 40초간확장과정을 40회반복하였다. 그리고 94 1분간재접합과정을거친후 55 에서 1분간재확장과정을실시하였다. 마지막으로 55 에서 0.5 씩상승시켜형광접합물질인 SYR Green이떨어져나오는마지막과정을수행하였다. 유전자발현의상대적발현양은 Livak와 Schmittgen [11] 가제시한 2 - Ct 방법을이용하였다. 화에미치는영향을조사하기위하여 selenate을세포가 confluent 된 1일후, 즉세포분화유도 1일전에 selenate를 24시간처리하였다. 처리농도는 0 μm, 10 μm, 25 μm, 50 μm, 100 μm 등으로달리하여세포에처리하였다. Selenate처리 24시간후세포는일반적인 3T3-L1세포의분화유도프로그램과같이 2일간 10% FS + adipogenic inducing medium으로배양, 2일간 10% FS + Insulin으로배양, 그리고나머지 2일은 10% FS + DMEM으로배양하였다. Selenate의처리에의하여지방전구세포는분화가억제되었으며, 처리된 selenate의농도가높아짐에따라그억제효과는높았다 (Fig. 1). ORO staining 을양적으로분석한결과 (OD측정) 10 μm 과 25 μm 에서는유의적인지방세포분화억제효과를나타내지않았으며, 처리농도 50 μm에서약 20% 정도지방세포의분화를억제하였다. 최고농도의 selenate (100 μm) 에서는정상적인분화를유도한처리구 (0 μm) 에비하여세포내지방축적이약 50% 감소된것을확인할수있었다. 통계처리통계처리는 SS 프로그램을이용하였으며, 실험성적은평균과표준오차를구하고분산분석을실시한다음 Duncan s multiple range test에의하여 95% 수준에서유의성을검정하였다 [4]. Selenoprotein 유전자발현은대조군과비교하여 Students s t-test 한후유의수준 0.05 및 0.01 이하로유의성분석을실시하였다. 결과및고찰 Selenate 의처리시기와지방전구세포의분화억제 Selenate의처리시기별농도별지방전구세포 3T3-L1의분 Fig. 2. Treatment of selenate on the early phase of adipogenesis inhibits adipocyte differentiation in a dose-dependent manner on 3T3-L1 cells. () Post-confluent 3T3-L1 preadipocytes (day 0) were subjected to a 48h selenate treatment (day 0-day 2) with various concentrations. fter differentiation, cells were measured to Oil-red O staining for photographic analysis of lipid accumulation (), followed by a quantitative analysis of ORO-stained intracellular lipids among differentiated 3T3-L1 cells (). The amount of ORO-stained intracellular lipid was expressed as relative fold of control (0 μm). a, b, c Values (means ± S.D) with different letters represent significant differences at p<0.05.

분화초기에처리된 selenate은효과적으로지방세포의분화를억제하였으며, selenate의처리농도가증가할수록지방세포의분화를강력하게억제함을볼수있었다 (Fig. 2). 그러나 selenate을지방세포분화유도배지에배양한후 2일간 (day2-day4; post-mitotic growth arrest) 처리한경우지방세포분화억제효과는크게감소함을보여주었다 (Fig. 3).

4 1088 생명과학회지 2014, Vol. 24. No. 10 지방세포분화의초기 (day0-day2: early phase of adipocyte differentiation) 에 selenate의처리가지방전구세포의분화에어떤영향을미치는지조사하기위하여위에처리한 selenate 을같은농도로 3T3-L1세포에 2일간분화초기 (day0-day2) 에지방세포분화유도배지와함께배양하였다. 분화초기에처리된 selenate은효과적으로지방세포의분화를억제하였으며, selenate의처리농도가증가할수록지방세포의분화를강력하게억제함을볼수있었다 (Fig. 2). 그러나 selenate을지방세포분화유도배지에배양한후 2일간 (day2-day4; post-mitotic growth arrest) 처리한경우지방세포분화억제효과는크게감소함을보여주었다 (Fig. 3). 이경우 selenate의농도를증가시켜도지방세포의분화는정상적으로진행됨을확인하였다. 마지막으로지방전구세포의분화전기간 (day0-day6) 동안 selenate을처리한경우지방전구세포의분화는효과적으로억제되었으며, 처리된 selenate의농도가증가함에따라유의하게세포의분화를억제하였다 (Fig. 4). 지방세포에서 selenate 와 ER stress지표유전자발현소포체 (ER) 의 stress는지방세포분화의가장초기단계의현상중의하나로소포체에서생화학적, 생태학적변화를거치면서수많은단백질을새롭게만들게되는데, 경우에따라지나치게많이만들어진단백질때문에소포체는스트레스를받게된다. 이와같은 ER스트레스는비만과인슐린저항성과도밀접한상호관계가있는것으로알려져있다 [14, 18]. 따라서 selenate의한지방세포분화억제에 ER stress 연관마커유전자들의발현양상이어떻게반응하는지확인하기위하여 selenate의각처리시기별및처리농도에따라 Glucose response protein 78 kda (Grp78), X-box binding protein 1 (Xbp1), C/EP homologous protein (Chop) 유전자들의발현을 qrt-pcr을이용하여세포의분화유도 4일후 (day 4) 에 total RN을추출하여분석하였다 (Fig. 5). 지방전구세포에 selenate를처리한후지방세포를분화유도한경우 ER-stress marker 유전자들인 Grp78, Xbp1, 그리고 Chop은주로고농도에서그발현이크게감소함을보였다. 본실험에서소포체스 Fig. 3. Treatment of selenate on the post-mitotic growth arrest phase of adipogenesis attenuates adipocyte differentiationon on 3T3-L1 cells. The post-mitotic growth arrest phase of 3T3-L1 preadipocytes (day 2-day 4) were subjected to a 48hr selenate treatment with various concentrations. fter differentiation, cells were measured to Oil-red O staining for photographic analysis of lipid accumulation (), followed by a quantitative analysis of ORO-stained intracellular lipids among differentiated 3T3-L1 cells (). The amount of ORO-stained intracellular lipid was expressed as relative fold of control (0 μm). a, b, c Values (means ± S.D) with different letters represent significant differences at p<0.05. Fig. 4. Treatment of selenate on the all period of adipogenesis inhibits adipocyte differentiationon on 3T3-L1 cells. The 3T3-L1 preadipocytes (day 0-day 6) were subjected to a 6-day selenate treatment with various concentrations. fter differentiation, cells were measured to Oil-red O staining for photographic analysis of lipid accumulation (), followed by a quantitative analysis of ORO-stained intracellular lipids among differentiated 3T3-L1 cells (). The amount of ORO-stained intracellular lipid was expressed as relative fold of control (0 μm). a, b, c, d Values (means ± S.D) with different letters represent significant differences at p<0.05.

5 Journal of Life Science 2014, Vol. 24. No 트레스지표유전자들의발현이감소된것은세포내지방의축적이 ER스트레스를유발하고관련지표유전자들의발현을유도한다는보고 [18] 와유사함을볼수있다. 즉, HepG2세포배양시험에서중성지방은 ER stress marker 유전자들의발현과인슐린저항 (insulin resistance) 을유도하였다. 본시험에서는 selenate의처리는지방전구세포의분화를억제함으로서지방전구세포의분화와더불어진행되는세포내지방구형성을억제함으로서세포의 ER스트레스의증가를억제한것으로사료된다. Selenate의처리는지방전구세포에게대사스트레스 ( 세포내지방산, 포도당증가등 ) 에대한소포체의스트레스증가를억제함으로써소포체내의 GRP78 단백질들이 PERK, TF6, IRE1과결합한상태에서분리되고, GRP78으로부터자유로워진위의단백질들은활성화되고활성화된이들단백질들은각각의신호전달체계를통하여 ER stress의다음단계반응을이어간다. IRE1의경우 Xbp1의발현을촉진하고, 활성형의 spliced XP1은핵내로이동하여 unfolded protein response (UPR) 유전자들 (Grp78, Xbp1, Chop) 의발현을다시촉진하게된다 [19]. 그러나지방전구세포에서 selenate와연관된 ER 스트레스와세포내신호전달기작은아직밝혀진바없기대문에이에대한연구가더필요한것으로사료된다. 지방전구세포에서 selenate 의처리와 selenoprotein 유전자발현본연구에서 selenate를지방전구세포혹은지방세포분화초기에처리하였을때지방세포의분화를효과적으로억제하는것을 ORO 염색을이용하여확인하였다. 그리고이러한분화억제에는 ER스트레스유전자들또한관여하는것으로확인하였다. 지방세포분화, ER스트레스, 그리고 selenate와공통적으로연관된 selenoprotein 유전자들중 Seps1과 Sepp1유전자들의발현양상을조사하였다. 본연구에서는 3T3-L1 세포에서 50 μm의 selenate를 post-confluent 1일후 24시간처리하였으며, 지방세포분화유도체계에따라 day 0부터 day 4까지매일 RN를추출한다음 Seps1과 Sepp1의발현을 qrt-pcr로분석하였다. Fig. 6 () 에서보는바와같이 Seps1 mrn의수준은 day 0에서 selenate가처리되지않은대조구에비해 2.2배그발현이증가하였으며 (p<0.05), 분화유도 day 1에서도그정도는낮아졌으나여전히높은발현을보였다. 그러나 day 2를기점으로급격하게 Seps1의발현은감소하였으며이후에는오히려대조구에비하여크게낮아진발현양상을보였다 (p<0.05). Sepp1의경우에도 Seps1과유사한발현양상을보였는데, 특히분화유도초기에대조구에비하여 3.6배 (day 0) 혹은 5.2배 (day 1) 높은발현을보였다 (p<0.05) (Fig. 6). Sepp1의발현은분화유도 day 2를기점으로급격하게감소하였으며 C D Fig. 5. Expression of ER-stress marker genes on 3T3-L1 cells incubated with selenate. Cells were incubated with various concentrations of selenate and were treated with selenate during specific given time period of adipogenesis. Cells harvested at day 6 were subjected to quantitative gene expression analysis by real-time RT-PCR. The signals were normalized to ß-actin internal control and the results were expressed as relative fold of induction. () pre-treatment of selenate on one-day postconfluent of cells; () selenate treatment during the early phase of adipogenesis; (C) selenate treatment during the post-mitotic growth arrest phase of adipogenesis; (D) selenate treatment during the all period of adipogenesis. a, b, c, d Values with different letters within the same bars significant differences at p<0.05.

6 1090 생명과학회지 2014, Vol. 24. No. 10 Fig. 6. nalysis of solenoprotein gene expressions with quantitative real-time RT-PCR. One-day post-confluent (day-1) 3T3-L1 preadipocytes were subjected to a 24 hr selenite (50 μm) treatment and each time period total RN was extracted for Seps1 () or Sepp1 () gene expressions. Data are given as means of values ± S.D from three independent experiments. * p<0.05 and ** p<0.01, compared to control group. 이후에도낮은발현수준을유지하였다. Seps1의경우포도당대사와연관된 ER스트레스에의해발현되며, Seps1단백질은지방전구세포에서분화유도초기에급격한발현감소와함께지방세포분화를억제한다고한다 [8]. 본연구에서는 Seps1의발현이세포의분열이최종적으로일어나는 mitotic colonal expansion 기간 (day 0-day 2) 에는높은발현을보이지만 post-mitotic growth arrest (day 2-day 4) 기간에는 Seps1유전자가낮은발현을보이는것은 selenate 처리에의한지방세포분화억제와연관이있는것으로보인다. Selenium을급여한동물실험에서체중감소효과가보고된바 [2] 있으나 Selenium 이지방세포분화와연관된구체적기작에대해서는아직잘알려진바가없다. 본연구에서도 selenate에의한분화유도초기급격한 Seps1의발현변화에대하여현단계에서명확한이유를찾을수없으므로이에대한체계적연구가필요한것으로사료된다. Selenoprotein P의대표적 isoform중의하나인 Sepp1은비만과인슐린내성과관련있는것으로알려져있으며지방세포에서 Sepp1의유전자를 knock-down을한경우정상적인지방세포의분화가억제되었다고한다 [21]. 또한 3T3-L1 세포에서 TNFɑ 또는 H 2O 2 를처리한결과 Sepp1의발현이억제되었고, 산화적스트레스와염증반응에의한 Sepp1 의발현억제는지방세포분화와지방합성연관유전자 (lipogenic genes) 들의발현을억제한다고하였다 [21]. 이는지방세포가정상적분화를하기위해서는 Sepp1은정상적으로발현되어야함을의미하며, 본연구에서와같이 selenate의처리에따른 Sepp1의급격한발현변화와 post-mitotic growth arrest 기간 (day 2-day 4) 의낮은발현양상이세포내정상적지방구형성과세포의분화를억제한것으로사료된다. Selenate처리에따른이들 selenoprotein들의분화유도초기급격한발현변화와지방세포분화억제조절에대한기작은앞으로밝혀져야할부분이다. 감사의글 본논문은차세대바이오그린21 사업 ( 과제번호 : PJ007981) 및 2013년도경남과학기술대학교기성회연구비지원에의하여연구되었음. References 1. erg, E.., Wu, J. Y., Campbell, L., Kagey, M. and Stapleton, S. R Insulin-like effects of vanadate and selenate on the expression of glucose-6-phosphate dehydrogenase and fatty acid synthase in diabetic rats. iochimie 77, ock,. C., Kanarek, R.. and prille, J. R Mineral content of the diet alters sucrose-induced obesity in rats. Physiol ehav 57, urk, R. F. and Lane, J. M Ethane production and liver necrosis in rats after administration of drugs and other chemicals. Toxicol ppl Pharmacol 50, Duncan, D Multiple range and multiple F test. iometrics 11, Ezaki, O The insulin-like effects of selenate in rat adipocytes. J iol Chem 265, Gao, Y., Feng, H. C, Walder, K., olton, K., Sunderland, T., ishara, N., Quick, M., Kantham, L. and Collier, G. R Regulation of the selenoprotein SelS by glucose deprivation and endoplasmic reticulum stress - SelS is a novel glucose-regulated protein. FES Lett 563, Kim, C. Y., Kim, G. N., Wiacek, J. L., Chen, C. Y. and Kim, K. H Selenate inhibits adipogenesis through induction of transforming growth factor-β1 (TGF-β1) signaling. iochem iophys Res Commun 426, Kim, C. Y. and Kim, K. H Dexamethasone-induced selenoprotein S degradation is required for adipogenesis. J Lipid Res 54, Kim, K. H., Gao, Y., Walder, K., Collier, G. R., Skelton, J.

7 Journal of Life Science 2014, Vol. 24. No and Kissebah,. H SEPS1 protects RW264.7 cells from pharmacological ER stress agent-induced apoptosis. iochem iophys Res Commun 354, Kryukov, G. V., Castellano, S., Novoselov, S. V., Lobanov,. V., Zehtab, O., Guigó, R. and Gladyshev, V. N Characterization of mammalian selenoproteomes. Science 300, Livak, K. J. and Schmittgen, T. D nalysis of relative gene expression data using real-time quantitative PCR and the 2 - CT method. Methods 25, Lu, J. and Holmgren, Selenoproteins. J iol Chem 284, McNeill, J. H., Delgatty, H. L. and attell, M. L Insulinlike effects of sodium selenate in streptozocin-induced diabetic rats. Diabetes 40, Ozcan, U., Cao, Q., Yilmaz, E., Lee,. H., Iwakoshi, N. N., Ozdelen, E., Tuncman, G., Görgün, C., Glimcher, L. H. and Hotamisligil, G. S Endoplasmic reticulum stress links obesity, insulin action, and type 2diabetes. Science 306, Papp, L. V., Lu, J., Holmgren,. and Khanna, K. K From selenium to selenoproteins: synthesis, identity, and their role in human health. ntioxid Redox Signal 9, Rotruck, J. T., Pope,. L., Ganther, H. E., Swanson,.., Hafeman, D. G. and Hoekstra, W. G Selenium: biochemical role as a component of glutathione peroxidase. Science 179, Schrauzer, G. N Effects of selenium antagonists on cancer susceptibility: new aspects of chronic heavy metal toxicity. J UOEH 20, S Sharma, N. K, Das, S. K., Mondal,. K., Hackney, O. G., Chu, W. S, Kern, P.., Rasouli, N., Spencer, H. J., Yao-orengasser,. and Elbein, S. C Endoplasmic reticulum stress markers are associated with obesity in nondiabetic subjects. J Clin Endocrinol Metab 93, van der Kallen, C. J., van Greevenbroek, M. M., Stehouwer, C. D. and Schalkwijk, C. G Endoplasmic reticulum stress-induced apoptosis in the development of diabetes: is there a role for adipose tissue and liver? poptosis 14, Ye, Y., Shibata, Y., Yun, C., Ron, D. and Rapoport, T membrane protein complex mediates retro-translocation from the ER lumen into the cytosol. Nature 429, Zhang, Y. and Chen, X Reducing selenoprotein P expression suppresses adipocyte differentiation as a result of increased preadipocyte inflammation. m J Physiol Endocrinol Metab 300, E 초록 :3T3-L1 세포에서 selenate 의처리가세포의분화와 selenoprotein 의발현에미치는영향박설희 1 문양수 2 * ( 1 경희대학교의과대학기초의과학과, 2 경남과학기술대학교동물생명과학과 ) 본연구는지방전구세포에서 selenate가지방세포의분화와초기분화조절연관 selenoprotein의유전자발현양상을조사하기위하여실시하였다. Selenate의농도를달리하여 (0-100 μm) 지방전구세포가 confluent한시기, 지방세포분화유도초기 (day0-day2), 분화유도중기 (day2-day4), 또는분화전기간 (day0-day6) 으로구분하여처리한다음세포내지방구형성과소포체 (ER) 스트레스및 selenoptotein 유전자들의발현양상을분석하였다. Selenate 에의한지방세포분화억제효과는지방세포가 post-confluent (cell cycle arrest), 분화유도초기 (mitotic clonal expansion), 또는지속적인처리가주어진상태에서농도의존적으로나타났다 (p<0.05). 그러나 selenate를분화유도중기 (post-mitotic growth arrest) 에처리되었을때는세포분화억제효과가감소하였다. Seps1와 Sepp1의 selenoprotein 유전자들은 mitotic clonal expansion시기에높게발현하였다가 post-mitic growth period에는급격한발현감소현상을나타내었다 (p<0.05). 본연구결과는 selenate에의한지방전구세포의분화억제효과는세포분화초기에효과적인기능이있음을보여주었으며, selenoprotein의분화유도초기와중기의변환지점에이들유전자들의급격한발현변화가 selenate에의한지방세포의분화억제와관련이있는것으로보여진다.

α α α α α

α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를