013~020. Áö¹æ¼¼Æ÷ ºÐÈ�ÁßÀÎ
|
|
- 수연 부
- 5 years ago
- Views:
Transcription
1 3T3-L1 13 DOI : /KPI T3-L1 Received : Accepted : Adipocyte-Related Genes and Transcription Factors were affected by Ganoderma lucidum during 3T3-L1 Differentiation Chae-Woo Lee*, Hyun-Min Yoon*, Kyung-Hwa Kang** Key Words: Ganoderma lucidum (GL), adipocytes, differentiation, energy expenditure *Dept. of Acupuncture & Moxibustion College of Oriental Medicine, Dong-Eui University, Busan, , Republic of Korea ** Department of Oriental Physiology, College of Oriental Medicine, Dongeui University, Busan, , Republic of Korea ABSTRACT In this study, the effects of Ganoderma lucidum (GL) on fat metabolism were performed in 3T3-L1 adipocytes. The effects of GL on 3T3-L1 preadipocytes differentiation were also examined. Our results showed that GL decreased the TG content by ORO staining. To elucidate the mechanism of the effects of GL on lowering TG content in 3T3-L1 adipocytes, we examined whether GL modulate the expressions of transcription factors and adipokines related to control of energy expenditure process because adipokines regulate adipocyte mass and increased expenditure may consume much TG in adipocytes. As a result, the expression of C/EBP, C/EBP, C/EBP, and PPAR, genes, which induce the adipose differentiation and adipose-specific FAS, ap2, and adipsin genes, which compose fat formation were decreased. In addition, GL increased the expression of leptin, UCP2, adiponectin in 3T3-L1 adipocytes, resulting in energy homeostasis. In conclusion, GL could regulate transcript factor related to induction of adipose differentiation and control TG content by up-regulation of adipokines related to fat burn. I Corresponding author : Kyung-Hwa Kang, Dong-Eui Univ. Department of Oriental Physiology, College of Oriental Medicine, Dongeui University, San 45-1, Yangjung 2-Dong, Busanjin -Gu Busan, Korea, , Tel : (82) Fax : (82) , ghkang@deu.ac.kr * This research was suppprted by KPI(Korea Pharwacopuncture Iust. itute) in 2007.
2 FDA polysaccharide triterpene 3T3-L1 Isobutylmethylxanthine(IBMX), Dexamethasone (DEX), bovine serum albumin (BSA) Sigma (USA). 2 (Ganoderma lucidum, GL) (Korea) 300g 1 L 25% ethanol m rotary evaporator 200ml T3-L1 Preadipocytes 5% CO2, 37 DMEM (10% FBS, 100 unit/ml of penicillin G sodium, 100 g/ml of streptomycin sulfate). 100% confluent 0.5mM IBMX, 1 M DEX 1 g/ml insulin (MDI) DMEM 3, 2 1 g/ml insulin DMEM T3-L1 Preadipocytes 0.5mM IBMX, 1 M DEX 1 g/ml insulin, 1%, 2% 3% 3. II 1 3T3-L 1 mouse preadipocytes American Type Culture Collection (ATCC, USA), Dulbecco's Modified Eagle Media (DME- M), bovine calf serum (BCS), fetal bovine serum (FBS), penicillin-streptomycin mixture DMSO GibcoBRL (USA). Insulin, 4. Oil red O Oil red O. phosphate-buffered saline (PBS) 3.7% formalin 10 deionized water Oil red O 30. deionized water 3 microscopic image (Olympus, Tokyo, Japan). DMSO
3 3T3-L1 15 microplate reader (Molecular Devices, USA) 490 nm. 5. RNA Cell TRizol 2 chloroform 10 vortexing 4 14,000rpm 15., isopropanol ,000 rpm 10 75% ethanol 4 7,500 rpm 5. RNA pellet 10 DEPC (diethyl pyrocarbonate)-dw 260nm RNA. 6. RT-PCR 1 g RNA RT-PCR kit (Bioneer, Korea) 45 30, denaturation, 55 ~ annealing, 72 1 extension cycle 30~35, extension 72 5 PCR machine (GeneAmp, PCR system 9700, USA). PCR products 0.5 TBE buffer (45 mm Tris-borate, 1mM EDTA) 2% agarose gel loading 100V 30 etidium bromide. primer Bioneer (Bioneer Co., Korea) (Table 1). 7. SPSS 12.0K for Windows P<0.05. One way-anova Scheffe test. III 1 3T3-L1 confluent (0 day), MDI 1%, 2% 3% Oil red O. MDI MDI % (Figure. 1). Oil red O 4 9 MDI , MDI , 1% MDI , 2% MDI , 3% MDI (Figure. 2). 2. 3T3-L1 adipocytes MDI MDI 1%,2% 3% 9 C/EBP C/EBP PPAR C/EBP C/EBP C/EBP C/EBP mrna 4 9 C/EBP mrna 4 9
4 (Figure 3A). C/EBP PPAR C/EBP mrna 4 9. PPAR mrna 4, 9 3% (Figure 3B). (Figure 5). 3% leptin. UCP mrna 4 9, (Figure 5). Adiponectin mrna 4 9, (Figure 5). IV 3. 3T3-L1 adipocytes MDI MDI 1%, 2% 3% 4 9 fatty acid synthase (FAS) mrna fatty acid binding protein ap2 adipsin mrna. FAS mrna ap2 mrna 4, 9 2% 3%. adipsin mrna 4 9 (Figure 4). 4. 3T3-L1 adipocytes adipokines MDI MDI 1%, 2% 3% 4 9 leptin, UCP2, adiponectin adipokines. Leptin mrna 4, 9 1% 2% 3T3-L1 3T3-L1 adipocytes in vivo adipocytes 3T3-L1 Triglycerol (TG)
5 3T3-L T3-L1 (Figure1 and 2) camp adipogenetic signal CCAAT/enhancer-binding protein (C/EBP) C/EBP adipogenesis peroxisome proliferator-activated receptor (PPAR) C/EBP family PPAR family C/EBP C/EBP C/EBP PPAR C/EBP PPAR adipogenesis leptin, fatty acid synthase (FAS) fatty acid binding protein (ap2) adipogenic gene PPAR PPAR PPAR C/EBP, C/EBP, C/EBP PPAR mrna C/EBP C/EBP mrna C/EBP PPAR mrna (Figure 3) FAS mrna ap2 adipsin mrna (Figure 4) leptin, UCP adiponectin mrna Leptin UCP (uncoupling protein) 2 Adiponectin 2 adiponectine leptin adipokines dedifferentiation V 3T3-L1 1. 3T3-L1 2. C/EBP C/EBP
6 mrna C/EBP PPAR mrna FAS mrna ap2 adipsin mrna 3. leptin, UCP adiponectin mrna dedifferentiation 1. Stein CJ, C.G., The epidemic of obesity. J Clin Endocrinol Metab, : p Kopelman, P., Obesity as a medical problem. Nature, : p Ahima RS, F.J., Adipose tissue as an endocrine organ. Trends Endocrinol Metab., (8): p Kim, M., Updates in treating obesity. Korean J Health Psychol., : p Reddy P, C.M., Focus on orlistat: A nonsystemic inhibitor of gastrointestinal lipase for weight reduction in the management of obesity. Formulary, : p Seo, Y., Patent trend of anti-obesity supplmentary food. Food World, : p Lee SZ. Compendium of Materia Medica. 2007, Yeoil Nogami M, I.M., Kubo M, Takahashi M, Kimura H, Matsuike Y., Studies on Ganoderma lucidum. VII. Anti-allergic effect. (2) Yakugaku Zasshi., (7): p Futrakul N, B.M., Patumraj S, Siriviriyakul P, Tosukhowong P, Futrakul P., Treatment of glomerular endothelial dysfunction in steroidresistant nephrosis with Ganoderma lucidum, vitamins C, E and vasodilators. Clin Hemorheol Microcirc., (3-4): p Chen WQ, L.S., Ll HZ, Yang H., Effects of ganoderma lucidum polysaccharides on serum lipids and lipoperoxidation in experimental hyperlipidemic rats. Zhongguo Zhong Yao Za Zhi, (17): p Qi G, H.H., Gao Y, Lin Q, Yu GY, Effects of Ganoderma lucidum spores on sialoadenitis of nonobese diabetic mice. Chin Med J (Engl), (5): p Lin, Z.B., Cellular and molecular mechanisms of immuno-modulation by Ganoderma lucidum. J Pharmacol Sci., (2): p Jiang J, G.B., Thyagarajan A, Sliva D, Ganoderic acids suppress growth and invasive behavior of breast cancer cells by modulating AP-1 and NF-kappaB signaling. Int J Mol Med., (5): p Lee DH. Incurable Disease and herbal pharmacopuncture therapy. Journal of Korean pharmacopuncture institute, (1): p Lee CW, Yoon HM, Kang KH, The effects of Ganoderma lucidum herba pharmacopuncture on 3T3-L1 preadipocyte differentiation. Journal of Korean pharmacopuncture institute, (3): p MacDougald OA, H.C., Fan H, Lane MD Regulated expression of the obese gene product (leptin) in white adipose tissue and 3T3-L1 adipocytes. Proc Natl Acad Sci USA, (20): p Klaus, S., Adipose tissue as a regulator of energy balance. Curr Drug Targets., (3): p ` 18. Koldovsky O, D.M., Drahota Z, Hahn P., Developmental aspects of lipid metabolism. Physiol Res., (6): p Gregoire FM, S.C., Sul HS, Understanding adipocyte differentiation. Physiol Rev.,
7 3T3-L : p Camp HS, R.D., Leff T., Adipogenesis and fatcell function in obesity and diabetes. Trends Mol Med., (9): p Long SD, P.P., Lipid mediators of insulin resistance: ceramide signalling down-regulates GLUT4 gene transcription in 3T3-L1 adipocytes. Biochem J., : p Hwang CS, L.T., Mandrup S, Lane MD, Adipocyte differentiation and leptin expression. Annu Rev Cell Dev Biol., : p Ceddia RB, W.W.J., Lima FB, Flandin P, Curi R, Giacobino JP, Leptin stimulates uncoupling protein-2 mrna expression and Krebs cycle activity and inhibits lipid synthesis in isolated rat white adipocytes. Eur J Biochem., (19): p Berg AH, C.T., Du X, Brownlee M, Scherer PE., The adipocyte-secreted protein Acrp30 enhances hepatic insulin action. Nat Med., (8): p Antuna-Puente B, F.B., Fellahi S, Bastard JP., Adipokines: the missing link between insulin resistance and obesity. Diabetes Metab., (1): p Table 1. Primers for RT-PCR Target mrna SEQUENCE(5-3 ) C/EBP F GTGTGCACGTCTATGCTAA R GCCGTTAGTGAAGAGTCTC C/EBP F GTTTCGGGAGTTGATGCAA R AACAACCCCGCAGGAACAT C/EBP F GATCTGCACGGCCTGTTGT R CTCCACTGCCCACCTGTCA PPAR F CGCTGATGCACTGCCTATG R TGCGAGTGGTCTTCCATCA FAS F TGGTGGGTTTGGTGAATTG R GCTTGTCCTGCTCTAACTG ap2 F CCAATGAGCAAGTGGCAAG R GATGCCAGGCTCCAGGATA Leptin F CCAAAACCCTCATCAAGAC R CTCAAAGCCACCACCTCTG Adiponectin F GGAGATGCAGGTCTTCTTGG R TCCTGATACTGGTCGTAGGT UCP2 F AACAGTTCTACACCAAGGGC R AGCATGGTAAGGGCACAGTG Adipsin F CTGCTGGACGAGCAGTGG R GATGACACTCGGGTATAGT 1&S F GTAACCCGTTGAACCCCATT R CCATCCAATCGGTAGTAGCG F: forward, R: reverse Figure 1. Effects of GL on the 3T3-L1 preadipocytes differentiation. 3T3-L1 adipocytes were observed 4 and 9 days after the initiation of differentiation and were treated with 1-3% of GL (B) for 72 h at 37 C in a humidified 5% CO2 incubator. (A) undifferented cells, (B) Control was treated with MDI to induce differentiation, (C, D, and E) MDI and 1%, 2%, and 3% of GL were treated Figure 2. Effects of GL on oil red O stained material in 3T3-L1 adipocytes. 3T3-L1 adipocytes were harvested 4 and 9 days after the initiation of differentiation and were stained with oil red O (A). Cells were treated with 1-3% of GL (B) for 72 h at 37 C in a humidified 5% CO2 incubator. Cells were stained with oil red O. The reported values are the means SD (n = 4). a; p 0.05 vs undifferentiated cells, b; p 0.05 vs differentiated cells
8 Figure 3. Effect of GL on mrna levels of C/EBP and C/EBP (A), and C/EBP and PPAR (B) in 3T3- L1 adipocytes. 3T3-L1 adipocytes were harvested 4 and 9 days after the initiation of differentiation. Cells were treated with 1-3% of GL for 72 h at 37 C in a humidified 5% CO2 incubator. 1: undifferented cells, 2: Control was treated with MDI to induce differentiation, 3, 4, and 5: MDI and 1%, 2%, and 3% of GL were treated Figure 5. Effect of GL on mrna levels of Leptin, UCP2, and Adiponectin in 3T3-L1 adipocytes. 3T3-L1 adipocytes were harvested 4 and 9 days after the initiation of differentiation. Cells were treated with 1-3% of GL for 72 h at 37 C in a humidified 5% CO2 incubator. 1: undifferented cells, 2: Control was treated with MDI to induce differentiation, 3, 4, and 5: MDI and 1%, 2%, and 3% of GL were treated Figure 4. Effect of GL on mrna levels of FAS, ap2 and adipsin in 3T3-L1 adipocytes. 3T3-L1 adipocytes were harvested 4 and 9 days after the initiation of differentiation. Cells were treated with 1-3% of GL for 72 h at 37 C in a humidified 5% CO2 incubator. 1: undifferented cells, 2: Control was treated with MDI to induce differentiation, 3, 4, and 5: MDI and 1%, 2%, and 3% of GL were treated
Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information27 2, 17-31, , * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** ( :
27 2, 17-31, 2009. -, * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** (: dminkim@cau.ac.kr) 18 한국교육문제연구제 27 권 2 호, 2009. Ⅰ. (,,, 2004). (,, 2006).,,, (Myrick,
More informationSheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120:
Sheu HM, et al., British J Dermatol 1997; 136:884-890 Kao JS, et al., J Invest Dermatol 03; 1:446-464 1 10 0 3 Day Normal MLE Lotion Lotion MLE Cream Cream 80 7 70 6 3 Day Normal MLE Lotion Lotion MLE
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More information歯5-2-13(전미희외).PDF
The Korean Journal of Counseling 2004, Vol. 5, No. 2, 423-434,. 4 5 18 9, 9.,,,,,.,,, t-.. :,,, (,, 1996),.,,. (, 2001),... 88 98 2000, 88 12.5%(250 )98 35.6%(712 )2.8 (,,, 2001) (Corresponding Author)
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information이 발명을 지원한 국가연구개발사업 과제고유번호 KGM2420913 부처명 교육과학기술부 연구관리전문기관 연구사업명 전북분원운영사업 연구과제명 저탄소 녹생성장을 위한 바이오매스/에너지 개발 주관기관 한국생명공학연구원 연구기간 2009년 01월 01일 ~ 2009년 12월
(19) 대한민국특허청(KR) (12) 등록특허공보(B1) (45) 공고일자 2015년04월10일 (11) 등록번호 10-1509796 (24) 등록일자 2015년04월01일 (51) 국제특허분류(Int. Cl.) A61K 36/45 (2006.01) A23L 1/30 (2006.01) A61P 3/04 (2006.01) (21) 출원번호 10-2009-0108173
More information12이문규
Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: * The
Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.243-268 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.243 * - 2001 2015 - The Research Trends on Peer Counseling in Elementary and
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More information농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다 년 2 월 11 일 - 1 -
농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다. 2013 년 2 월 11 일 - 1 - 연구기관명 : 부산대학교 연구책임자 : 정명호 연구원 : 손용해 연구원 : 장민경 - 2 - Ⅰ. 제목 팥의대사성질환개선및기능성규명 Ⅱ. 연구개발의목적및필요성 팥의대사성질환개선소재발굴과그기능성을과학적으로증명하기위해, 팥의당뇨,
More information10(3)-10.fm
w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction
More informationMay 10~ Hotel Inter-Burgo Exco, Daegu Plenary lectures From metabolic syndrome to diabetes Meta-inflammation responsible for the progression fr
May 10~12 2012 Hotel Inter-Burgo Exco, Daegu Plenary lectures From metabolic syndrome to diabetes Meta-inflammation responsible for the progression from obesity to metabolic syndrome originates in the
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
More information54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3
27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,
More informationMicrosoft PowerPoint - Ch4. 생인공지방
Ch.4 Adipose in Tissue Engineering Cell Sources & Tissue Procurement Cell line: homogeneous, same stage of differentiation Primary Cell: in vivo condition 과유사 (varying stage of development) 위치 (epididymal
More information<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 4, pp DOI: * A Study on Teache
Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp.149-171 DOI: http://dx.doi.org/10.21024/pnuedi.27.4.201712.149 * A Study on Teachers and Parents Perceptions on the Introduction of Innovational
More information16_이주용_155~163.hwp
사상체질의학회지 2008;20(2):155-163 J of Sasang Constitutional Medicine Vol. 20, No. 2, 2008:155-163 http://www.esasang.com 腦 梗 塞 으로 발생한 少 陽 人 半 身 舞 蹈 病 患 者 치험 1례 이주용 이한얼 한경수 안택원 Abstract 대전대학교 한의과대학 사상체질과 A Soyangin
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education
More informationAbstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
More informationA Study on the Relationships between Self-Differentiation and Adaptability Factors for Senior Dementia Patients Care Givers Department of Social Welfare, Seoul Welfare Graduate University Full-time Lecturer
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI: 3 * Effects of 9th
Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp.357-378 DOI: http://dx.doi.org/10.21024/pnuedi.29.2.201906.357 3 * Effects of 9th Grade Students Participation in Career Curriculum Cluster
More information2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, )
Abstract Kim Dal-Rae, Kim Sun-Hyung* Dept. of Sasang Constitutional Medicine, College of Oriental Medicine, Kyung-Hee Univ. *Dept. of Sasang Constitutional Medicine, East-West Neo Medical Center, Kyung-Hee
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More informationKor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on
More information025~038-오공약침의
25 DOI : 10.3831/KPI.2008.11.4.025 A Study on Subchronic Toxicity Test and Method of Increasing Output of Scolopendrid Pharmacopuncture Kim Sung-chul *Dept. of Acupuncture & Moxibustion, Gwang-Ju Oriental
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI: An Exploratory Stud
Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp.423-441 DOI: http://dx.doi.org/10.21024/pnuedi.29.1.201903.423 An Exploratory Study on the Improvement of Democratic Consultative Culture
More information04조남훈
Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache
More information- 1 -
11 1541000-001436-01 수출전략형신수요창출을위한홍마늘및바이오식품개발 (Development of red-garlic and its bio-food for create new market demand and develop of export items) - 1 - - 2 - - 3 - o o - 4 - o o - 5 - o α α - 6 - - 7
More information(....).hwp
sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
More information5
26 3 (2005 9 ) J Korean Oriental Med 2005;26(3):55-65 The Effcects of Psoraleae fructus Extract on Melanin Synthesis of B16 Melanoma Cells Jae-Ho Chung, Hyung-Sik Seo Dept. of Ophthamology, Otolaryngology
More information( )Jkstro011.hwp
비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy
More informationMicrosoft Word doc
KISEP Rhinology Korean J Otolaryngol 2006;49:307-12 사람정상코점막상피세포에서겔형성점소 (Gel-Forming Mucin) 분비에대한 Prostaglandin E 2 의효과 김진국 1 김창훈 2,3 김규보 2 장현종 1 김현직 2 윤주헌 2,3,4 Effect of Prostaglandin E 2 on Gel-forming
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI: * Suggestions of Ways
Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp.65-89 DOI: http://dx.doi.org/10.21024/pnuedi.29.1.201903.65 * Suggestions of Ways to Improve Teaching Practicum Based on the Experiences
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More information2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285
13 2 ( 25 ) 2004 12 Korean J Med Hist 13 284 296 Dec 2004 ISSN 1225 505X 1) * ** ** 1 1920 1930 40 ( 1896-1973) 80 * ** 1) 2003 284 2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More informationJournal of Educational Innovation Research 2016, Vol. 26, No. 3, pp DOI: Awareness, Supports
Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp.335-363 DOI: http://dx.doi.org/10.21024/pnuedi.26.3.201612.335 Awareness, Supports in Need, and Actual Situation on the Curriculum Reconstruction
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More informationJournal of Educational Innovation Research 2016, Vol. 26, No. 3, pp DOI: * The Grounds and Cons
Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp.63-81 DOI: http://dx.doi.org/10.21024/pnuedi.26.3.201612.63 * The Grounds and Consequences of the Elementary School Teachers' Trust Formation
More informationMHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
More information07-1960(JH)
한국두피모발미용학회지 제5권 제1호 2009 The Journal of Beauty & Trichology 5(1), 00~00(2008) 1960년대 뷰티 및 패션트렌드 분석 - 모델 트위기 (Twiggy) 를 중심으로 - 김희선* 안양과학대학 뷰티디자인학부 Analysis of Beauty and Fashion trends in the 1960 s - Focusing
More informationAbstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
More informationWnt signaling 과 adipogenesis
Wnt signaling 과 adipogenesis 지방 조직(adipose tissue)을 이루는 지방세포(adipocyte)는 지방(fat)을 포함하고 있는 세 포로써 체내 지방 대사를 조절 하는 것 뿐 아니라 여러가지 분비물질들을 통하여 식욕 조절 등의 기능을 하는 것이 잘 알려져 있으며 당 대사에도 관여하여 전반적인 에너지 항상성 유 지를 담당하고 또한
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More informationA Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
More information<B1A4B0EDC8ABBAB8C7D0BAB8392D345F33C2F75F313032362E687770>
광고에 나타난 가족가치관의 변화 : 97년부터 26년까지의 텔레비전 광고 내용분석* 2) 정기현 한신대학교 광고홍보학과 교수 가족주의적 가치관을 사회통합의 핵심 중의 핵심으로 올려놓았던 전통이 현대사회에서 아직 영향력을 미치는 점을 감안할 때, 한국에서의 가족변동은 사회전반의 변동으로 직결된다고 해도 크게 틀리지 않을 것이다. 97년부터 26년까지 텔레비전에서
More information???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
More information077~088 해계 유침과 전침이
loperamide 77 DOI : 10.3831/KPI.2009.12.4.077 loperamide Received : 09. 10. 21 Accepted : 09. 11. 04 The Effect of Acupuncture and Electro-acupuncture at ST41 on Intestinal Hypomotility Induced with Loperamide
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A S
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.461-487 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.461 * - 2008 2018 - A Study on the Change of Issues with Adolescent Problem
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con
Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency
More information<30382EC0C7C7D0B0ADC1C22E687770>
대한내과학회지: 제 76 권 제 2 호 2009 의학강좌-개원의를 위한 모범처방(Current Clinical Practice) 간기능검사의 이해와 적용 인제대학교 의과대학 일산백병원 내과학교실 김 경 아 Understanding and application of liver function tests Kyung-Ah Kim, M.D. Department of
More information<31335FB1C7B0E6C7CABFDC2E687770>
에너지기후변화교육 4(2):203~211(2014) 203 초등학교 교과서 에너지 단원의 탐구활동과 시각자료 기능 분석 사례 연구 신명경 권경필 * 경인교육대학교 Abstract : This study aimed to analyze energy related inquiry activity and visual materials in elementary textbook.
More informationuntitled
pissn 2287-3368 / eissn 2287-3376 ORIGINAL ARTICLE Korean Journal of Acupuncture Vol.31, No.4, pp.168-178, 2014 http://dx.doi.org/10.14406/acu.2014.025 마황천오약침액이 3T3-L1 지방세포분화및유전자발현에미치는영향 동의대학교한의과대학생리학교실
More information:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( )
:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α=.83.91.,.,,..,,,.,. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ..,.,.,. Bandura(1997),.,,,,., (,,, 2009), (,,,, 2014).?.,,,.. Bandura (1995) (Resiliency
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More information°ø±â¾Ð±â±â
20, 30, 40 20, 30, 40 1 2 3 4 5 6 7 8 9 10 3.1 6.3 9.4 12.6 15.7 18.8 22.0 25.1 28.3 31.4 2.4 4.7 7.1 9.4 11.8 14.1 16.5 18.8 21.2 23.6 7.1 14.1 21.2 28.3 35.3 42.4 49.5 56.5 63.6 70.7 5.9 11.9 17.8 23.7
More information232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특
한국도시행정학회 도시행정학보 제25집 제4호 2012. 12 : pp.231~251 생활지향형 요소의 근린주거공간 분포특성 연구: 경기도 시 군을 중심으로* Spatial Distribution of Daily Life-Oriented Features in the Neighborhood: Focused on Municipalities of Gyeonggi Province
More information분 기 보 고 서 (제 47 기) 사업연도 2014년 01월 01일 2014년 03월 31일 부터 까지 금융위원회 한국거래소 귀중 2014년 5월 30일 제출대상법인 유형 : 면제사유발생 : 주권상장법인 해당사항 없음 회 사 명 : 파미셀 주식회사 대 표 이 사 : 김
목 분 기 보 고 서...1 대표이사 등의 확인...2 I. 회사의 개요...3 1. 회사의 개요...3 2. 회사의 연혁...4 3. 자본금 변동사항...7 4. 주식의 총수 등...9 5. 의결권 현황...10 6. 배당에 관한 사항 등...10 II. 사업의 내용...12 III. 재무에 관한 사항...30 IV. 감사인의 감사의견 등...34 V. 이사의
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More information???? 1
The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1
More information109~120 õÃʾàħ Ä¡·á
109 DOI : 10.3831/KPI.2010.13.3.109 Received : 10. 08. 13 Revised : 10. 09. 06 A Case Study Of Patients With Knee Joint Pain Treated With Rubiae Radix Pharmacopuncture Accepted : 10. 09. 07 Key Words:
More information135 Jeong Ji-yeon 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 머리말 협저불상( 夾 紵 佛 像 )이라는 것은 불상을 제작하는 기법의 하나로써 삼베( 麻 ), 모시( 苧 ), 갈포( 葛 ) 등의 인피섬유( 靭 皮 纖 維 )와 칠( 漆 )을 주된 재료
MUNHWAJAE Korean Journal of Cultural Heritage Studies Vol. 47. No. 1, March 2014, pp.134~151. Copyright 2014, National Research Institute of Cultural Heritage 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 정지연 a 明 珍 素 也
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More information서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소
2012 년도기초과학연구소 대학중점연구소심포지엄 마이크로파센서를이용한 혈당측정연구 일시 : 2012 년 3 월 20 일 ( 화 ) 14:00~17:30 장소 : 서강대학교과학관 1010 호 주최 : 서강대학교기초과학연구소 Contents Program of Symposium 2 Non-invasive in vitro sensing of D-glucose in
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
More information전체 목차 1. 주류 일반 2. 기능성 3. 숙취 4. 주세법 5. 주류 일반 상식 6. 우리술 즐기기
국순당 배중호 대표의 우리 술 강좌 : 백세주 성공신화, 그 비결 전체 목차 1. 주류 일반 2. 기능성 3. 숙취 4. 주세법 5. 주류 일반 상식 6. 우리술 즐기기 1. 주류 일반 술 소비량으로 본 세계지도 집값으로 본 세계지도 군사비 지출로 본 세계지도 1. 주류 일반 주류일반 전통주 정의 전통주 특징 전통주 역사 국순당과 전통주 계승 전통주 담그기
More informationECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of
More information(Microsoft PowerPoint - S13-3_\261\350\273\363\307\366 [\310\243\310\257 \270\360\265\345])
Cardiovascular Disease in Metabolic Syndrome 김상현 보라매병원내과 서울대학교의과대학내과학교실 Contents Metabolic syndrome and Cardiovascular system CVD Mortality Coronary artery disease Heart failure Atrial fibrillation Management
More information1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
More information,......
The Impact of Personal Traits, Family Characteristics, and Job Satisfaction on the Psychological Well-Being of Middle Aged Men from the Baby Boomer Generation Working in Large Corporations Department of
More information페링야간뇨소책자-내지-16
야간뇨의진단과치료 - 실제적접근 - Reference 1. Choo MS, Ku JH, Park CH et al. Prevalence of Nocturia in a Korean Population Aged 40 to 89 Years. Neurourol Urodyn 2008; 27:60-64. 2. Weiss JP. Prevalence
More information이용석 박환용 - 베이비부머의 특성에 따른 주택유형 선택 변화 연구.hwp
住居環境 韓國住居環境學會誌 第 11 卷 1 號 ( 通卷第 20 號 ) pp. 159~172 투고 ( 접수 ) 일 : 2013.02.28. 게재확정일자 : 2013.04.04. The change of housing choice by characteristics of the Baby Boomers Lee, Yong-Seok Park, Hwan-Yong Abstract
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 16 Jul.; 27(7), 64662. http://dx.doi.org/./kjkiees.16.27.7.646 ISSN 1226-3133 (Print)ISSN 2288-226 (Online) 2D Microwave Image
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More information제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상
6차 산업 수익모델 시범사업 농산물가공품개발 연구용역 최 종 보 고 서 영남대학교 식품공학과 연구책임자 : 한 기 동 제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 2, pp DOI: IPA * Analysis of Perc
Journal of Educational Innovation Research 2018, Vol. 28, No. 2, pp.45-72 DOI: http://dx.doi.org/10.21024/pnuedi.28.2.201806.45 IPA * Analysis of Perception and Needs on Teaching Competencies of Faculty
More information대한한의학원전학회지24권6호-전체최종.hwp
小兒藥證直訣 의 五臟辨證에 대한 小考 - 病證과 處方을 중심으로 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 ㆍ 韓醫學古典硏究所 白裕相1,2*1)2) A study on The Diagnosis and Treatment Using The Theory of Five Organs in Soayakjeungjikgyeol(小兒藥證直訣) 1 Dept. of Oriental
More information<33372DC7D7B3EBC8ADC8ADC0E5C7B02E687770>
논문접수일 : 2013.09.24 심사일 : 2013.10.06 게재확정일 : 2013.10.25 항노화화장품의 국내현황과 항노화관심도에 따른 자외선차단제소비성향조사 Status and anti-aging cosmetics Interest in accordance with anti-aging sunscreen Consumption Survey 주저자 : 김미영
More informationuntitled
Journal of Korean Medicine Rehabilitation Vol. 23 No. 3, July 2013 pissn 1229-1854 eissn 2288-4114 Original Article 봉독약침이 흰쥐의 국소뇌혈류량 및 평균혈압에 미치는 영향 민선정 염승룡 권영달 원광대학교 한의과대학 한방재활의학과교실 Effects of Bee Venom
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More information