untitled
|
|
- 지효 추
- 5 years ago
- Views:
Transcription
1 pissn / eissn ORIGINAL ARTICLE Korean Journal of Acupuncture Vol.31, No.4, pp , 마황천오약침액이 3T3-L1 지방세포분화및유전자발현에미치는영향 동의대학교한의과대학생리학교실 Effects of Mahuang-Chuanwu(Mahwang-Cheonoh) Pharmacopuncture Solution on Adipocyte Differentiation and Gene Expression in 3T3-L1 Adipocytes Kyung-Hwa Kang Department of Physiology, College of Korean Medicine, Dong-Eui University Objectives : Mahuang-Chuanwu(Mahwang-Cheonoh) Pharmacopuncture(MCP) has been used to treat obesity in Clinical Korean Medicine. MCP solution(mcps) is also expected to have strong anti-obesity activities. However, little is known about the mechanisms of its inhibitory effects on adipocyte differentiation and lipogenesis. Methods : In the present study, we examined the effects of MCPS on differentiation and lipogenesis of 3T3-L1 adipocytes. To elucidate the mechanism of the effects of MCPS on lowering lipid content in 3T3-L1 adipocytes, we examined whether MCPS modulates the expressions of transcription factors to induce lipogenesis and adipogenic genes related to regulate the accumulation of lipids. Results : Our results showed that MCPS significantly inhibited differentiation and lipogenesis of 3T3-L1 adipocytes in a dose-dependent manner. MCPS suppressed the mrna expressions of cytidine-cytidine-adenosine-adenosine-thymidine(ccaat)/enhancer binding proteins α(c/ebpα), C/EBP β, C/EBPδ, and peroxisome proliferator-activated receptor γ(pparγ) genes related to the induction of adipose differentiation. MCPS inhibited the mrna expressions of adipose-specific ap2, adipsin, lipoprotein lipase(lpl), CD36, TGF-β, and leptin genes related to the fat formation. MCPS downregulated the mrna expressions of liver X receptor(lxr) α and fatty acid synthase(fas) genes related to the induction of lipogenesis. In addition, MCPS reduced the production of adipocyte-induced pro-inflammatory cytokines. Conclusions : MCPS could regulate the accumulation of lipids and expression of adipogenic genes via inhibition of transcript factors related to induction of adipose differentiation. Key words : Mahuang-Chuanwu(Mahwang-Cheonoh) Pharmacopuncture (MCP), 3T3-L1 adipocytes, differentiation, adipogenesis, lipogenesis 서 론 식사와생활습관의변화로비만인구가전세계적으로증가하고, 점차비만연령이낮아지는추세에있다. 또한비만은당뇨병, 고지혈증과심혈관계질환등의심각한대사성질환을동반하고, 그발병의직접적인유발원인으로인식되고있어비만의조절이사회적 Received September 25, 2014, Revised November 27, 2014, Accepted November 27, 2014 Corresponding author: Kyung-Hwa Kang Department of Physiology, College of Korean Medicinem, Dong-Eui Universitym, 52-57, Yangjeongro, Busanjin-gu, Busan , Korea Tel: , Fax: , ghkang@deu.ac.kr This work was supported by Dong-eui University Foundation Grant(2014AA132). CC This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. 168 Copyright 2014, SOCIETY FOR MERIDIAN AND ACUPOINT
2 Effects of MCPS on Adipocyte Differentiation and Gene Expression 이슈로대두되고있다 1). 비만은체내과잉에너지가지방세포의증식과비대에의해지방조직으로과다축적된상태로비정상적인지방대사를유발하고내분비이상을초래한다. 그러므로최근비만의조절을위해지방세포의분화증식과세포내지질축적의기전을제어하는방법에대한연구가많이이루어지고있다. 한의학에서는비만의조절을위해다양한치료방법이사용되고있는데, 약침요법도이러한치료법의하나로환자의질병을근거로혈위의치료작용과약물의약리작용을결합하여질병을치료하는방법이다. 약침요법은약리효과가소화기관을통과하지않고나타나므로적은양의약물로도경구섭취에비해우수한치료효과를나타내는특징이있다 2). 마황 (Ephedra sinica Stapf) 은대표적인신온해표약 ( 辛溫解表藥 ) 으로발산풍한 ( 發散風寒 ), 선폐평천 ( 宣肺平喘 ), 이수소종 ( 利水消腫 ) 의효능을가지고비만, 호흡기질환, 피부질환, 순환기질환등에많이응용되고있으나, 부작용으로빈맥, 혈관수축, 일시적인고혈압, 기관지확장, 불면증, 자한, 식욕감퇴, 심계항진, 두통등이나타날수있는것으로보고되고있다 3). 동의보감에서마황의최고사용용량은 24 g이며, 이는에페드린함량으로환산할경우미국 FDA 에서의약품으로허용하고있는최고에페드린의함량기준이하이므로비만과체중조절을위해적절히사용할경우효과적인치료가가능할것으로생각된다 4). 천오 (Aconitum carmichaeli Debx) 는대표적인온리약 ( 溫裏藥 ) 으로거풍습 ( 祛風濕 ), 산풍사 ( 散風邪 ), 온경지통 ( 溫經止痛 ) 의효능을가지고풍한습비 ( 風寒濕痺 ) 나역절풍 ( 歷節風 ), 중풍 ( 中風 ) 등에응용되고있으며, 수족마비, 호흡마비, 심계항진, 혈압강하등의부작용을가지고있다 5). 그러나, 마황추출물및약침제제의안전성은면역독성, 발열성시험, 용혈독성시험, 아급성및급성독성시험등의실험연구를통해평가되었으며 6-8), 초오추출물및약침제제의안전성도독성시험실험연구를통해평가되었다 9,10). 또한마황천오약침제제의안전성및유효성에대한설문조사분석연구를통해서도안정성이인정되었다 11). 이와같이마황과천오는풍한 ( 風寒 ) 을발산하고경락을소통하게하여기혈순환을원활하게하고신진대사를활발하게하는작용을통해비만에응용가능할것으로생각된다. 현재한의학에서임상적으로비만치료에마황과천오가많이응용되고있으며, 마황천오약침에대한선행연구로비만치료에대한문헌적고찰과비만환자를대상으로한연구가보고되었다 12,13). 비만치료를위한마황과천오의사용에대한지속적인연구를통해적절하게임상에서응용한다면다양한난치성질환을극복하 는데도움이될것으로생각된다. 이에저자는마황천오약침제제가지방세포의분화와지방생성에미치는억제효과를조사하기위하여지방전구세포의분화, 지방구생성과매개물질분비와이와관련있는유전자의발현에미치는영향을조사하여다음과같은결과를보고하는바이다. 실험방법 1. 재료 3T3-L1 mouse preadipocytes는 American Type Culture Collection(ATCC, USA) 에서분양받아사용하였고, Dulbecco's Modified Eagle's Medium(DMEM), bovine calf serum(bcs), fetal bovine serum(fbs), penicillin-streptomycin mixture 및 dimethylsulfoxide(dmso) 는 GibcoBRL(USA) 로부터구입하였다. Insulin, isobutylmethylxanthine(ibmx), dexamethasone(dex), tetrazolium bromide salt(mtt), dimethylsulfoxide(dmso), bovine serum albumin(bsa) 는 Sigma(USA) 로부터구입하였다. 2. 마황천오약침액 (Mahuang-Chuanwu Pharmacopuncture Solution, MCPS) 조제 MCPS 는대한약침학회에서구입하여사용하였다. 조제방법은간략히설명하면마황과천오를원적외선으로건조하여압출성형기법으로평균직경 10 μm 의초미세분말을추출하였고, 수율은 25% 였다. 건조된분말 100 g을반응조하부에넣고 3차증류수 1.5 L를부어서 impellar, 반응조하부, 반응조상부, 냉각관 ( 직류, 환류 ), 분액여두를설치하고약 60분동안약재를불린후 105 o C로 120분간전탕하여찌꺼기를따로분리하였다. 전탕액을무균실에있는증류추출기에넣고 107 o C로 3시간이상추출하였다. 추출된약침액은무기염류를침강시키기위해서하루동안냉장보관하고, 무균실에서무기염류를제외한상층액을분리하여염도 0.98%, ph 로조절한후 0.45 μm, 0.2 μm, 0.1 μm 필터로 3차여과하여 MCPS 1,000 ml을얻었다. 멸균된 vial병에여과된약침액을각각 20 ml씩소분하여 120 o C로 30분간고압멸균하여 -20 o C에저장하였다가실험에사용하였다. 3. 세포생존률측정 3T3-L1 전구지방세포에대한 MCPS 의독성여부를알아보기위하여 MTT assay를시행하였다. 24 well plate(corning, NY, USA) 에 cells/well 의농도로세포를 DMEM 배양액에분주 169
3 하여 24 시간동안안정화시킨후, MCPS 을농도별 (0, 5%, 10%) 로처리하여 48 시간동안반응시켰다. 배양액을제거한후 5 mg/ml 의 MTT 를각 well 에넣고잘섞어준후최대 4시간 37 o C incubator 에서배양한후 tetrazolium bromide salt를제거하고각 well에 DMSO 를 100 μl 씩분주하여생성된 formazan 이잘녹을수있게충분히흔들어모두녹인후 ELISA(Molecular Devices, Sunnyvale, California, USA) 를사용하여 540 nm에서흡광도를측정하였다. 4. 세포배양및분화지방세포의분화를위해, 3T3-L1 전구지방세포는 5% CO 2, 37 o C 배양기에서 DMEM(10% FBS, 100 unit/ml of penicillin G sodium, 100 μg/ml of streptomycin sulfate) 으로배양하였다. 100% confluent 한상태에서 2일후 0.5 mm IBMX, 1 μm DEX 와 1 μg/ml insulin 의분화유도물질 (MDI) 이포함된 DMEM 으로교환하여 2 3 일동안분화를유도하였으며, 그후매 2일마다 1 μg/ml insulin 이포함된 DMEM으로교환하였다. 분화 8일후세포는분석을위해사용되었다. 실험군은 3T3-L1 전구지방세포에분화유도를하지않은미분화군, 3T3-L1 전구지방세포에 0.5 mm IBMX, 1 μm DEX 와 1 μg/ml insulin 을처리하여 8일동안분화를유도한분화유도군 (MDI), 3T3-L1 전구지방세포에 8일동안분화유도와 MCPS 각각 5% 와 10% 의농도로처리한군 (MCPS) 으로나누었다 (Fig. 1). 5. Oil-Red O 염색세포내지방구생성을확인하기위하여 Oil red O 염색을실시하였다. 배양된세포는 phosphate-buffered saline(pbs) 로세척한 후 3.7% formalin 으로 5분간고정하고 deionized water 로세척하여 Oil red O를처리한후실온에서 30분간염색하였다. 그후염색액을제거하고 deionized water 로 3회세척하여염색된세포를 microscopic image(olympus, Japan) 로관찰하였다. 또한정량을위해 DMSO 를가하여지방을추출한후 microplate reader (Molecular Devices, Sunnyvale, California, USA) 를사용하여 490 nm에서흡광도를측정하였다. 6. ELISA assay 24 well plate(corning, NY, USA) 에 cells/well의농도로세포를 DMEM 배양액에분주하고 24시간동안안정화시켰다. MDI에의한분화 8 일후세포상층액을사이토카인분석을위해사용되었다. IL-1β, TNF-α, GM-CSF, IFN-γ, IL-6를 ELISA kit(bd Biosciences Pharmingen, San Diego, CA, USA) 를이용하여측정하였다. 7. RNA 추출및 RT-PCR Cell 에 TRizol 을넣고 2분간방치하였다가세포를떼어낸후 chloroform 을넣고 10초간강하게 vortexing 하고 4 o C 14,000 rpm에서 15분간원심분리하였다. 원심분리후, 상층액을취하여동량의 isopropanol 을혼합하여흔들어준후실온에 10분간방치하였다. 그후 4 o C 14,000 rpm에서 10분간원심분리하여상층액을제거하고 75% ethanol 을넣고섞어준후 4 o C 7,500 rpm에서 5분간원심분리하였다. RNA pellet 은 10분간실온에서건조시키고 DEPC(diethyl pyrocarbonate)-dw 에녹여 260 nm에서흡광도를측정하여 RNA 농도를계산하였다. 1 μg의 RNA 를취하여 RT-PCR kit(bioneer, Daejeon, Korea) 를사용하여 45 o C에서 30 Fig. 1. The Experimental Scheme of Differentiation of 3T3-L1 Preadipocytes. The 2-day post-confluent 3T3-L1 preadipocytes were treated with MDI(0.5 mm IBMX, 1 μm DEX and 1 μg/ml insulin) for 48 hrs. Cells were then replaced with maintenance media containing 1 μg/ml insulin every 2 days for 8 days. To investigate effect of MCPS on adipogenesis, the differentiating 3T3- L1 cells were treated every 2 days with MCPS for 8 days
4 Effects of MCPS on Adipocyte Differentiation and Gene Expression Table 1. The Primers for RT-PCR Target gene Oligonuclotide sequences (5' to 3' direction) Target gene Oligonuclotide sequences (5' to 3' direction) C/EBPβ F GTTTCGGGAGTTGATGCAATC CD36 F TTGTACCTATACTGTGGCTAAATGAGA R AACAACCCCGCAGGAACAT R CTTGTGTTTTTGAACATTTCTGCTT C/EBPδ F GATCTGCACGGCCTGTTGTA TGF-β F ATGGAGCTGGTGAAACGGAA R CTCCACTGCCCACCTGTCA R ACTGCTTCCCGAATGTCTGA PPARγ F CGCTGATGCACTGCCTATGA Leptin F CCAAAACCCTCATCAAGACCA R TGCGAGTGGTCTTCCATCAC R CTCAAAGCCACCACCTCTGT C/EBPα F GTGTGCACGTCTATGCTAAACCA LXRα F AGGAGTGTCGACTTCGCAAA R GCCGTTAGTGAAGAGTCTCAGTTTG R CTCTTCTTGCCGCTTCAGTTT ap2 F CCAATGAGCAAGTGGCAAGA FAS F TGGTGGGTTTGGTGAATTGTC R GATGCCAGGCTCCAGGATAG R GCTTGTCCTGCTCTAACTGGAAGT Adipsin F CTGCTGGACGAGCAGTGG GAPDH F CCACAGTCCATGCCATCAC R GATGACACTCGGGTATAGACGC R TTCACCACCCTGTTGCTGTA LPL F GGCCAGATTCATCAACTGGAT R GCTCCAAGGCTGTACCCTAAG 분, 94 o C에서 5분간반응시킨후 94 o C에서 30초간 denaturation 시키고, o C에서 30초간 annealing 시킨다음, 72 o C에서 1 분간 extension 시키는 cycle 을 회반복한뒤, 마지막 extension은 72 o C에서 5분간 PCR machine(geneamp, PCR system 9700)(Applied Biosystems, Foster City, CA, USA) 에서수행하였다. 각 PCR products는 0.5 TBE buffer(45 mm Trisborate, 1 mm EDTA) 를사용하여 2% agarose gel 에 loading 하여 100 V 조건에서 30분간전기영동한후 etidium bromide 염색을한후분석하였다. 각각의 primer 는 Bioneer(Bioneer Co., Daejeon, Korea) 에의뢰하여합성하였다 (Table 1). 8. 통계분석통계분석은 SPSS 12K for Windows 통계프로그램패키지를사용하여평균치 ± 표준편차로나타내었고유의수준은 p<0.05로하였다. 각실험군간의통계학적분석은 One way-anova 와 Dunnett's Multiple Comparison Test 검정을실시하였다. 실험결과 1. 지방세포분화억제효과 1) 지방전구세포증식에미치는영향 : 3T3-L1 전구지방세포에 5 및 10% 의 MCPS 를 48시간동안처리하여지방전구세포증식에미치는영향에대해조사한결과, 아무런처리를하지않은대조군의경우 0.67±0.04 의흡광도를나타낸데비하여 5 및 10% 의 MCPS를처리한군에서각각 0.66±0.05 와 0.64±0.04 의흡광도 Fig. 2. Effects of MCPS on the Cell Viability in 3T3-L1 preadipocytes. 3T3-L1 preadipocytes were treated with the indicated concentrations of MCPS for 48 hrs. Cell viability was evaluated using a colorimetric assay based on MTT assay. Values are means±sd of three independent experiments. 를나타내어대조군에비해유의한차이를나타내지않았다. 따라서 5 및 10% 의 MCPS 농도에의해세포의증식이저해되지않았음을확인할수있었다 (Fig. 2). 2) 지방세포의형태학적변화에미치는영향 : 100% 가득찬 3T3-L1 을 2일동안분화를유도하고분화양상을현미경으로관찰하여세포형태의변화를관찰한결과, 전구지방세포의세포밀도가 100% confluent된세포형태는길게뻗은섬유아세포의형태를보여주었으나, 지방세포로분화유도한 5일, 6일과 8일째세포의형태는시간이지남에따라세포모양이둥그러지고세포질내지방구들이점차많이형성됨을현미경으로관찰할수있었다. 반면 MCPS 군은농도에의존적으로세포내지방구의생성이억제되는것을관찰할수있었다 (Fig. 3). 3) 지방세포내중성지방생성에미치는영향 : Oil red O를이용 171
5 Fig. 3. Effects of MCPS on the Microscopic Morphological Changes of 3T3-L1. Preadipocytes Differentiation. The 2-day post-confluent 3T3-L1 preadipocytes(day 0) were treated with MDI(0.5 mm IBMX, 1 μm DEX and 1 μg/ml insulin) for 48 hrs in the absence or presence of indicated concentrations of MCPS. Cells were then replaced with maintenance media containing 1 μg/ml insulin and MCPS for every 2 days. Accumulated lipid droplets in adipocytes were observed 5 days, 6 days and 8 days after the initiation of differentiation and morphological changes associated with adipogenesis were photographed using Inverted Microscope(Carl Zeiss, Germany). Fig. 4. Effects of MCPS on the Adipogenesis and Lipid Accumulation of 3T3-L1. Adipocytes. The 2-day post-confluent 3T3-L1 preadipocytes(day 0) were differentiated into adipocytes in the absence or presence of indicated concentrations of MCPS. (A) Adipocytes were stained with Oil red O to determine the degree of adipocyte differentiation. (B) Stained intracellular lipid was solubilized in isopropanol and absorbance was measured to evaluated lipid con# tent. Values are means±sd. p 0.05 vs. preadipocytes, *p 0.05 vs. MDI
6 Effects of MCPS on Adipocyte Differentiation and Gene Expression 하여세포염색을시행하여지방세포의형태를관찰하고세포내중성지방의양을정량하였다. 관찰한결과, 분화군에비해 5 및 10% 의 MCPS 군에서지방세포내지방구의형성이억제되는것을관찰하였다. 또한지방세포내염색된중성지방의양을정량한결과, 미분화군의흡광도는 0.05±0.00 로나타났으나, 분화군에서흡광도는 0.65±0.23 으로미분화군에비해유의하게증가하는것으로나타났다 (p<0.05). 반면, 5 및 10% 의 MCPS 군의흡광도는각각 0.29±0.15 와 0.05±0.00으로지방생성을농도의존적으로유의하게억제하였다 (p<0.05)(fig. 4). 2. 지방세포분화관련전사인자및유전자발현조절효과 1) 지방분화전사인자발현에미치는영향 : Cytidine-cytidineadenosine-adenosine-thymidine(CCAAT)/enhancer binding proteins β(c/ebpβ), C/EBPδ, C/EBPα 와 peroxisome proliferator-activated receptor γ(pparγ) 의발현양상을살펴보면, C/EBPβ, C/EBPδ, C/EBPα 와 PPARγ mrna 는분화군은미분화군에비하여발현이현저하게증가하였고, MCPS 군은분화군에 비해농도의존적으로발현감소를보였다 (Fig. 5). 2) 지방세포특이적유전자발현에미치는영향 : ap2, Adipsin, lipoprotein lipase(lpl), CD36, transformation growth factorβ(tgf-β) 와 Leptin 의발현양상을살펴보면, ap2, Adipsin, LPL, CD36, TGF-β 와 Leptin mrna 의경우분화군은미분화군에비하여발현이증가하였고 MCPS 군은분화군에비해농도의존적으로발현감소를보였다 (Fig. 6). 3) 지방합성유전자발현에미치는영향 : Liver X receptor (LXR)α 와 fatty acid synthase(fas) 의발현양상을살펴보면 LXR α와 FAS mrna 는분화군은미분화군에비하여발현이증가하였고 MCPS 군은분화군에비해농도의존적으로발현감소를보였다 (Fig. 7). 3. 전구염증사이토카인생산에미치는영향 3T3-L1 성숙지방세포에서생산이증가하는전구염증사이토카인 tumor necrosis factor-alpha(tnf-α), interleukin(il)-1β, IL-6, interferon(ifn)-γ 와 granulocyte-macrophage colony- Fig. 5. Effects of MCPS on the Expression C/EBPβ, C/EBPδ, C/ EBPα, and PPARγ in mrna Level. The 2-day post-confluent 3T3-L1 preadipocytes(day 0) were differentiated into adipocytes in the absence or presence of indicated concentrations of MCPS for 8 days. The mrna levels were determined by RT-PCR as described in ʻMaterial and Methods
7 Fig. 6. Effects of MCPS on the Expression of ap2, Adipsin, LPL, CD36, TGF-β, and Leptin in mrna Level. The 2-day post-confluent 3T3-L1 preadipocytes(day 0) were differentiated into adipocytes in the absence or presence of indicated concentrations of MCPS for 8 days. The mrna levels were determined by RT-PCR as described in ʻMaterial and Methods. Fig. 7. Effects of MCPS on the Expression of LXRα and FAS in mrna Level. The 2-day post-confluent 3T3-L1 preadipocytes(day 0) were differentiated into adipocytes in the absence or presence of indicated concentrations of MCPS for 8 days. The mrna levels were determined by RT-PCR as described in ʻMaterial and Methods. stimulating factor(gm-csf) 의양을정량하였다. 그결과 TNF-α 의양은전구지방세포에서 52.90±22.29 pg/ml 이었으나, 성숙지방세포에서 ±28.39 pg/ml 로전구지방세포에비해유의한증가를보인반면 (p<0.01), 5와 10% MCPS 군은각각 86.43±71.41 pg/ml(p<0.05) 과 58.04±36.65 pg/ml(p< 0.01) 로성숙지방세포에비해유의한감소를보였다. IL-1β 의양은전구지방세포에서 3.31±2.13 pg/ml 이었으나, 성숙지방세포에서 ±52.61 pg/ml 로전구지방세포에비해유의한증가를보인반면 (p<0.01), 5와 10% MCPS 군은각각 7.61±2.91 pg/ml 과 5.83±3.30 pg/ml로성숙지방세포에비해유의한감소를보였 174
8 Effects of MCPS on Adipocyte Differentiation and Gene Expression Fig. 8. Effects of MCPS on the Levels of TNF-α, IL-1β, IL-6, IFN-γ, and GM- CSF in 3T3-L1 Adipocytes. Cytokines were detected by ELISA. Values are expressed as mean±sd. # p< 0.05 vs. preadipocytes. *p<0.05 vs. MDI. Dunnett's multiple comparison tests after one-way analysis of variance. 다 (p<0.01). IL-6의양은전구지방세포에서 11.89±1.00 pg/ml 이었으나, 성숙지방세포에서 48.53±6.48 pg/ml 로전구지방세포에비해유의한증가를보인반면 (p<0.01), 5와 10% MCPS 군은각각 30.97±14.45 pg/ml 과 14.46±6.96 pg/ml 로성숙지방세포에비해유의한감소를보였다 (p<0.01). INF-γ의양은전구지방세포에서 0.38±0.23 pg/ml 이었으나, 성숙지방세포에서 77.57± 0.23 pg/ml 로전구지방세포에비해유의한증가를보인반면 (p< 0.01), 5와 10% MCPS 군은각각 33.55±24.40 pg/ml과 6.29± 6.44 pg/ml로성숙지방세포에비해유의한감소를보였다 (p< 0.01). GM-CSF 의양은전구지방세포에서 11.82±2.20 pg/ml 이었으나, 성숙지방세포에서 35.31±11.17 pg/ml로전구지방세포에비해유의한증가를보인반면 (p<0.01), 5와 10% MCPS 군은각각 26.56±7.51 pg/ml(p<0.05) 과 19.02±2.32 pg/ml(p<0.01) 로성숙지방세포에비해유의한감소를보였다 (Fig. 8). 고찰 본연구에서비만환자의치료에사용되고있는마황천오약침의효과를실험적으로증명하기위하여 MCPS 가지방세포의분화를통한지방조직생성, 지방생성및분화관련유전자발현에미치는영향을조사하였다. MCPS 의농도에따른지방전구세포에대한세포생존율에대한 효과를살펴보기위하여 MTT assay 를통해 48시간동안살펴본결과 MCPS 는 5% 와 10% 의농도에서지방전구세포의증식을저해하지않는것으로나타났다 (Fig. 2). 그러나, MDI 분화유도에의해지방세포로분화되는과정에서현미경관찰에의해 MCPS 가 5% 와 10% 의농도에서농도의존적으로세포의형태학적변화와세포내지방구의생성을효과적으로억제하는결과를관찰하였다 (Fig. 3). 또한세포내축적된중성지방의양을정량한결과 MCPS 가 5% 와 10% 의농도에서농도의존적으로유의한억제효과를나타내었다 (Fig. 4). 지방세포는백색지방조직의주요구성세포로주로중성지방을저장하고동원함으로써에너지균형을조절하는기능을하며, 내분비작용과근거리분비작용을한다. 성숙지방세포는형태학적으로세포내에큰지방방울이특징인데, 핵이세포의외부가장자리에전치하는동안세포질은지방방울을둘러싼얇은층으로압축되어세포가확장되는것으로알려져있다 14). 또한지방조직의생성은 PPARγ 와 C/EBP isoforms 와같은지방분화전사인자의유도에의해지방전구세포가증식과분화과정을거쳐성숙한지방세포가된다. C/EBP isoforms 는여섯종류의이성질체가알려져있는데조직분포에있어지방세포에만국한되어존재하는것이아니라과립구나간세포에도분포하여말기분화에관여하는것으로알려져있으며, 감염이나상처에대한면역반응에도관여한다고알려져있다 15). 지방전구세포를이용한분화실험에서 C/EBPβ 와 C/EBPδ 가초기에증가를보인후분화후기에 175
9 C/EBPα 의증가가두드러지것으로보고되었다 16). PPAR 는지방산과아이코사노이드에의해활성화되는전사인자이다 17). PPAR subtypes(pparα, PPARγ 및 PPARδ) 는뚜렷한조직발현과생리학적활성을가진다. 그중 PPARγ 는지방조직에서주로발현되어지질리모델링과지방세포분화에필수적인전사인자로지질저장에중요한역할을하며, 탄수화물대사에간접적으로영향을미치며 18), 리간드가 PPARγ 에결합하여활성화되는핵수용체의한구성원으로또다른핵수용체인 retinoid-x-receptor(rxr) 와함께이형이합체를형성하여표적유전자의프로모터에위치한 PPAR response elements(ppres) 에결합하여작용하는것으로알려져있다 19,20). 본연구에서지방세포분화후기에 C/EBPβ, C/EBPδ, C/EBP α와 PPARγ 의 mrna 발현에미치는영향을조사한결과, MCPS 는 5% 와 10% 농도에서농도의존적으로이들전사인자의발현을억제하는것으로나타났다 (Fig. 5). 이는지방조직의생성과지질저장에필수적인지방세포분화후기에주로발현되는전사인자뿐만아니라분화초기에주로발현되어분화후기까지발현되는초기전사인자를모두제어하는효과를나타낸결과로해석된다. 지방조직생성 (adipogenesis) 은 C/EBPα 와 PPARγ의활성화로인해지방전구세포가증식과분화과정을거쳐성숙한지방세포로되는것으로써이때지질이축적되고실질적인지방세포의표현형을결정하는 ap2, LPL, 그리고 adipsin 과같은지방세포특이적인유전자 (adipose specific gene) 가발현되는것으로알려져있다 14). 본연구에서지방세포특이적유전자인 ap2, Adipsin, LPL, CD36, TGF-β 와 Leptin 의발현양상에대해조사한결과 MCPS 는 5% 와 10% 농도에서농도의존적으로지방세포특이적유전자의발현을감소시켰다 (Fig. 6). 또한지방합성에핵심적인역할을하는핵수용체로지방생성과축적에관여하는유전자인 LXRα 와 FAS 의발현에대한영향을조사한결과 MCPS 는 5% 와 10% 농도에서농도의존적으로지방합성에관여하는유전자의발현을감소시켰다 (Fig. 7). 이와같은결과는성숙지방세포로의분화와지방합성을억제하는효과를나타낸결과로해석된다. 지방조직은각종사이토카인을포함하는아디포카인이라는생리활성물질을분비하여지방대사및당대사에관여하는중요한내분비기관이다. 비만의경우지방세포에서생산하는염증성사이토카인의분비가증가하여인슐린저항성을유발하고, 심혈관계질환및제2형당뇨병등의비만성대사질환의발생에중요한역할을하는것으로알려져있다 21). TNF-α는지방세포에서염증과인슐린저항성을유발하는중 추적매개자로지방세포내염증성신호경로의활성화를통해지방세포의기능을손상시키고인슐린민감성을감소시킨다 22-24). IL-6 은지방분해와간의중성지방분비자극에의해고중성지방혈증을유도하며 25), IFN-γ 는지방세포에서인슐린유도혈당흡수를억제하고당대사이상과인슐린저항성을유발하는것으로알려져있다 26,27). 또한비만인의지방조직에서는대식세포의화학주성인자인 GM-CSF 가과발현되어지방조직으로대식세포의침투와인슐린저항성을증가시키고, TNF-α, IL-1β 와 IL-6 와같은전구염증사이토카인유전자발현을증가시키며염증부위면역세포를침투시켜전구염증사이토카인을유도한다. 특히, 고지방식이를투여한마우스의지방조직에서전구염증사이토카인의전반적인발현에중요한작용을하는것으로알려져있다 28,29). 본연구에서성숙한지방세포에서분비되는대표적인염증성사이토카인인 TNF-α, IL-1β, IL-6, IFN-γ 및 GM-CSF 의양을조사한결과 MCPS 는 5% 와 10% 농도에서농도의존적으로전구염증성사이토카인의분비를억제하는효과를나타내었다 (Fig. 8). 이와같은결과는비만으로인한전구염증성사이토카인의증가를억제함으로서인슐린저항성과같은지방대사및당대사의장애를조절하여비만성대사질환의예방에효과가있을것으로생각된다. 본연구결과를종합해볼때 MCPS 가지방세포분화전사인자와지방합성유전자의조절을통해성숙지방세포로의분화와지방생성을억제하고, 성숙지방세포에서생성되어이차적인비만성대사질환을유발하는염증성사이토카인의분비를억제하는것으로나타났는데, 이는한의학적원리에의한체온조절과수액의조절효능을통해비만조절및관련질환에대한조절가능성을보여주는것으로의미있는결과라고생각된다. 감사의글 This work was supported by Dong-eui University Foundation Grant(2014AA132). References 1. Haslam D, Sattar N, Lean M. Obesity--time to wake up. BMJ 2006 ; 333 : Korean Pharmacopuncture Institute. Pharmacopuncturology: Principles and Clinical Applications. Elsevier Korea LLC: Seoul, 176
10 Effects of MCPS on Adipocyte Differentiation and Gene Expression 2011, pp Jang IS, Yang CS, Hwang EH. The Need for Clinical Practice Guidelines in Usage of Mahuang in Weight Loss. Journal of Society of Korean Medicine for Obesity Research 2007 ; 7 : Kim HJ, Han CH, Lee EJ, Song YK, Shin BC, Kim YK. A Clinical Practice Guideline for Ma-huang(Ephedra sinica) Prescription in Obesity. Journal of Society of Korean Medicine for Obesity Research 2007 ; 2 : Textbook Compilation Committee of National Universitiy of Korean Medicine. Herbology. Yeonglimsa: Seoul, 1991, pp 121-3, Youn KS, Nam SS, Lee JD, Choi DY, Ahn BC, Park DS et al. Experimental studies on the safety of Ephedrae Herba extract solution used for herbal - acupuncture. The Acupuncture 1997 ; 14 : Chang M-S, Shim K-J, Oh J-H, Yoon J-W, Choi M-J, Kim D-R et al. Acute Oral Toxicity of Ephedrae Herba in SD Rats. Korean J of Oriental Physiology & Pathology 2008 ; 22 : Choi D, Shim KJ, Choi B-J, Park SY, Chang MS, Park SK. Subacute Oral Toxicity of Ephedrae Herba Extract in SD Rats. Kor J Herbology 2008 ; 23 : Lee JS, Lee JS, Park Y-C, Choi SM, Lee S. A Repeated-dose 28-Day Oral Toxicity Test of Aconitum jaluense Extract in Sprague-Dawley Rats. Yakhak Hoeji 2014 ; 58 : Kim S, Ahn S-H, Kim S, Lee S, Song B-K. The Study on toxicity and biological activities of Aconiti ciliare tuber Pharmacopuncture in Rats Original Articles. Journal of Pharmacopuncture 2011 ; 14 : Hong K. Analysis Study of Survey for Safety and Efficacy of Pharmacopuncture. Journal of Pharmacopuncture 2010 ; 13 : Kim JH, Shin MS, Choi SW, Song BY, Yook TH. The Effect of Mahuang(Ephedra sinica Stapf)-Chuanwu(Aconitum Carmichaeli Debx) Pharmacopuncture Treatment in Obese Patients. Journal of Korean acupuncture & moxibustion medicine society 2009 ; 26 : Choi S, Bae J, Kim Y. The Study on Application of Mahuang-chuanwu Herbal Acupuncture to the treatment of obesity. KOREAN PHARMACOPUNCTURE Inst 2006 ; 9 : Ali AT, Hochfeld WE, Myburgh R, Pepper MS. Adipocyte and adipogenesis. Eur J Cell Biol 2013 ; 92 : Lekstrom-Himes J, Xanthopoulos KG. Biological Role of the CCAAT/Enhancer-binding Protein Family of Transcription Factors. J Biol Chem 1998 ; 273 : Darlington GJ, Ross SE, MacDougald OA. The Role of C/EBP Genes in Adipocyte Differentiation. J Biol Chem 1998 ; 273 : Forman BM, Tontonoz P, Chen J, Brun RP, Spiegelman BM, Evans RM. 15-Deoxy-Δ12,14-Prostaglandin J2 is a ligand for the adipocyte determination factor PPARγ. Cell 1995 ; 83 : Rosen ED, Walkey CJ, Puigserver P, Spiegelman BM. Transcriptional regulation of adipogenesis. Genes Dev 2000 ; 14 : Kliewer SA, Umesono K, Noonan DJ, Heyman RA, Evans RM. Convergence of 9-cis retinoic acid and peroxisome proliferator signalling pathways through heterodimer formation of their receptors. Nature 1992 ; 358 : Tugwood JD, Issemann I, Anderson RG, Bundell KR, McPheat WL, Green S. The mouse peroxisome proliferator activated receptor recognizes a response element in the 5 flanking sequence of the rat acyl CoA oxidase gene. EMBO J 1992 ; 11 : Lafontan M. Adipose tissue and adipocyte dysregulation. Diabetes Metab 2014 ; 40 : Lobo SM de V, Quinto BMR, Oyama L, Nakamichi R, Ribeiro AB, Zanella MT et al. TNF-α modulates statin effects on secretion and expression of MCP-1, PAI-1 and adiponectin in 3T3-L1 differentiated adipocytes. Cytokine 2012 ; 60 : Hotamisligil GS, Murray DL, Choy LN, Spiegelman BM. Tumor necrosis factor alpha inhibits signaling from the insulin receptor. Proc Natl Acad Sci 1994 ; 91 : Zhang HH, Halbleib M, Ahmad F, Manganiello VC, Greenberg AS. Tumor Necrosis Factor-α Stimulates Lipolysis in Differentiated Human Adipocytes Through Activation of Extracellular Signal-Related Kinase and Elevation of Intracellular camp. Diabetes 2002 ; 51 : Interleukin-6 stimulates hepatic triglyceride secretion in rats. Endocrinology 1995 ; 136 :
11 26. Wada T, Hoshino M, Kimura Y, Ojima M, Nakano T, Koya D et al. Both type I and II IFN induce insulin resistance by inducing different isoforms of SOCS expression in 3T3-L1 adipocytes. Am J Physiol - Endocrinol Metab 2011 ; 300 : E Waite KJ, Floyd ZE, Arbour-Reily P, Stephens JM. Interferon-γ-induced Regulation of Peroxisome Proliferator-activated Receptor γ and STATs in Adipocytes. J Biol Chem 2001 ; 276 : Kanda H. MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity. J Clin Invest 2006 ; 116 : Kamei N, Tobe K, Suzuki R, Ohsugi M, Watanabe T, Kubota N et al. Overexpression of Monocyte Chemoattractant Protein-1 in Adipose Tissues Causes Macrophage Recruitment and Insulin Resistance. J Biol Chem 2006 ; 281 :
013~020. Áö¹æ¼¼Æ÷ ºÐÈ�ÁßÀÎ
3T3-L1 13 DOI : 10.3831/KPI.2009.12.2.013 3T3-L1 Received : 09. 04. 29 Accepted : 09. 05. 19 Adipocyte-Related Genes and Transcription Factors were affected by Ganoderma lucidum during 3T3-L1 Differentiation
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More information농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다 년 2 월 11 일 - 1 -
농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다. 2013 년 2 월 11 일 - 1 - 연구기관명 : 부산대학교 연구책임자 : 정명호 연구원 : 손용해 연구원 : 장민경 - 2 - Ⅰ. 제목 팥의대사성질환개선및기능성규명 Ⅱ. 연구개발의목적및필요성 팥의대사성질환개선소재발굴과그기능성을과학적으로증명하기위해, 팥의당뇨,
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한
More informationJournal of Life Science 2011, Vol. 21. No μ μ
Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More information04조남훈
Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache
More informationMHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More informationProduct Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot
EZ-LDH Cell Cytotoxicity Assay Kit Cat. No. DG-LDH500 DG-LDH1000 FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. 1 ( 주 ) 대일랩서비스부설두젠생명공학연구소 Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는
More information- 1 -
11 1541000-001436-01 수출전략형신수요창출을위한홍마늘및바이오식품개발 (Development of red-garlic and its bio-food for create new market demand and develop of export items) - 1 - - 2 - - 3 - o o - 4 - o o - 5 - o α α - 6 - - 7
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More information목차 1. 서론 줄기세포의간세포분화능평가시고려사항 간세포분화능평가시험법 분
세포치료제시험정보집 7 줄기세포치료제의 간세포분화능평가시험 2015. 4. 30. 식품의약품안전평가원 차세대줄기세포기반제제평가연구사업단 목차 1. 서론 --------------------------------------------- 1 2. 줄기세포의간세포분화능평가시고려사항 --------------- 2 3. 간세포분화능평가시험법 -----------------------------
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More information10(3)-10.fm
w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction
More information???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
More information16_이주용_155~163.hwp
사상체질의학회지 2008;20(2):155-163 J of Sasang Constitutional Medicine Vol. 20, No. 2, 2008:155-163 http://www.esasang.com 腦 梗 塞 으로 발생한 少 陽 人 半 身 舞 蹈 病 患 者 치험 1례 이주용 이한얼 한경수 안택원 Abstract 대전대학교 한의과대학 사상체질과 A Soyangin
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More informationJksvs019(8-15).hwp
Grade I Grade II Grade III 12 대한혈관외과학회지 : 제 20 권 제 1 호 2004 Control Group A Group B Fig. 4. Microscopic findings of vein wall in control, group A and group B on the day of 7 after venous occlusion. The
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More informationA Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information대한한의학원전학회지24권6호-전체최종.hwp
小兒藥證直訣 의 五臟辨證에 대한 小考 - 病證과 處方을 중심으로 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 ㆍ 韓醫學古典硏究所 白裕相1,2*1)2) A study on The Diagnosis and Treatment Using The Theory of Five Organs in Soayakjeungjikgyeol(小兒藥證直訣) 1 Dept. of Oriental
More informationJkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI: 3 * Effects of 9th
Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp.357-378 DOI: http://dx.doi.org/10.21024/pnuedi.29.2.201906.357 3 * Effects of 9th Grade Students Participation in Career Curriculum Cluster
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More information석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
More information<30345F D B1E8BEE7C7CF5FC0FAC0DAB1B3C1A4BEF8C0BD2E687770>
Ginsenoside Rg3 가지방세포분화과정에서 Adipocyte Fatty Acid Binding Protein mrna 발현과 Glycerol-3-phosphate Dehydrogenase 활성에미치는효과 이막순 1 김인환 2 김종태 3 김양하 1* 이화여자대학교식품영양학과 1, 고려대학교식품영양학과 2, 한국식품연구원식품나노바이오연구단 3 Effects
More informationMicrosoft Word - KSR2016S168
2016 년도 한국철도학회 춘계학술대회 논문집 KSR2016S168 GPR 을 이용한 자갈궤도 파울링층 파악을 위한 실내실험적 접근 Evaluation of Applicability of GPR to Detect Fouled Layer in Ballast Using Laboratory Tests 신지훈 *, 최영태 **, 장승엽 *** Ji-hoon. Shin
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More information2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, )
Abstract Kim Dal-Rae, Kim Sun-Hyung* Dept. of Sasang Constitutional Medicine, College of Oriental Medicine, Kyung-Hee Univ. *Dept. of Sasang Constitutional Medicine, East-West Neo Medical Center, Kyung-Hee
More informationKorea Food & Drug Administration 깨끗하고바른당신! 세상을밝힙니다. 목 차 * 건강기능식품의기능성개요 1 * 약어 4 Ⅰ. 서론 5 Ⅱ. 일반적사항 5 Ⅲ. 기능성시험방법 15 Ⅳ. 기능성인정원칙및기준 35 Ⅴ. 기능성심사사례 37 Ⅵ. 참고문헌 42 건강기능식품의기능성개요 기능성정의 기능성구분 기능성구분 기능성내용 기능성을가진원료또는성분
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con
Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More informationWnt signaling 과 adipogenesis
Wnt signaling 과 adipogenesis 지방 조직(adipose tissue)을 이루는 지방세포(adipocyte)는 지방(fat)을 포함하고 있는 세 포로써 체내 지방 대사를 조절 하는 것 뿐 아니라 여러가지 분비물질들을 통하여 식욕 조절 등의 기능을 하는 것이 잘 알려져 있으며 당 대사에도 관여하여 전반적인 에너지 항상성 유 지를 담당하고 또한
More informationDBPIA-NURIMEDIA
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More informationJkafm093.hwp
가정의학회지 2004;25:721-739 비만은 심혈관 질환, 고혈압 및 당뇨병에 각각 위험요인이고 다양한 내과적, 심리적 장애와 연관이 있는 질병이다. 체중감소는 비만한 사람들에 있어 이런 위험을 감소시키고 이들 병발 질환을 호전시킨다고 알려져 있고 일반적으로 많은 사람들에게 건강을 호전시킬 것이라는 믿음이 있어 왔다. 그러나 이런 믿음을 지지하는 연구들은
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More information005송영일
Received : 2015. 12. 09 Reviewed : 2015. 12. 16 Accepted : 2015. 12. 16 Sternal Fracture occurred after Thai Massage : A Case Report Young-Il Song, K.M.D. 1, Dong-Eun Kim, K.M.D. 1 1 Department of Rehabilitation
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 4, pp DOI: * A Study on Teache
Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp.149-171 DOI: http://dx.doi.org/10.21024/pnuedi.27.4.201712.149 * A Study on Teachers and Parents Perceptions on the Introduction of Innovational
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More information(5차 편집).hwp
(215), 54(1), 17-3 211 STEAM,.. STEAM, STEAM, 5~6 11.,., 5~6...,. (, 21)., 29. (,, 212). 211 STEAM * :, E-mail: njkwon@hanmail.net http://dx.doi.org/1.15812/ter.54.1.2153.17 (215), 54(1), 17-3,. (Arts)
More informationKorean J. Plant Res. 28(5): (2015) Print ISSN Online ISSN Original Research Art
Korean J. Plant Res. 28(5):582-590(2015) http://dx.doi.org/10.7732/kjpr.2015.28.5.582 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 비타민나무잎에탄올추출물의 AMPK 활성화를통한 3T3-L1 지방전구세포의 adipogenesis
More information077~088 해계 유침과 전침이
loperamide 77 DOI : 10.3831/KPI.2009.12.4.077 loperamide Received : 09. 10. 21 Accepted : 09. 11. 04 The Effect of Acupuncture and Electro-acupuncture at ST41 on Intestinal Hypomotility Induced with Loperamide
More information<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>
J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
More information페링야간뇨소책자-내지-16
야간뇨의진단과치료 - 실제적접근 - Reference 1. Choo MS, Ku JH, Park CH et al. Prevalence of Nocturia in a Korean Population Aged 40 to 89 Years. Neurourol Urodyn 2008; 27:60-64. 2. Weiss JP. Prevalence
More information109~120 õÃʾàħ Ä¡·á
109 DOI : 10.3831/KPI.2010.13.3.109 Received : 10. 08. 13 Revised : 10. 09. 06 A Case Study Of Patients With Knee Joint Pain Treated With Rubiae Radix Pharmacopuncture Accepted : 10. 09. 07 Key Words:
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More information<31325FB1E8B0E6BCBA2E687770>
88 / 한국전산유체공학회지 제15권, 제1호, pp.88-94, 2010. 3 관내 유동 해석을 위한 웹기반 자바 프로그램 개발 김 경 성, 1 박 종 천 *2 DEVELOPMENT OF WEB-BASED JAVA PROGRAM FOR NUMERICAL ANALYSIS OF PIPE FLOW K.S. Kim 1 and J.C. Park *2 In general,
More informationEffects of baseball expertise and stimulus speeds on coincidence-anticipation timing accuracy of batting Jong-Hwa Lee, Seok-Jin Kim, & Seon-Jin Kim* Seoul National University [Purpose] [Methods] [Results]
More information1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
More informationMicrosoft Word doc
KISEP Rhinology Korean J Otolaryngol 2006;49:307-12 사람정상코점막상피세포에서겔형성점소 (Gel-Forming Mucin) 분비에대한 Prostaglandin E 2 의효과 김진국 1 김창훈 2,3 김규보 2 장현종 1 김현직 2 윤주헌 2,3,4 Effect of Prostaglandin E 2 on Gel-forming
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: * The
Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.243-268 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.243 * - 2001 2015 - The Research Trends on Peer Counseling in Elementary and
More information자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr
Original Article pissn 1738-2637 J Korean Soc Radiol 2012;67(2):129-134 The Survey of Magnetic Resonance Imaging Quality according to in Korea 1 자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 1 Hyun-Hae
More informationuntitled
Journal of Korean Medicine Rehabilitation Vol. 23 No. 3, July 2013 pissn 1229-1854 eissn 2288-4114 Original Article 봉독약침이 흰쥐의 국소뇌혈류량 및 평균혈압에 미치는 영향 민선정 염승룡 권영달 원광대학교 한의과대학 한방재활의학과교실 Effects of Bee Venom
More information,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012). (2007) 26%., (,,, 2011;, 2006;
,,.. 400,,,,,,.,,, -, -, -., 3.. :, Tel : 010-9540-0640, E-mail : sunney05@hanmail.net ,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012).
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI: An Exploratory Stud
Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp.423-441 DOI: http://dx.doi.org/10.21024/pnuedi.29.1.201903.423 An Exploratory Study on the Improvement of Democratic Consultative Culture
More information<303720C7CFC1A4BCF86F6B2E687770>
1) < 論 文 > 라이프스타일 세분화를 통한 실버타운 수요자 분석 133 주택연구 제15권 4호 2007. 12/15(4) : 133~160 Housing Studies Review Vol. 15, No. 4 : 133~160 접수일 : 2007. 7. 9, 심사일 : 2007. 7. 16, 심사완료일 : 2007. 8. 29 라이프스타일 세분화를 통한 실버타운
More information12.077~081(A12_이종국).fm
J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 77-81 y w» e wx Á w œw Fabrication of Ceramic Batch Composition for Porcelain by Using Recycled Waste Ceramic Powder Hyun Guen Han, and
More information(01) hwp
Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of
More informationAbstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
More information歯5-2-13(전미희외).PDF
The Korean Journal of Counseling 2004, Vol. 5, No. 2, 423-434,. 4 5 18 9, 9.,,,,,.,,, t-.. :,,, (,, 1996),.,,. (, 2001),... 88 98 2000, 88 12.5%(250 )98 35.6%(712 )2.8 (,,, 2001) (Corresponding Author)
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More informationJournal of Educational Innovation Research 2016, Vol. 26, No. 3, pp DOI: Awareness, Supports
Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp.335-363 DOI: http://dx.doi.org/10.21024/pnuedi.26.3.201612.335 Awareness, Supports in Need, and Actual Situation on the Curriculum Reconstruction
More information서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소
2012 년도기초과학연구소 대학중점연구소심포지엄 마이크로파센서를이용한 혈당측정연구 일시 : 2012 년 3 월 20 일 ( 화 ) 14:00~17:30 장소 : 서강대학교과학관 1010 호 주최 : 서강대학교기초과학연구소 Contents Program of Symposium 2 Non-invasive in vitro sensing of D-glucose in
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: NCS : G * The Analy
Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.133-158 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.133 NCS : G * The Analysis of the Cognitive Level of Basic Job Skills of Specialized
More informationMBL fm
Microbiol. Biotechnol. Lett. (2016), 44(1), 89 97 pissn 1598-642X eissn 2234-7305 Microbiology and Biotechnology Letters 금앵자에탄올추출물에의한 3T3-L1 지방세포의분화억제효과와그메커니즘규명 정현영 1, 정인교 2, 남소연 2, 윤희정 2, 김병우 1,2, 권현주
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More information- 2 -
- 1 - - 2 - - 3 - - 4 - μ μ μ μ μ μ μ α μ μ μ μ μ - 5 - μ μ μ μ - 6 - μ - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - μ μ μ α μ λ - 14 - μ μ μ μ μ - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22
More information연구목표 재료및방법 년도시험연구보고서
ABSTRACT This study was conducted to determine the optimum concentration of cactus standard nutrient solution for hydroponic culture in potted succulents, Echeveria derenbergii, Sedeveria Letizia and Cotyledon
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More information44-4대지.07이영희532~
A Spatial Location Analysis of the First Shops of Foodservice Franchise in Seoul Metropolitan City Younghee Lee* 1 1 (R) 0 16 1 15 64 1 Abstract The foodservice franchise is preferred by the founders who
More information15 (01-08-수정).hwp
J Korean Soc Food Sci Nutr 한국식품영양과학회지 46(4), 523~528(2017) https://doi.org/10.3746/jkfn.2017.46.4.523 연구노트 3T3-L1 세포분화중지방축적및활성산소종생성에대한국내산림자원 5 종추출물의효과 최선일 1 이종석 2 이사라 2 이혜진 2 여주홍 2 조봉연 1 이진하 1 김재민 1 정태동
More informationMay 10~ Hotel Inter-Burgo Exco, Daegu Plenary lectures From metabolic syndrome to diabetes Meta-inflammation responsible for the progression fr
May 10~12 2012 Hotel Inter-Burgo Exco, Daegu Plenary lectures From metabolic syndrome to diabetes Meta-inflammation responsible for the progression from obesity to metabolic syndrome originates in the
More information<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More informationOverview -ingredient - mechanism 2. Biomarker 3. In vitro study 4. In vivo study 5. Human study 6. 기능성 인정서 7.기준규격 인정서
*CJ standard Mw 40500 standard Mw 8000 CJ CJ Chitosan 1. 70g Sprague Dawley 1 2. Stainless steel cage 3. Ingredient Basal Control CJ Sucrose Starch Casein DL-methionine Corn oil Lard Choline bitartarate
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
More information(....).hwp
sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
More information433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
More informationA Study on the Relationships between Self-Differentiation and Adaptability Factors for Senior Dementia Patients Care Givers Department of Social Welfare, Seoul Welfare Graduate University Full-time Lecturer
More informationJkbcs032.hwp
Clinical Correlation of HER-2/neu Overexpression in Patients with Breast Cancer Sung Yong Kim, Tae Yoon Kim, Jae Jun Kim, Chang Ho Kim, Ok Pyung Song, Min Hyuk Lee, Eui Han Kim 1, and Moo Sik Cho Departments
More information