DBPIA-NURIMEDIA
|
|
- 종환 자
- 6 years ago
- Views:
Transcription
1 농약과학회지 (Korean J. Pestic. Sci.) Vol. 20, No. 4, pp (2016) Open Access Online ISSN Print ISSN ORIGINAL ARTICLES / BIOPESTICIDE Bacillus velezensis YP2 의겨자채흰가루병의생물적방제 이상엽 * 원항연 김정준 한지희국립농업과학원농업미생물과 Biocontrol of Leaf Mustard Powdery Mildew Caused by Erysiphe cruciferarm using Bacillus velezensis YP2 Sang Yeob Lee*, Hang Yeon Weon, Jeong Jun Kim and Ji Hee Han Agricultural Microbiology Division, National Institute of Agricultural Sciences, RDA, Wanju 55365, Korea (Received on October 30, Revised on November 24, Accepted on November 25, 2016) Abstract Bacillus velezensis YP2 inhibited the mycelial growth of several plant pathogens including Cercespora spp., Septoria sp., Phoma sp., Botrytis cinerea and Sclerotinia scleotiorum occurring in leafy vegetables. Control efficacy for powdery mildew caused by Erysiphe cruciferarm on red leaf mustard and cheong mustard by treatment of spraying with 10-fold diluted Luria-Bertani (LB) broth of B. velezensis YP2 was 91.8% and 80.9%, respectively. When B. velezensis YP2 was treated four times with five-day interval, three times at seven-day interval and two times at ten day interval in the greenhouse test, the control effect of red leaf mustard powdery mildew was 70.6%, 65.0% and 40.9%, respectively. Also B. velezensis YP2 could promote the seed germination and plant growth of led leaf mustard. The results showed that the culture broth of B. velezensis YP2 was very effective to control the powdery mildew of leaf mustard. Key words leaf mustard Antifungal activity, Bacillus velezensis, biological control, Erysiphe cruciferarm, powdery mildew, 서 론 겨자채는쌍떡잎식물로십자화과에속하는 Brassica juncea 이며, 청겨자와적겨자로구분되며쌈채소의대표작물중에하나로재배되고있다. 우리나라에서겨자채에발생하는흰가루병은 2011년 5월에경기도화성에비닐하우스재배하는청겨자에서첫발생을보고하였다 (Kim et al., 2013). 우리나라에서는 Erysiphe cruciferarm에의한흰가루병은배추, 다닥냉이, 애기똥풀, 애기장대와풍접초에서보고되어있다 (The Korean Society of Plant Pathology, 2009). 배추흰가루병경우에는주로온실내의채종재배시피해가크며, 자낭각으로월동하여 1차전염원이되며, 온실내의건조한조건하에서심하게발생하며일반적으로노지재배포장에서는발생이매우드물다고하였다 (Jeong 2000). 겨자채 *Corresponding author lsy2014@korea.kr 흰가루병도유리온실이나비닐하우스재배에서주로봄과가을에발생하며농가경우에는재배관리가제대로되지않은경우에심하게발생한다. 이를방제하기위한등록된화학약제는없으며신선한쌈채소를생식하기때문에친환경재배방법을사용할수있으며, 작물에대한잔류문제가거의없는유용미생물을이용하여방제하는것이바람직한하나의방법으로사료된다. 전세계적으로미생물농약은 149종이등록되어병해충과잡초방제에사용되고있으며, 흰가루병을비롯한잿빛곰팡이병방제용으로 Bacillus subtilis QST 713 (Rhapsody R, Serenade R ) 과 Bacillus pumilus QST 2808 (Sonata R ) 이개발되어우리나라를포함한여러나라에서친환경방제재로사용되고있다 (Copping, 2004; Helene et al., 2011). 우리나라에서는흰가루병방제미생물농약으로는 9종이등록되어있으며주로바실러스가 8품목이등록되어사용되고있다. 식물병방제와관련이있는 Bacillus 균주의이차대사산물은 cyclic lipopeptides (bacillomycin D, fengycin, iturin, surfactin), 369
2 370 이상엽 원항연 김정준 한지희 siderophore (bacillibactin), polyketides (bacillaene, difficidin, and macrolactin), dipeptide (basilysin), acetoin, 2,3-butandiol 등이있으며 (Lee et al., 2012; Soumitra et al., 2015), 병원세균이나곰팡이병균의균사생장이나포자발아억제, 저항성유도및바이오필름형성등의작용기작으로식물병에대한친환경적방제로농가에서사용되고있다. 따라서본연구에서는소비자가흰가루병을친환경적으로방제하고안심하고먹을수있는겨자채를생산하기위하여선발한 Bacillus velezensis YP2균주가겨자채흰가루병발생억제효과검정을실시하였다. 재료및방법 선발미생물보관 Bacillus velezensis YP2 균주는양평의토마토잎을마쇄하여 80 o C에서 10분간처리한후 1/10 trypticase soy agar (TSA, Bacto Tryptone 15 g, Bacto Soytone 5 g, NaCl 5 g, Agar 15 g/l) 배지에도말하여 25 o C에서 2일간배양한다음, 분리하여 TSA 배지에다시획선배양하여재분리한후, TSA 배지에서 28 o C에서 2일간배양한후균체를멸균한글리세롤 20% 액에넣고 -20 o C에보관하면서계대배양하여사용하였으며, 국립농업과학원에기탁하여 KACC92130P 수탁번호를받았다. 미생물배양 Bacillus velezensis YP2 균주를 Luria-Bertani 액체배지 (LB, tryptone 10 g, yeast extract 5 g, NaCl 10 g) 를사용하여미리배양한균주를 2% (v/v) 으로접종하여 28 o C, 180 rpm으로조절한진탕배양기에서 48시간배양하여사용하였다. B. velezensis YP2 균주의쌈채에서분리한식물병원균에 대한항균활성검정 식물병원균 Cercospora sp. 1~3, Septoria sp., Colletotrichum sp., Sclerotinia sclerotiorum, Phoma sp., Botrytis cinerea를 potato dextrose agar (PDA, Potato 200 g, Dextrose 20 g, Agar 15 g/l) 배지에이식후 Cercospora sp. 1~3, Septoria sp., Colletotrichum sp., Phoma sp. 균주는 25 o C에서 Sclerotinia sclerotiorum, Botrytis cinerea 균주는 20 o C에서각각 7~25 일간배양하여직경 5mm 코르크보러를이용하여병원균의균총을 PDA 배지가분주된일회용페트리디쉬중앙에치상하였다. YP2 균주는 TSA 평판배지에배양하여루프를이용하여균을떼어내어 PDA 배지가분주된일회용페트리디쉬 3개소에치상하여병원균별로 25 o C와 20 o C 항온기에서 7~20일간배양후저지원의직경을조사하였다. 선발균주의동정 YP2균주의계통분류학적동정은일반적으로사용되는 16S rrna 유전자의염기서열을사용하였고, 추가로 Bacillus spp. 의분류에유용한것으로알려진 DNA gyrase유전자 (gyrb 유전자 ) 의염기서열을이용하여선발균주의분류학적위치를분석하였다 (Wang et al., 2007). YP2 균주는 TSB (Difco, Detroit, MI, USA) 배지에접종하여 30 o C에서 24시간이상배양후원심분리하여균체를수거하였다. Genomic DNA는 Genomic Plus DNA Prep kit (Inclone, Yongin, Korea) 를이용하여추출하였다. 16S rrna 유전자의증폭을위해범용프라이머인 27F와 1492R을사용하였고, gyrb 유전자의증폭을위해범용프라이머인 UP-1과 UP-2r을사용하여 PCR한후각각유전자의증폭산물을얻었다 (Yamamoto et al., 1955; Song et al., 2004). 3개의프라이머 (518F; CCAGCAGCCGCGGTAATACG, 800R; TACCAGGGTAT CTAATCC, 984F; ACGCGARGAACCTTAC) 를이용하여 16S rrna 유전자의염기서열을결정하였고, gyrb 유전자는두개의염기서열분석용프라이머 (UP-1S; GAA GTC ATC ATG ACC GTT CTG CA, UP-2Sr; AGC AGG GTA CGG ATG TGC GAG CC) 를이용하여제노텍 (GenoTech, Daejeon, Korea) 에분석의뢰하였다. 얻어진염기서열은 SeqMan (DNASTAR, Madison, WI, USA) 을이용하여직접오류를검정하고연결하였다. 각유전자의비교분석을위해서 16S rrna 유전자의염기서열및균주간상동성은 EzTaxon ( 을통해서얻었으며 (Kim et al., 2012), gyrb 유전자의염기서열은 GenBank ( 를통하여얻었다. 계통도의작성을위해 MEGA 5.0 프로그램의 Clustal W 프로그램으로염기서열을정렬하고염기서열길이를맞추었다. 계통도를작성하기위해 neighbor-joining 알고리즘을사용하였으며, 계통도의신뢰성을확보하기위해 1,000회반복 bootstrapping 을수행하였다 (Tamura et al., 2011). B. velezensis YP2 균주의겨자채흰가루병에대한방제효과검정청겨자 ( 아시아종묘 ) 종자를흑색비닐포트 ( 직경 9.6 cm) 에바로커상토 ( 서울바이오 ) 를담아서파종하여 20일간생육한청겨자에흰가루병이자연발생한다음, YP2 균주를 LB 배지에서 28 o C에서 200 rpm으로 48시간진탕배양하여배양액을 10배희석하여구당 10주씩 3반복으로 7일간격으로 3회분무처리하여최종처리 7일후병반면적율 (%) 을육안으로달관조사하였다. B. velezensis YP2 균주의처리간격및횟수에따른적겨자흰가루병방제효과검정적겨자 ( 아시아종묘 ) 재배중에흰가루병이자연발생한초
3 Bacillus velezensis YP2 의겨자채흰가루병의생물적방제 371 기에 LB 배지에서배양한 YP2 균주의배양액을 10배희석하여구당 15주씩 3반복으로 5일간격 4회, 7일간격 3회와 10일간격 2회분무처리하여최종처리 10일후병반면적율 (%) 을육안으로달관조사하였다. 대조구는시판미생물제를 500배희석하여 7일간격 3회처리하였다. B. velezensis YP2 균주의침지에의한적겨자종자발아및생육촉진효과검정적겨자종자발아의영향을조사하기위하여 YP2 균주를 LB액체배지에 25 o C, 200 rpm에서 48시간진탕배양후원심분리하여균체를회수후 hemacytometer (Bright-Line, USA) 로계수하여 cell/ml로조절하여적겨자종자를 1시간침지후 100립씩 5반복으로페트리디쉬에치상하여 25 o C도항온기내에서 3일간보관한다음종자발아율 (%) 를조사하였다. 적겨자생육촉진효과는 YP2 균주를 LB 액체배지에 25 o C, 200rpm에서 48시간진탕배양한후원심분리하여균체를회수하여 cell/ml로농도를조절하였다. 적겨 자종자를 BM-6 상토에파종하고, 파종일로부터 7일간격으로 50 ml 씩 4회관주처리하였다. 100립씩 5반복으로실험하였으며, 최종처리 8일후에반복당 20주씩초장, 근장과생체중을각각조사하였다. 결과및고찰 B. velezensis YP2 균주의쌈채에서분리한식물병원균에대한항균활성쌈채류에서분리한식물병원균 Cercospora sp. 1~3, Septoria sp., Colletotrichum sp., Phoma sp., Botrytis cinerea, Sclerotinia sclerotiorum에대한 B. velezensis YP2 균주의군사생장억제효과를조사한결과에서 Cercospora sp. 1~3 에대하여 8.3~8.8 mm, Septoria sp. 에대하여 4.4 mm, Colletotrichum sp. 에대하여 5.8 mm, Phoma sp. 에대하여 8.5 mm, Botrytis cinerea에대하여 6.1 mm, Sclerotinia sclerotiorum에대하여 5.9 mm의균사생육을저지하였다 (Table 1). Bacillus 균주는 cyclic lipopeptides (bacillomycin Fig. 1. Phylogenetic dendrogram based on partial 16S rrna (A) and gyrb (B) gene sequences (1,416 bp and 1,065 bp, respectively) of Bacillus strains. Numbers above branches indicate bootstrap values (>50%) from 1,000 replicates. Strain or culture collection and accession numbers are indicated next to species name. T means type strain.
4 372 이상엽 원항연 김정준 한지희 Table 1. Antifungal activity of B. velezensis YP2 on fungal pathogens of leafy vegetables on PDA agar Plant pathogen Inhibition zone of mycelial growth (mm) ± SD Cercospora sp ± 0.4 a) Cercospora sp ± 0.2 Cercospora sp ± 0.4 Septoria sp. 4.4 ± 0.1 Collectotrichum sp. 5.8 ± 0.3 Phoma sp. 8.5 ± 0.4 Botrytis cinerea 6.1 ± 0.0 Sclerotinia sclerotiorum 5.9 ± 0.2 a) average of three replicates. Fig. 2. Morphology of cells of B. velezensis YP2 by microscopy (Leica DM2500). D, fengycin, iturin, surfactin), siderophore (bacillibactin), polyketides (bacillaene, difficidin, macrolactin), dipeptide (basilysin), acetoin, 2,3-butandiol 등의이차대사물질을생산하는것으로보고되었으며 (Lee et al., 2012; Soumitra et al., 2015), 이러한이차대사물질들이식물병원세균이나곰팡이의생장과포자발아를억제및저항성유도등으로식물병방제가가능하며본연구에서선발된균주도식물병원균의균사생육억제와관련유전자를지니고있다고추정된다. 선발균주의동정 16S rrna와 gyrb 유전자를바탕으로 MEGA5 프로그램을이용하여분자유전학적인계통도를작성하고, 선발균주의분류학적위치를확인하였다 (Fig. 2). 16S rrna 유전자를바탕으로작성한계통도에서 YP2 균주는 Bacillus velezensis BCRC 17467(T) 균주와높은상동성 (100%) 을보였다 (Fig. 1A). B. siamensis 균주와는계통도의신뢰성을확보하기위한 bootstrap 값도 81% 로비교적높은값을보였다. YP2 균주는 gyrb 유전자를바탕으로작성한계통도에서 B. amyloliquefaciens subsp. plantarum 균주에높은상동성 (100%) 을보였으며, 99% 의 Bootstrap 값을보이며높은계통도의신뢰성을보였다 (Fig. 1B). 최근계통유전체학을근거로한 Bacillus spp. 의분류연구는근연종 Bacillus 4종, 즉 B. amyloliquefaciens subsp. plantarum, B. methylotrophicus, B. oryzicola, 및 B. velezensis를모두 B. velezensis로분류되어야한다고보고된바있다 (Dunlap et al., 2016). 본연구의선발균주인 YP2 균주는 16S rrna 와 gyrb 유전자를이용하여분석한결과 Dunlap 등의보고에따라 B. velezensis로동정되었으며, YP2균주를배양하여현미경상에서세균이다 (Fig. 2). B. velezensis YP2 균주의겨자채흰가루병에대한방제효과 20일간생육한청겨자에흰가루병이발생한초기에 YP2 균주를 LB배지에서배양한배양액을 10배희석하여 7일간격으로 3회분무처리한결과, YP2 균주는적겨자에처리하여흰가루병이 5.3% 병반면적율을나타내어 91.8% 방제효과를보였으며, 청겨자에대해서는청겨자에대해서는흰가루병병반면적율이 14.2% 로 80.9% 의높은방제효과를나타내었다 (Table 2). B. velezensis YP2 균주의처리간격및횟수에따른적겨자흰가루병방제효과적겨자흰가루병이발생한초기에 LB 배지에서배양한 YP2 균주의배양액을 10배희석하여 5일간격 4회, 7일간격 3회와 10일간격 2회분무처리한결과에서 5일간격 4 회처리구가흰가루병발생이 24.6% 로 70.6% 가장높은방제효과를, 7일간격 3회처리구는 29.3% 의흰가루병발생하여 65.0% 방제효과를보인반면에 10일간격 2회처리구는흰가루병발생이 49.5% 발생하여 40.9% 의낮은방제효과를나타내었다 (Table 3, Fig. 3). 10일간격 2회처리구의낮은방제효과는흰가루병균의분생포자가식물체에부 Table 2. Control effect of powdery mildew on leaf mustard variety by cultured broth of B. velezensis YP2 Treatment Red-Kyeoja Cheong-Kyeoja Lesion area (%) Control efficacy (%) Lesion area (%) Control efficacy (%) YP a a) a a) 80.9 Untreated check 63.8 b b - a) In a column, means followed by a common letter are not significantly different at the 5% level by DMRT (Duncan's multiple range test).
5 Bacillus velezensis YP2 의겨자채흰가루병의생물적방제 373 Table 3. Control effect of powdery mildew by treatment of cultured broth of B. velezensis YP2 at interval and frequency of treatment on red leaf mustard Treatment Application interval (day) Application frequency Lesion area (%) Control efficacy (%) 5 4 times 24.6 a a) 70.6 YP2 7 3 times 29.3 ab times 49.5 c 40.9 Microbial agent 7 3 times 65.7 d 21.6 Untreated check f - a) In a column, means followed by a common letter are not significantly different at the 5% level by DMRT. Fig. 3. Control effect of red leaf mustard powdery mildew by the cultured broth of B. velezensis YP2 at interval and frequency of application. A; 5 days interval 4 times treatment, B; 7 days interval 3 times treatment, C; 10 days interval 2 times treatment, D; untreated check. Table 4. Growth promoting activity and seed germination of red leaf mustard by treatment of B. velezensis YP2 Treatment Seed germination rate (%) Height (cm) Root length (cm) Fresh weight (g) YP a a) 10.8 a 28.5 a 2.1 a Untreated check 75.6 b 58.5 b 30.1 ab 1.1 b a) In a column, means followed by a common letter are not significantly different at the 5% level by DMRT. 착하여발아되어 5일 ~6일이면한세대가경과하여다시분생포자가형성되어매우빠른속도로분생포자세대를유지하면서식물체에피해를주어 (Endo, 1989) 새로운흰가루병균포자가비산되어서병발생하는생활사와깊은연관이있을것으로생각된다. Bacillus pumilus와 Bacillus subtilis 균주가식물병방제에효과가인정되어미국의아그라퀘스트사에서흰가루병등방제제로개발하여세레나데, 랩쏘디와쏘나타라는미생물농약제품으로등록하여, 미국, 독일, 스위스, 페루, 캐나다이태리와프랑스등에서사용되고있다 (Helene et al., 2011). 국내에서는 B. amyloliquefaciens M27 (Lee et al., 2013), B. subtilis B29, B. subtilis M10과 Streptomyces sp. CC19 균주가오이흰가루병에효과적인균주로서선발한바있으며 (Lee et al., 2010), 그리고 Bacillus sp. BS061 균주의 20배희석한배양여액은오이흰가루병을 62.4% 방제하였으며, 딸기흰가루병을 80.3% 방제효과를나타내었다 (Kim et al., 2013). 그리고 B. subtilis가생성한항균물질이투린과펜기신이오이흰가루병균 (Podosphaera fusca) 에대한길항력에큰주요역할을보고한바있다 (Romero et al., 2007). B. velezensis YP2 균주의침지에의한적겨자종자발아및생육촉진효과적겨자의종자발아에미치는영향을조사한결과에서 YP2 균주처리가종자발아율이 81.4% 로무처리 75.6% 보다 5.8% 종자발아율이증가되었으며, 적겨자의생육촉진을조사한결과에서는초장은 10.8 cm과생체중이 2.1 g으로무처리에비하여각각 127.1%, 190.9% 각각증가되었다 (Table 4). 바실러스균주의식물체의생육촉진에관여하는일차대사물질에서 2,3-butandiol과 IAA 생성유전자가가지고있다고밝혀져서 (Lee et al., 2012; Soumitra et al., 2015), YP2 균주도이런유전자를가지고있다고추정된다. 이상의결과에서와같이 B. velezensis YP2 균주는겨자채흰가루병에방제효과가우수하며, 종자발아를향상시키고생육을촉진하는특성을가지고있어친환경재배에사용될수있는우수한균주라고사료된다. 감사의글 본연구는농촌진흥청국립농업과학원농업과학기술연구개발사업 ( 과제번호 : PJ010049) 의지원에의해수행되었습니다.
6 374 이상엽 원항연 김정준 한지희 Literature Cited Chowdhury, S. P., A. Hartmann, X. W. Gao and R. Borriss (2015) Biocontrol mechanism by root-associated Bacillus amyloliquefaciens FZB42-a review. Frontiers in Microbiology/ 6:780. Copping, L. G. (2004) The manual of biocontrol agents. edition 4th, Alton: BCPC; UK, pp Dunlap, C. A, S. J. Kim, S. W. Kwon and A. P. Rooney (2016) Bacillus velezensis is not a later heterotypic synonym of Bacillus amyloliquefaciens; Bacillus methylotrophicus, Bacillus amyloliquefaciens subsp. plantarum and Bacillus oryzicola are later heterotypic synonyms of Bacillus velezensis based on phylogenomics. Int J Syst Evol Microbiol. 66: Endo, T. (1989) Studies on the life-cycle of cucurbit powdery mildew fungus Sphaerotheca fuliginea (schlecht) Poll. Spec. Bull. Fukushima Pref. Agr. Exp. Stn. 5: Helene, C., B. Wagner, F. Patrick and O. Marc (2011) Bacillusbased biological control of plant diseases in pesticides in the modern world - pesticides use and management. pp http;// Accessed 14 October Jeong, Y. H. (2000) Diagnosis and control of vegetables diseases and insects, Seoul : publisher Academy. 34. Kim, J. Y., B. S. Kim, S. E. Cho and H. D. Shin (2013) First report of powdery mildew caused by Erysiphe cruciferarum on indian mustard (Brassica juncea) in Korea. Plant Disease. 97:1383. Kim, Y. S., J. G. Song, I. K. Lee, W. H. Yeo and B. S. Yun (2013) Bacillus sp. BS061 Suppresses powdery mildew and gray mold. Mycobiology. 41(2): Kim, O. S., Y. J. Cho, K. Lee, S. H. Yoon, M. Kim, Na H, S. C. Park, Y. S. Jeon, J. H. Lee and H. Y, et al. (2012) Introducing EzTaxon-e: a prokaryotic 16S rrna gene sequence database with phylotypes that represent uncultured species. Int J Syst Evol Microbiol. 62: Lee, S. Y., B. Y. Kim, J. H. Ahn, J. Song, Y. J. Seol, W. G. Kim and H. Y. Weon (2012) Draft genome sequence of the biocontrol bacterium Bacillus amyloliquefaciens strain M27. J Bacteriol. 194: Lee, S. Y., Y. K. Lee, K. Park and Y. K. Kim (2010) Selection of beneficial microbial agents for control of fungal diseases in the phyllosphere of cucumber plant. Korean J. Pestic. Sci. 14(4): (in Korea) Lee, S. Y., H. Y. Weon, J. J. Kim, J. H. Han and W. G. Kim (2013) Control effect of the mixture of Bacillus amyloliquefaciens M27 and plant extract against cucumber powdery mildew. Korean J. Pestic. Sci. 17(4): Romero, D., de Vicente A. Rakotoaly, R. H. Dufour, S. E. Veening, J. W. Arrebola, E. Cazorla, F. M. Kuipers, O. P. Paquot and M. A. Perez-Garcia1 (2007) The iturin and fengycin families of lipopeptides are key factors in antagonism of Bacillus subtilis toward Podosphaera fusca. MPMI. 20(4): Song, J., S. C. Lee, J. W. Kang, H. J. Baek and J. W. Suh (2004) Phylogenetic analysis of Streptomyces spp. isolated from potato scab lesions in Korea on the basis of 16s rrna gene and 16s 23s rdna internally transcribed spacer sequences. Int J Syst Evol Microbiol. 54: Tamura, K, D. Peterson, N. Peterson, G. Stecher, M. Nei, S. Kumar (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 28: The Korean Society of Plant Pathology (2009) List of plant diseases in Korea. 5th ed. Seoul: Korean Society of Plant Pathology. Wang, L. T, F. L. Lee, C. J. Tai and H. Kasai (2007) Comparison of gyrb gene sequences, 16s rrna gene sequences and DNA-DNA hybridization in the Bacillus subtilis group. Int J Syst Evol Microbiol. 57: Yamamoto, S. and S. Harayama (1995) PCR amplification and direct sequencing of gyrb genes with universal primers and their application to the detection and taxonomic analysis of Pseudomonas putida strains. Appl Environ Microbiol. 61: Bacillus velezensis YP2 의겨자채흰가루병의생물적방제 이상엽 * 원항연 김정준 한지희국립농업과학원농업미생물과 요약 Bacillus velezensis YP2 균주는쌈채소에서분리한 Cercospora sp. 1~3, Septoria sp., Colletotrichum sp., Sclerotinia sclerotiorum, Phoma sp., Botrytis cinerea 에대하여균사생육을억제하였다. B. velezensis YP2 균주의 LB 배양액을 10 배희석액은적겨자와청겨자에발생하는 Erysiphe cruciferarm 에의한흰가루병을 91.8% 와 80.9% 방제효과을보였다. B. velezensis YP2 균주의배양액을 10 배희석하여 5 일간격 4 회처리구가적겨자흰가루병을 70.6%, 7 일간격 3 회처리구는 65.0%, 10 일간격 2 회처리구는 49.5% 방제하였다. 또한 B. velezensis YP2 균주는적겨자종자발아를증가시켜고생육을촉진하였다. 이상의결과에서 YP2 균주는겨자채흰가루병방제에매우효과적이었다. 색인어 항균력, 바실러스벨레젠시스, 생물적방제, Erysiphe cruciferarm, 겨자채, 흰가루병
DBPIA-NURIMEDIA
농약과학회지 (Korean J. Pestic. Sci.) Vol. 20, No. 3, pp. 189-196 (2016) Open Access http://dx.doi.org/10.7585/kjps.2016.20.3.189 Online ISSN 2287-2051 Print ISSN 1226-6183 ORIGINAL ARTICLES / SYNTHESIS / FORMULATION
More information212 Research in Plant Disease Vol. 20 No. 3., 7 (Kim, 2004). Colletotrichum (Park Kim, 1992),.. (Agrios, 2008)... 1,202, 256 92, 147, 11 (RDA, 2014).
식물병연구 Research Article Open Access Res. Plant Dis. 20(3) : 211-215(2014) http://dx.doi.org/10.5423/rpd.2014.20.3.211 Protective Activity of the Mixtures of Pine Oil and Copper Hydroxide against Bacterial
More information28 Research in Plant Disease Vol. 21 No 년 4월에 전라북도농업기술원의 노지 시험연구포장에 정식한 콜라비(품종 아삭콜)에서 처음으로 시들음병이 발생 하였다. 이병주에서 병원균을 순수분리하여 균주를 확보하 였다. 균학적 특성 및
식물병연구 Note Open Access Res. Plant Dis. 21(1) : 27-31(2015) http://dx.doi.org/10.5423/rpd.2015.21.1.027 Fusarium oxysporum First Report of Fusarium Wilt Caused by Fusarium oxysporum on Kohlrabi in Korea
More information연구목표 재료및방법 년도시험연구보고서
ABSTRACT This study was conducted to determine the optimum concentration of cactus standard nutrient solution for hydroponic culture in potted succulents, Echeveria derenbergii, Sedeveria Letizia and Cotyledon
More information1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
More information미생물유래물질을이용한식물병방제용작물보호제의산업화
미생물유래물질을이용한식물병방제용작물보호제의산업화 - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 -
More information- 2 -
- 1 - - 2 - - 3 - - 4 - - 5 - [ 그림 1] 산수유 [ 그림 2] 더덕 - 6 - - 7 - sample [ 그림 3] 균분리를위한접종 - 8 - PCA PCA with inoculum Slide glass [ 그림 4] Slide culture 모식도 - 9 - - 10 - Nutrient Medium Paperdisk with Antibiotics
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information식물병연구 Res. Plant Dis. 24(4): (2018) Note Open Access Botrytis cinerea Occurrence of Gray Mold Caused
식물병연구 Res. Plant Dis. 24(4): 302-307 (2018) Note Open Access https://doi.org/10.5423/rpd.2018.24.4.302 Botrytis cinerea Occurrence of Gray Mold Caused by Botrytis cinerea on Okra in Korea *Co-corresponding
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More informationca_02.hwp
SPSPSPSP SPSPSPS SPSPSP SPSPS SPSP SPS 공기청정기 항균필터 SPS - KACA009-139 한국공기청정협회 2002년 12월 31일 제정 2016년 -월 -일 개정예정 http://www.kaca.or.kr 1.1 적용범위 이 표준은 에어필터로 공기중의 입자제거 및 미생물 제균 성능을 지닌 필터에 대하여
More information492 Korean Journal of Soil Science and Fertilizer Vol. 51, No. 4, 2018 Introduction 인삼은오갈피나무과에속하는다년생초본식물로서작물의특성상동일장소에서 3-5년동안장기간재배하므로작물의생육기간중기상, 재배환경및
Korean J. Soil Sci. Fert. Vol.51, No.4, pp.491-498, 2018 Korean Journal of Soil Science and Fertilizer Article https://doi.org/10.7745/kjssf.2018.51.4.491 pissn : 0367-6315 eissn : 2288-2162 Suppressive
More information이발명을지원한국가연구개발사업 과제고유번호 SB010 부처명 농림수산식품부 연구사업명 생명산업기술개발사업 연구과제명 천연항생펩타이드발굴및산업적적용 기여율 1/1 주관기관 전남대학교 연구기간 ~
(19) 대한민국특허청 (KR) (12) 등록특허공보 (B1) (45) 공고일자 2014년04월01일 (11) 등록번호 10-1379708 (24) 등록일자 2014년03월25일 (51) 국제특허분류 (Int. Cl.) C12N 1/20 (2006.01) A01N 63/02 (2006.01) (21) 출원번호 10-2012-0013124 (22) 출원일자 2012
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information(72) 발명자 김성기 경기도수원시영통구영통동살구골 7 단지아파트 소호섭 경기도성남시분당구서현동 301 효자촌삼환아파트 이지영 서울특별시관악구봉천 6 동낙성대현대홈타운아파트 한영희 경기도수원시팔달구지동 김희동 경기
(19) 대한민국특허청 (KR) (12) 공개특허공보 (A) (51) 국제특허분류 (Int. Cl.) C12N 1/20 (2006.01) A01N 63/02 (2006.01) C12R 1/07 (2006.01) (21) 출원번호 10-2011-0138408 (22) 출원일자 2011 년 12 월 20 일 심사청구일자 전체청구항수 : 총 6 항 2011 년 12
More information(....).hwp
sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial
More information(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016) ISSN 228
(JBE Vol. 1, No. 1, January 016) (Regular Paper) 1 1, 016 1 (JBE Vol. 1, No. 1, January 016) http://dx.doi.org/10.5909/jbe.016.1.1.60 ISSN 87-9137 (Online) ISSN 16-7953 (Print) a), a) An Efficient Method
More information(52) CPC 특허분류 C12R 1/07 ( ) 이발명을지원한국가연구개발사업 과제고유번호 부처명 연구관리전문기관 연구사업명 연구과제명 기여율 1/2 산업통상자원부 한국산업기술평가관리원 산업융합원천기술개발사업 효과지속형광범위프로바이오틱작물보호
(19) 대한민국특허청 (KR) (12) 등록특허공보 (B1) (51) 국제특허분류 (Int. Cl.) C12N 1/20 (2006.01) A01N 63/02 (2017.01) C12R 1/07 (2006.01) (52) CPC 특허분류 C12N 1/20 (2013.01) A01N 63/02 (2013.01) (21) 출원번호 10-2015-0061418 (22)
More information농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 : ~ ) 과제의최종보고서로제출합니다 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 (
농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 :2014. 7. 29 ~ 2016. 7. 28.) 과제의최종보고서로제출합니다. 2016. 7. 28. 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 ( 인 ) 협동연구기관명 : 목원대학교산학협력단 ( 대표자 ) 고대식 ( 인 ) 협동연구기관명
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More informationResearch in Plant Disease Vol. 23 No , ,114 ha ,082 ha 10 (Ministry of Agriculture, Food and Rural Affairs, 2017)., ton, 20
식물병연구 Research Article Open Access Res. Plant Dis. 23(4): 322-333 (2017) https://doi.org/10.5423/rpd.2017.23.4.322 Monilinia fructicola Characteristics of Brown Rot Caused by Monilinia fructicola on Stone
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More information(2)-(455 김진철).fm
식물병연구 Res. Plant Dis. 18(2) : 109 116 (2012) http://dx.doi.org/10.5423/rpd.2012.18.2.109 Research Article Open Access Research in Plant Disease The Korean Society of Plant Pathology Bacillus subtilis GDYA-1
More information( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More information???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information(2)-02(최경자).fm
Res. Plant Dis. 16(2) : 148-152 (2010) Research in Plant Disease The Korean Society of Plant Pathology z w t w sƒ Á½ Á Á yá * w yw yw l Development of Effective Screening Method and Evaluation of Radish
More information???? 1
The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1
More information식물병연구 Note Open Access Res. Plant Dis. 22(2): (2016) Monilinia fructicola 에의한살구잿빛무늬병 Occurrence of
식물병연구 Note Open Access Res. Plant Dis. 22(2): 122-126 (2016) http://dx.doi.org/10.5423/rpd.2016.22.2.122 Monilinia fructicola 에의한살구잿빛무늬병 Occurrence of Brown Rot on Apricot Caused by Monilinia fructicola
More informationƯÇãû
'' - 1 - - 2 - - 3 - - 4 - - 5 - ' - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - Super-Bio Co., Ltd. KWON, Suk-Tae Thermostable DNA Polymerase-encoding Gene from Thermus sp. X-1 an d Amino Acid Sequence
More information이 발명을 지원한 국가연구개발사업 과제고유번호 G1111700300320000000000000 부처명 한국환경산업기술원 연구사업명 토양지하수오염방지기술개발사업 연구과제명 시데로포아(Siderophore)의 대량생산을 통한 토양 및 지하수의 친환경 중금속 제거기술 개 발
(19) 대한민국특허청(KR) (12) 공개특허공보(A) (11) 공개번호 10-2013-0029213 (43) 공개일자 2013년03월22일 (51) 국제특허분류(Int. Cl.) C12N 1/15 (2006.01) C12P 21/00 (2006.01) C12R 1/77 (2006.01) (21) 출원번호 10-2011-0092470 (22) 출원일자 2011년09월14일
More informationDBPIA-NURIMEDIA
논문 10-35-03-03 한국통신학회논문지 '10-03 Vol. 35 No. 3 원활한 채널 변경을 지원하는 효율적인 IPTV 채널 관리 알고리즘 준회원 주 현 철*, 정회원 송 황 준* Effective IPTV Channel Control Algorithm Supporting Smooth Channel Zapping HyunChul Joo* Associate
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More information05_06_HM _rev8_ hwp
Korean Journal of Microbiology (2014) Vol. 50, No. 3, pp. 201-209 DOI http://dx.doi.org/10.7845/kjm.2014.4035 Copyright c 2014, The Microbiological Society of Korea 보문 Bacillus sp. CS-52 를이용한고추탄저병 (Colletotrichum
More information13(이동운)p fm
Weed Turf. Sci. 2(2):202~206, 2013 DOI:dx.doi.org/10.5660/WTS.2013.2.2.202 Print ISSN 22877924, Online ISSN 22883312 Research Note Open Access Weed & Turfgrass Science The Korean Society of Weed Science
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Feb.; 29(2), 93 98. http://dx.doi.org/10.5515/kjkiees.2018.29.2.93 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) UHF-HF
More information03-2ƯÁý -14š
Management on hazardous chemicals for production of safe produce Namjun Cho, Sumyeong Hong, Wonil Kim, Byungjun Park Chemical Safety Division, National Academy of Agricultural Science, RDA * Correspondence
More informationDBPIA-NURIMEDIA
무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 901 무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 (A Effective Sinkhole Attack Detection Mechanism for LQI based Routing in WSN) 최병구 조응준 (Byung
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More information식물병연구 Res. Plant Dis. 25(1): (2019) Note Open Access Plasmodiophora brassicae Ocurrence of Clubroot Cau
식물병연구 Res. Plant Dis. 25(1): 33-37 (2019) Note Open Access https://doi.org/10.5423/rpd.2019.25.1.33 Plasmodiophora brassicae Ocurrence of Clubroot Caused by Plasmodiophora brassicae on Kohlrabi in Korea
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More information<B8F1C2F72E687770>
제1장 제17장 성홍열 및 사슬알균 감염증 사슬알균 (Streptococci)은 증식 중의 특징적으로 쌍 또는 사슬모양의 그람양성 알균 으로 catalase 음성, 통성혐기성균이며, 보통 한천배지에서는 발육이 어렵고 혈액이나 혈청 등을 첨가한 배지에서 잘 발육한다. 포도당이나 다른 탄수화물을 분해하나 포도당 을 분해하여 가스를 생성하지 않는다. 이들은 최소
More informationDBPIA-NURIMEDIA
e- 비즈니스연구 (The e-business Studies) Volume 17, Number 1, February, 28, 2016:pp. 293~316 ISSN 1229-9936 (Print), ISSN 2466-1716 (Online) 원고접수일심사 ( 수정 ) 게재확정일 2015. 12. 04 2015. 12. 24 2016. 02. 25 ABSTRACT
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: * Review of Research
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.79-102 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.79 * Review of Research Trends on Curriculum for Students with Severe and multiple
More information<31332E28C7B0C1BE29B9E8BCAEBAB92E687770>
韓 育 誌 (Korean J. Breed. Sci.) 40(2) : **~** (2008) 단경 내병 다수성 땅콩 품종 풍산 배석복 * 정영근 2 박장환 이명희 황정동 심강보 정찬식 강철환 박금룡 박충범 최규환 4 이재철 5 김인재 6 김제규 영남농업연구소, 2 호남농업연구소, 작물과학원, 4 전라북도노업기술원, 5 충청남도농업기술원, 6 충청북도 농업기술원,
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More information<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
More information식물병연구 Note Open Access Res. Plant Dis. 24(1): (2018) Fusarium oxysporum Fusarium Wilt Caused by Fusariu
식물병연구 Note Open Access Res. Plant Dis. 24(1): 75-80 (2018) https://doi.org/10.5423/rpd.2018.24.1.75 Fusarium oxysporum Fusarium Wilt Caused by Fusarium oxysporum on Passionfruit in Korea 1 2 * 2 2 1 3
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Sep.; 30(9), 712 717. http://dx.doi.org/10.5515/kjkiees.2019.30.9.712 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) MOS
More information28 Journal of Agriculture & Life Science 46(2) Ⅰ. 서론시금치 (Spinacia olerecea L.) 는명아주과에속하 는 1년생저온성식물로고대페르시아가원산지로아랍상인들에의해인디아와중국으로전해져현재까지식용으로이용되는작물이다 (Vic
농업생명과학연구 46(2) pp.27-33 Journal of Agriculture & Life Science 46(2) pp.27-33 식물정유, 길항세균및난황유를이용한시금치노균병방제 이정한 1 정성우 2 전성식 3 강신권 3 최준민 3 임채신 4 고학룡 5 이광수 6 정남준 7 배동원 8* 1 경상대학교생명과학연구원, 2 경상대학교농업생명과학연구원, 3
More information?
http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ
More information- 1 -
발간등록번호 11-1541000-001345-01 전통된장의농가기업형대량생산 system 개발 - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23
More information<32382DC3BBB0A2C0E5BED6C0DA2E687770>
논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More information33(4)-[09] 11(국).fm
J. Ginseng Res. Vol. 33, No. 4, 311-315 (2009) 일정조건에서아인산염을이용한 Phytophthora cactorum 이야기하는인삼역병의방제 이병대 * 밝훈 허브킹, 생물자원개발연구소, 한경대학교, 안성 (2009 년 9 월 8 일접수 ; 2009 년 12 월 10 일수정 ; 2009 년 12 월 11 일수리 ) Control
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More information(2)-05(김용기).fm
Res. Plant Dis. 16(2) : 163-169 (2010) Research in Plant Disease The Korean Society of Plant Pathology t q Pantoea agglomerans 59-4» w ½»*Á«Á wáy Á x Á yáw Á 1 Á 1 Á 2 w», 1, 2 Elucidation of Mode of Action
More information대한한의학원전학회지24권6호-전체최종.hwp
小兒藥證直訣 의 五臟辨證에 대한 小考 - 病證과 處方을 중심으로 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 ㆍ 韓醫學古典硏究所 白裕相1,2*1)2) A study on The Diagnosis and Treatment Using The Theory of Five Organs in Soayakjeungjikgyeol(小兒藥證直訣) 1 Dept. of Oriental
More information., (, 2000;, 1993;,,, 1994), () 65, 4 51, (,, ). 33, 4 30, 23 3 (, ) () () 25, (),,,, (,,, 2015b). 1 5,
* 4.,, 3,,, 3,, -., 3, 12, 27, 20. 9,,,,,,,,. 6,,,,,. 5,,,,.. * (2016),. (Corresponding Author): / / 303 Tel: 063-225-4496 / E-mail: jnj1015@jj.ac.kr ., (, 2000;, 1993;,,, 1994), 2000. 2015 () 65, 4 51,
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze
More informationEffects of baseball expertise and stimulus speeds on coincidence-anticipation timing accuracy of batting Jong-Hwa Lee, Seok-Jin Kim, & Seon-Jin Kim* Seoul National University [Purpose] [Methods] [Results]
More information歯5-2-13(전미희외).PDF
The Korean Journal of Counseling 2004, Vol. 5, No. 2, 423-434,. 4 5 18 9, 9.,,,,,.,,, t-.. :,,, (,, 1996),.,,. (, 2001),... 88 98 2000, 88 12.5%(250 )98 35.6%(712 )2.8 (,,, 2001) (Corresponding Author)
More informationuntitled
理 葉 CNFH-88-04 行 87 年 9 1 88 年 6 30 類 葉 Staphylococcus aureus Staphylococcus epidermidis Streptococcus mutans Streptococcus sanguis Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa Candida
More information27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
More information식물병연구 Note Open Access Res. Plant Dis. 23(3) : (2017) Analysis of the Cause of the Twig Blight on Mu
식물병연구 Note Open Access Res. Plant Dis. 23(3) : 283-287 (2017) https://doi.org/10.5423/rpd.2017.23.3.283 Analysis of the Cause of the Twig Blight on Mulberry Based on the Weather Conditions * *Corresponding
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More information제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상
6차 산업 수익모델 시범사업 농산물가공품개발 연구용역 최 종 보 고 서 영남대학교 식품공학과 연구책임자 : 한 기 동 제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김
More information식물병연구 Research Article Open Access Res. Plant Dis. 24(3): (2018) Incidence Rates of Major Diseases o
식물병연구 Research Article Open Access Res. Plant Dis. 24(3): 175-181 (2018) https://doi.org/10.5423/rpd.2018.24.3.175 Incidence Rates of Major Diseases on Green-Fleshed Kiwifruit cv. Hayward and Yellow-Fleshed
More information10(3)-09.fm
w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½
More informationDBPIA-NURIMEDIA
e- 비즈니스연구 (The e-business Studies) Volume 17, Number 3, June, 30, 2016:pp. 273~299 ISSN 1229-9936 (Print), ISSN 2466-1716 (Online) 원고접수일심사 ( 수정 ) 게재확정일 2016. 06. 11 2016. 06. 24 2016. 06. 26 ABSTRACT e-
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 4, pp DOI: A Study on the Opti
Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp.127-148 DOI: http://dx.doi.org/11024/pnuedi.27.4.201712.127 A Study on the Optimization of Appropriate Hearing-impaired Curriculum Purpose:
More information<353420B1C7B9CCB6F52DC1F5B0ADC7F6BDC7C0BB20C0CCBFEBC7D120BEC6B5BFB1B3C0B0C7C1B7CEB1D7B7A52E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 13, No. 2 pp. 866-871, 2012 http://dx.doi.org/10.5762/kais.2012.13.2.866 증강현실을 이용한 아동교육프로그램 모델제안 권미란 1*, 김정일 2 1 나사렛대학교 아동학과, 2 한세대학교 e-비즈니스학과
More information16_이주용_155~163.hwp
사상체질의학회지 2008;20(2):155-163 J of Sasang Constitutional Medicine Vol. 20, No. 2, 2008:155-163 http://www.esasang.com 腦 梗 塞 으로 발생한 少 陽 人 半 身 舞 蹈 病 患 者 치험 1례 이주용 이한얼 한경수 안택원 Abstract 대전대학교 한의과대학 사상체질과 A Soyangin
More information54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3
27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,
More information저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
More informationÆ÷Àå82š
Lee, Kyungbae (E-mail : kblee6078@ex.co.kr) Lee, Jaehoon (E-mail : ranian74@ex.co.kr) Sohn, Duecksu (E-mail : mgsds@ex.co.kr) Kwon, Soonmin (E-mail : soonmini2@ex.co.kr) ABSTRACT PURPOSES : The purpose
More information00Àâ¹°
ISSN 1598-5881 REVIEW c o n t e n t s REVIEW 3 4 5 6 7 8 9 10 REVIEW 11 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 REVIEW 37 39 40 41 42 43 44 45 46 47 48 49 50 51 52
More information00Àâ¹°
ISSN 1598-5881 REVIEW c o n t e n t s REVIEW 1 3 4 5 6 7 8 9 REVIEW 11 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 REVIEW 33 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
More information[ 영어영문학 ] 제 55 권 4 호 (2010) ( ) ( ) ( ) 1) Kyuchul Yoon, Ji-Yeon Oh & Sang-Cheol Ahn. Teaching English prosody through English poems with clon
[ 영어영문학 ] 제 55 권 4 호 (2010) 775-794 ( ) ( ) ( ) 1) Kyuchul Yoon, Ji-Yeon Oh & Sang-Cheol Ahn. Teaching English prosody through English poems with cloned native intonation. The purpose of this work is to
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 6, Jun Rate). STAP(Space-Time Adaptive Processing)., -
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Jun.; 29(6), 457463. http://dx.doi.org/10.5515/kjkiees.2018.29.6.457 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Sigma-Delta
More information160106_STEPI_Insight_179호(정기철,김석관_외)rp.hwp
2015. 12. 1. 제179호 개인 유전체 기반 맞춤 의료 현황과 발전과제 2015. 12. 1. 제179호 개인 유전체 기반 맞춤 의료 현황과 발전과제 정기철 김석관 김승현 이명화 목 차 < 요 약 > Ⅰ. 개인 유전체 기반 맞춤 의료 7 Ⅱ. 맞 춤 의료 기 술 현 황과 시 사 점 10 Ⅲ. 맞춤 의료 조직 및 비즈니스모델 현황과 시사점 16 Ⅳ.
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con
Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency
More information