DBPIA-NURIMEDIA
|
|
- 정균 김
- 7 years ago
- Views:
Transcription
1 농약과학회지 (Korean J. Pestic. Sci.) Vol. 20, No. 3, pp (2016) Open Access Online ISSN Print ISSN ORIGINAL ARTICLES / SYNTHESIS / FORMULATION / CONTROL 복합기능성 Bacillus sp. GH1-13 균주의특징 김상윤 상미경 원항연 전영아 1 류재환 2 송재경 * 농촌진흥청국립농업과학원농업미생물과, 1 농촌진흥청국립농업과학원농업유전자원센터, 2 전주대학교농생명EM환경연구센터 Characterization of Multifunctional Bacillus sp. GH1-13 Sang Yoon Kim, Mee Kyung Sang, Hang-Yeon Weon, Young-Ah Jeon 1, Jae Hwan Ryoo 2 and Jaekyeong Song* Agricultural Microbiology Division, National institute of Agricultural Sciences, RDA 55365, Republic of Korea 1 RDA-Genebank Information Center, National institute of Agricultural Sciences, RDA 54874, Republic of Korea 2 Research Center for Agro-Bio EM & Environmental Resources, Jeonju University 55065, Republic of Korea (Received on July 26, Revised on September 6, Accepted on September 11, 2016) Abstract Several microorganisms in particular Bacillus subtilis group have been isolated from diverse places such as soils and the gastrointestinal tract of ruminants etc., and used as biocontrol agent against various plant pathogens and utilized as plant growth promoting agents. Among them, Bacillus is well known as one of the most useful bacteria for biocontrol and plant growth promotion. Bacterium GH1-13 was isolated from a reclaimed paddy field in Wando Island and identified as Bacillus velezensis using phylogenetic analysis on the basis of 16S rrna and gyrb gene. It was confirmed that GH1-13 produced indole acetic acid (IAA) associated with promoted growth of rice root. GH1-13 showed characteristics of antagonization against the main pathogen of rice as well as diverse pathogenic fungi. GH1-13 had biosynthetic genes, bacillomycin, bacilycin, fengycin, iturin, and surfactin which are considered to be associated closely with inhibition of growth of pathogenic fungi and bacteria. This study showed that GH1-13 could be used as a multifunctional agent for biocontrol and growth promotion of crop. Key words Bacillus, biocontrol, growth promotion, multifunction, secondary metabolites. 서 론 농업에서작물의병을방제하고생산성을증대시키기위해다량으로사용되고있는화학농약과비료를대체할수있는환경친화적인소재로서미생물에대한연구가많이이루어지고있다 (Avis et al., 2008; Santoyo et al., 2012). 최근다양한미생물이시설하우스, 밭, 과수원등의농업현장에서활용되고있으며, 시군농업기술센터에서다양한미생물을배양하여농가에공급하고있다. 많은시군농업기술센터에서배양하여보급하는미생물은주로바실러스 (Bacillus), 유산균 (Lactic acid bacteria), 효모 (Saccharomyces), 광합성균 (Photosynthetic bacteria) 등이며몇몇곰팡이 (Aspergillus) *Corresponding author mgjksong@korea.kr 와방선균 (Streptomyces), 슈도모나스 (Pseudomonas) 등도활용되고있다. 이들중바실러스는작물의생육촉진, 병저항성증진, 병방제뿐아니라해충방제, 악취저감, 사료제조등의목적으로다양한농업현장에사용되고있다 (Velivelli et al., 2014). 바실러스는 non-ribosomal peptide synthetase (NRPS) 와 polyketide synthase (PKS) 를이용하여관련된여러항생제뿐만아니라다양한휘발성물질등을생산하여식물의생장을촉진하고병저항성을강화시켜병방제에도효과가있는것으로알려져있다 (Ongena and Jacques, 2008; Insam and Seewald, 2010; Raaijmakers et al., 2010; Chowdhury et al., 2015). 오이 (Cucumis sativus) 균핵병을방제할수있는 Bacillus sp. M27 균주와벼 (Oryza sativa) 의생육촉진및병을억제할수있는 Bacillus vallismortis EXTN-1 등이 189
2 190 김상윤 상미경 원항연 전영아 류재환 송재경 일반적으로알려져있다 (Park et al., 2006; Lee et al., 2013). 인삼밭토양으로부터미생물을분리하여인삼 (Panax ginseng) 뿌리썩음병균에길항력이있는바실러스균주를선발하여동정하고, 항진균활성에대한특성조사또한이루어진바있다 (Kim et al., 2012). 최근친환경농산물의수요증대와저농약농산물의폐지등으로작물병방제및생육촉진등의활성을가진미생물제의수요가증대하고있으며, 특히내생포자를생성하여제제화하기가용이한바실러스는다양하게미생물제재로서개발되어상용화되고있다 (Nicholson, 2002; Cawoy et al., 2011). 이와같이친환경미생물제의개발을위해작물의근권및주변토양뿐아니라다양한환경으로부터유용한미생물을분리하여특성을밝히고현장에적용하는연구가수행되고는있으나여전히생육촉진과병방제를동시에수행하는미생물에대한연구는미흡한실정이다. 본연구에서는간척지작물의병방제와더불어생육촉진등에활용할수있는유용미생물을분리하기위해대표간척지 3지역 ( 전남고흥, 충남당진, 전남완도 ) 의논으로부터시료를채취하여염에내성을가지며, 작물의주요병원균에대한길항활성이우수한균주를선발하고특성을분석하였으며, 16S rrna와 gyrb 유전자를이용하여동정하였다. 재료및방법 균주분리내염성을가지며, 작물생육촉진및병방제에활용할수있는세균을분리하기위해 2015년 5월간척지논 ( 전남고흥, 충남당진, 전남완도일대 ) 에서약 1cm의표토를제거하고오우거 (auger) 를이용하여 15 cm까지의토양을채취하였다. 각시료 1g을 9ml의멸균수에현탁하여 3% NaCl을 Table 1. Antagonistic activity of Bacillus sp. GH1-13 against diverse crop pathogenic bacteria and fungi. Length of inhibition zones were measured in triplicate. No inhibition zones were found in the control in this study Pathogens Strain/KACC a) Inhibition zones (mm) numbers Rep. 1 b) Rep. 2 Rep. 3 Anthracnose Colletotrichum acutatum KACC Bakanae disease Gibberella moniliformis KACC Bakanae disease Fusarium fujikuroi RGF Bakanae disease F. fujikuroi RGF Bakanae disease F. fujikuroi RGF Bakanae disease F. fujikuroi RGF Black mold Alternaria alternata KACC Blast Pyricularia grisea KACC Blight Xanthomonas oryzae KACC Brown spot Cercospora capcisi KACC Brown spot Bipolaris oryzae KACC Brown streak Acidovorax avenae KACC Canker Clavibacter michiganensis KACC Damping-off Phythium ultimum KACC Grain rot Burkholderia glumae KACC Gray mold Botrytis cinerea KACC Phytophthora blight Phytophthora capcisi KACC Root rot Fusarium oxysporum KACC Root rot Sclerotinia nivalis KACC Root rot Fusarium solani KACC Root rot Cylindrocarpon destructans KACC Scab Streptomyces acidophilus S Scab Streptomyces scabiei S ND c) Sclerotinia rot Sclerotinia sclerotiorum KACC Sheath blight Rhizoctonia solani KACC Soft rot Pectobacterium carotovorum KACC a) Korean agricultural culture collection. b) Replicate. c) Not detected
3 Multifunctional Bacillus sp. GH 포함한 R2A 배지에현탁액 0.1 ml를도말한후 28 o C 항온기에서 3일간배양하였다. R2A배지의조성은 Yeast extract 0.5 g, Proteose peptone 0.5 g, Casamino acids 0.5 g, Glucose 0.5 g, Soluble starch 0.5 g, Na-pyruvate 0.3 g, K 2 HPO g, MgSO 4 7H 2 O 0.05 g, Agar 15.0 g, distilled water 1,000 ml 이며 ph 7.0으로조절하였다. 다양한세균을분리하기위해무작위로다른형태나색깔을보이는집락을순수분리하였다. 분리균주의항균활성검정분리균주의항균활성검정은대치배양법을이용하였다. 병원성곰팡이인경우페트리접시에서병원균과분리균을대치배양하여식물병원균의생장저해능을검정하였으며, 세균인경우병원균을배지에도말한후분리균을그위에접종하여 3-5일간배양한후분리균에의한식물병원균의생장저해능을검정하였다. 사용된균주는벼에해를입히는주요병원균및다양한작물에서해를입히는주요병원균을사용하였으며, 이들균주는농촌진흥청농업유전자원센터 (Korean Agricultural Culture Collection (KACC), 에서분양받아사용하였다 (Table 1). Table 2. Primers used in this study Antibiotic Gene Primers Primer sequence (5-3 ) References Bacilysin bacd BACD-F1 AAAAACAGTATTGGTYATCGCTGA Chung et al. (2008) BACD-R1 CCATGATGCCTTCKATRCTGAT Bacillomycin D bmya BACC1F GAAGGACACGGCAGAGAGTC Athukorala et al. (2009) BACC1R CGCTGATGACTGTTCATGCT Fengycin fend FEND1F TTTGGCAGCAGGAGAAGTTT Athukorala et al. (2009) FEND1R GCTGTCCGTTCTGCTTTTTC Iturin A itua ITUD1F GATGCGATCTCCTTGGATGT Athukorala et al. (2009) ITUD1R ATCGTCATGTGCTGCTTGAG Surfactin srfa SUR3F ACAGTATGGAGGCATGGTC Athukorala et al. (2009) SUR3R TTCCGCCACTTTTTCAGTTT Zwittermicin A zwia ZWITF2 TTGGGAGAATATACAGCTCT Athukorala et al. (2009) ZWITR1 GACCTTTTGAAATGGGCGTA 16S 27F AGAGTTTGATCCTGGCAC Kim et al. (2012), rrna 1492R TACGGYTACCTTGTTACGACTT Song et al. (2004), 518F CCAGCAGCCGCGGTAATACG Ahn et al. (2014) 800R TACCAGGGTATCTAATCC 984F ACGCGARGAACCTTAC gyrb UP-1 UP-2r UP-1S UP-2Sr 선발균주의생육촉진활성검정선발균주의생육촉진활성을검정하기위해 L-tryptophan 을첨가한배지 (0.1% wt/v) 와무첨가 R2A broth배지에각각균주접종후 30 o C, 150 rpm에서약 48시간동안균주를배양하였다. 균주밀도가 cfu/ml 수준으로배양완료된배약액 1ml를 4 o C, 4000 rpm, 15분간원심분리하여균체를침강시킨후상등액만회수하였다. 배양상등액 0.5 ml 과 Salkowski 시약 1 ml (35% HClO 4 50 ml, 0.5 M FeCl 3 1mL) 을혼합하여상온에서 30분간반응시킨후분광광도계 (Infinite 200 PRO multimode reader, Tecan, Austria) 를이용하여 530 nm에서흡광도를측정하여균주의 IAA 생성능을확인하였다. 이때표준곡선은 Sigma사의 IAA (Indole- 3-Acetic Acid) 를 0, 10, 30, 50, 100 mg/l 농도로제조하여 R2A broth 배지에첨가후시료와동일한조건하에서반응후측정하였다 (Naqqash et al., 2016). 선발균주의작물생육촉진활성을검정하기위해 tryptic soy broth (TSB) 배지에서 40시간배양 ( 약 cfu/ml) 한후, 균체를 13,000 rpm, 15분간원심분리하고멸균증류수로두번세척하였다. TSB배지의조성은 Tryptone 17.0 g, Soytone 3.0 g, Glucose 2.5 g, Sodium Chloride 5.0 g, Dipotassium hydrogen phosphate 2.5 g, distilled water GAAGTCATCATGACCGTTCTGCAYGCNGGNGGNAART- TYGA AGCAGGGTACGGATGTGCGAGCCR TCNACRTCNGCRTC- NGTCAT GAAGTCATCATGACCGTTCTGCA AGCAGGGTACGGATGTGCGAGCC Fukushima et al. (2002), Yamamoto and Harayama (1995)
4 192 김상윤 상미경 원항연 전영아 류재환 송재경 1,000 ml이며, ph 7.3으로조절하였다. 수확한선발균주의균체는 0.03 M MgSO 4 용액에 cfu/ml의농도로현탁하였다. 활성검정대상작물인벼, 토마토 (Solanum lycopersicum), 오이종자는 1차소독액 (70% 에탄올, 0.1% Triton X-100) 에서 1분간침지한후, 2차소독액 (10% 차아염소산 (NaOCl), 0.1% Triton X-100) 에 15분간침지하였다. 침지된종자를멸균수로 5번세척하여준비하였다. 각종자를선발균주의현탁액 (A ) 에 3시간침지한후풍건하고생육검정파우치 (PhytoTC, USA) 에종자를올려놓고 28 o C 항온기 (16시간광조건 ) 에서 10일간배양한후줄기의생육길이와무게, 뿌리의발달개수및뿌리털의발달개수를육안으로관측후계수하였다. 선발균주의이차대사물질유전자의검출바실러스의병원균에대한길항활성을나타내는NRPS와 PKS의합성관련유전자를검출하기위해특이프라이머를활용하여 PCR을실시하였다 (Athukorala et al. 2009) (Table 2). PCR은 PCR 반응혼합액 (2X TOPsimple DyeMIX- Tenuto; Enzymonics Co., Korea) 을이용하였으며, 1 ul의 genomic DNA (30 ng) 와 10 pmol의프라이머를혼합하여 20 ul를최종부피로하여실행하였다. PCR은초기변성반응 (initial denaturation; 95 o C, 3분 ) 후, 증폭반응 ( 변성 ; 95 o C 30초, 결합 ; 55 o C 45초, 신장 ; 72 o C 1분 ) 을 30회반복하였으며, 최종신장반응은 72 o C에서 5분간실시하였다. 증폭한 PCR 산물은전기영동하여존재여부및크기를확인하였다. 선발균주의동정 GH1-13 균주의동정을위해 16S rrna 유전자와 Bacillus spp. 의분류에유용한 gyrb 유전자 (DNA gyrase유전자 ) 의염기서열을분석하였다 (Wang et al., 2007). GH1-13 균주는 TSB에접종하여 28 o C에서 24시간이상배양한후원심분리하여균체를수확하였다. QIAamp DNA mini kit (Qiagen, USA) 를이용하여 genomic DNA를추출하였다. 16S rrna 유전자는범용프라이머인 27F와 1492R을사용하였고, gyrb 유전자는범용프라이머 UP-1과 UP-2r을사용하여 PCR한후각각유전자의증폭산물을얻었다 (Yamamoto and Harayama, 1995; Song et al., 2004). 16S rrna 유전자의염기서열분석은3개의프라이머 (800R, 518F, 984F) 를이용하고 gyrb 유전자는두개의염기서열분석용프라이머 (UP-1S, UP-2Sr) 를이용하여분석하도록제노텍 ( 대전, 한국 ) 에의뢰하였다 (Table 1). 얻어진염기서열은 Seqman (DNASTAR, USA) 을이용하여직접오류를검정하고연결하였다. 각유전자의비교분석을위해서 16S rrna 유전자의염기서열은 EzTaxon-e 서버를통해서얻었으며, gyrb 유전자의염기서열은 Genbank ( 를통하여얻었 다. 계통도의작성을위해 MEGA 5.0 프로그램의 Clustal W 프로그램으로염기서열을정렬하였으며, Neighbor-joining 알고리즘을사용하고 1,000회반복 bootstraping을통해계통도의신뢰성을확인하였다 (Tamura et al., 2011). 통계분석통계분석은 SAS 프로그램 ( 버전 9.2) 을이용하여실시하였으며, t-검정을통해유의수준 5% 에서균주처리에따른생육증진효과를비교하였다. 결과및고찰 균주분리및항균활성검정간척지로알려진전남고흥군, 충남당진군, 전남완도군일대의논토양으로부터내염성이있는균주총 137균주를분리하였다. 분리한균주의 45% 는 Bacillus 속에속한균주였으며, 이들중대부분 (80%) 은 B. aryabhattai와 B. marisflavi, B. stratosphericus, B. megaterium 등인것으로분석되었다. 대치배양법을이용하여분리균주의벼의주요병원균에대한항균활성검정을수행한결과, 벼의주요병원균에대한생장억제활성을나타내는다양한세균을확인하였으며이들중가장강한활성을보이는바실러스균주 (GH1-13) 를선발하였다 (Fig. 1). GH1-13 균주는벼의주요곰팡이병원균인 Fusarium fujikuroi ( 키다리병균 ), Pyricularia grisea ( 도열병균 ), Bipolaris oryzae ( 깨씨무늬병균 ), Rhizoctonia solani ( 잎집무늬마름병균 ) 에대한강한활성을보였으며, 벼의주요세균병원균인 Xanthmonas oryzae ( 흰잎마름병균 ), Acidovorax avenae ( 세균성줄무늬병균 ), Burkholderia glumae ( 알마름병균 ) 에대해서도생육억제능을보였다 (Fig. 1). 또한 GH1-13은다양한작물에병을일으키는것으로알려진 Cercospora capsici ( 갈색무늬병균 ), Phytophthora capcisi ( 역병균 ), Sclerotinia sclerotiorum ( 균핵병균 ), Colletotrichum acutatum ( 탄저병균 ), Alternaria alternata ( 검은곰팡이병균 ), Botrytis cinerea ( 잿빛곰팡이병균 ), Fusarium oxysporum ( 뿌리썩음병균 ), Streptomyces scabiei ( 더뎅이병균 ), Clavibacter michiganensis ( 궤양병균 ), Pectobacterium carotoborum ( 무름병균 ) 에대한생육억제활성을보였다 (Table 1). 인삼뿌리썩음병의원인균인 Cylindrocarpon destructans ( 뿌리썩음병균 ), Sclerotinia nivalis ( 뿌리썩음병균 ) 에대한강한생육억제활성을보였다 (Table 1). 이결과를통해 GH1-13균주가벼를포함한다양한작물의병해방제를위한미생물제로서의잠재적가치가큰것으로평가된다. 향후실제농가에서생물검정을바탕으로 GH1-13 균주의현장적용성평가가수행되어야할것으로판단되며, 이를바탕으로토착세균을이용한우수한미생물제로서의활용가능성확인및다
5 Multifunctional Bacillus sp. GH Fig. 1. Growth inhibition of pathogenic fungi and bacteria of rice (Oryza sativa L.) by Bacillus sp. GH1-13. (A) Gibberella moniliformis KACC and Fusarium fujikuroi, (B) Bipolaris oryzae KACC 41025, (C) Pyricularia grisea KACC 40435, (D) Rhizoctonia solani KACC 40123, (E) Xanthomonas oryzae KACC 10331, (F) Acidovorax avenae KACC 10162, (G) Burkholderia glumae KACC Fig. 2. IAA production potential from several Bacillus stains in the presence or absence of tryptophan in R2A media. Bars indicate standard deviations (n=3). 양한병원균에대한생육억제활성기작에대한연구가진행되어야할것으로여겨진다. 선발균주의생육촉진활성검정 GH1-13 균주의 IAA 생성능을분석한결과, tryptophan 이 배지에추가되었을때의 IAA생성량 (31.4 µg/ml) 은없을때의생성량 (6.3 µg/ml) 보다약 5배정도증가되었으며타바실러스균주와비교하여큰차이를나타내지는않았다 (Fig. 2). 이는 GH1-13균주가 tryptophan을전구체로사용하여 IAA 를만드는 tryptophan 의존형경로를가진세균이라는것을보여준다 (Idris et al., 2007). 작물생육촉진활성을검정하기위하여 GH1-13 균주로침지처리한벼, 토마토, 오이의종자를생육검정파우치를이용하여검정하였다 (Fig. 3). 토마토와오이에대한생육촉진효과는통계적으로유의한차이가없는것으로나타났다. 벼의경우뿌리의길이에대한생육촉진효과는통계적인차이는없었으나뿌리털의개수에는통계적인유의성을보였다 (p<0.05, n=9)(fig. 3). 이러한결과는 GH1-13 균주가식물생육촉진과관련있는IAA같은물질분비를통해벼뿌리털의발달을촉진시켜벼의생육을촉진하는역할을하는것으로판단된다 (Richardson et al., 2009). 이러한균주의특징을이용하여벼의직파에활용한다면벼의생장초기에뿌리의발달에도움을줌으로써입모율을향상시켜벼의생육및생산성을개선할수있는미생물제의개발이가능할것으로여겨진다.
6 194 김상윤 상미경 원항연 전영아 류재환 송재경 Fig. 3. Growth promotion effects on cucumber, rice and tomato root after soaking seed into cell suspension (1 106 cfu/ml) of Bacillus sp. GH1-13. (p<0.05, n=9). NS means not significant, and * denote significance at the p<0.05 level. Bars indicate standard deviations (n=9). Fig. 4. Detection of biosynthetic genes of Bacillus sp. GH1-13 by PCR amplification. M. marker (100 bp ladder), 1; bacilysin (bacd, 749 bp), 2; bacillomycin (BmyA, 875 bp), 3; iturin (itua, 647 bp), 4; surfactin (srfa, 441 bp), 5; fengycin (fend, 964 bp), 6; zwittermicin (zwia, 779 bp). PCR products were detected on 1.5% agarose gel. Fig. 5. Neighbor-joining phylogenetic tree based on partial 16S rrna (A) and gyrb (B) gene sequences (1,416 bp and 1,065 bp, respectively) of Bacillus strains. Bootstrap values are indicated at branch points. Strain or culture collection and accession numbers are indicated next to species name. T means type strain. 선발 균주의 길항활성 관련 유전자의 검출 GH1-13 균주는 벼의 주요 병원균뿐만 아니라 채소 등의 작물에서 발생하는 많은 병원균, 특히 진균에 의한 병원균 에 강한 길항 활성을 보였다(Fig. 1). 이는 바실러스 균주들 이 다양한 생합성 유전자를 이용하여 2차 대사산물을 생산 하는 것처럼 GH1-13균주가 생합성 유전자를 가지고 관련된 항생 물질을 생산할 것으로 판단하여 기존에 알려진 생합성 유전자, bacd (bacilycin), bmya (bacillomycin D), fend (fengycin), itua (iturin A), srfa (surfactin), and zwia (zwittermicin A)를 검출할 수 있는 특이 프라이머를 이용하 여 PCR을 수행하였다(Ramarathnam et al., 2007; Athukorala et al., 2009; Kim et al., 2012)(Fig. 4). GH1-13 균주는 bacillomycin D (875 bp), bacilycin (749 bp), fengycin (964 bp), iturin (647 bp), surfactin (441 bp)을 생성하는 유전자를 지
7 Multifunctional Bacillus sp. GH 니는것으로조사되었으나, zwittermicin 생성관련유전자는검출되지않았다. Kim et al. (2012) 에의해보고된 Bacillus amyloliquifaciens GR4-5 균주와비교할때 fengycin 생합성유전자가추가적으로존재함을확인하였으며더불어세균에길항력을보이는 bacilycin 생합성유전자도확인하였다. 이러한결과는 GH1-13균주가다양한작물의진균및세균성병원균의생육을억제할수있는강력한미생물제로개발될수있음을보여준다. 선발균주의동정 GH1-13 균주의동정을위해 16S rrna와 gyrb 유전자를바탕으로 MEGA5 프로그램을이용하여분자유전학적인계통도를작성하였다 (Fig. 5). 16S rrna 유전자를바탕으로작성한계통도에서 GH1-13 균주는 Bacillus methylotrophicus KACC 13105(T) 균주와높은상동성 (100%) 을보였다 (Fig. 5(a)). 계통도의신뢰성을확보하기위한 Bootstrap 값도 69% 로비교적높은값을나타내어 Bacillus methylotrophicus 인것으로추정되었다. gyrb 유전자를바탕으로작성한계통도에서 GH1-13 균주는 Bacillus velezensis BCRC (T) 균주와 Bacillus methylotrophicus KACC 13105(T) 균주에같은높은상동성 (98.6%) 을보였다 (Fig. 5(b)). 최근계통유전체학을바탕으로두종 (B. methylotrophicus와 B. velezensis) 과더불어 B. amyloliquefaciens subsp. plantarum 과 B. oryzicola를포함하여모두 B. velezensis로분류되어져야한다고보고되었다 (Dunlap et al., 2016). 16S rrna 유전자와 gyrb 유전자의분석결과와 Dunlap et al. (2016) 의보고에따라 GH1-13 균주의분류학적인위치는 B. velezensis로판단된다. 결론적으로본연구에서는 B. velezensis GH1-13균주가작물의생육촉진과병방제를동시에해결할수있는강력한복합기능성미생물제로의가능성이있음을보여주었다. 그러나 B. velezensis GH1-13균주처리가실제현장에서항균활성에미치는영향에대한보다정밀한평가가요구되며, 현장적용성평가를위한후속연구가수행되어져야할것으로판단된다. 감사의글 본연구는농촌진흥청공동연구사업 ( 과제번호 : ) 의지원에의해수행되었습니다. Literature Cited Ahn, J. H., B. C. Kim, B. Y. Kim, S. J. Kim, J. Song, S. W. Kwon and H. Y. Weon (2014) Paenibacillus cucumis sp. nov. Isolated from Greenhouse Soil. J Microbiol. 52(6): Athukorala, S. N. P., W. G. D. Fernando and K. Y. Rashid (2009) Identification of antifungal antibiotics of Bacillus species isolated from different microhabitats using polymerase chain reaction and maldi-tof mass spectrometry. Can. J. Microbiol. 55(9): Avis, T. J., V. Gravel, H. Antoun and R. J. Tweddell (2008) Multifaceted beneficial effects of rhizosphere microorganisms on plant health and productivity. Soil Biol. Biochem. 40(7): Cawoy, H., W. Bettiol, P. Fickers and M. Ongena (2011) Bacillus-based biological control of plant diseases, p In D.M. Stoytcheva (ed.), Pesticides in the modern world - pesticides use and management, InTech. Chowdhury, P. S., A. Hartmann, X. Gao and R. Borriss (2015) Biocontrol mechanism by root-associated Bacillus amyloliquefaciens FZB42 - a review. Front. Microbiol. 6(780):1-11. Dunlap, C. A., S. J. Kim, S. W. Kwon and A. P. Rooney (2016) Bacillus velezensis is not a later heterotypic synonym of Bacillus amyloliquefaciens; Bacillus methylotrophicus, Bacillus amyloliquefaciens subsp. Plantarum and Bacillus oryzicola are later heterotypic synonyms of Bacillus velezensis based on phylogenomics. Int. J. Syst. Evol. Microbiol. 66(3): Fukushima, M., K. Kakinuma and R. Kawaguchi (2002) Phylogenetic analysis of Salmonella, Shigella, and Escherichia coli strains on the basis of the gyrb gene sequence. J. Clin. Microbiol. 40(8): Idris, E. E., D. J. Iglesias, M. Talon and R. Borriss (2007) Tryptophan-dependent production of indole-3-acetic acid (iaa) affects level of plant growth promotion by Bacillus amyloliquefaciens FZB42. Mol. Plant-Microbe Interact. 20(6): Insam, H. and M. S. A. Seewald (2010) Volatile organic compounds (vocs) in soils. Biol. Fertil. Soils 46(3): Kim, B. Y., J. H. Ahn, H. Y. Weon, J. Song, S. I. Kim and W. G. Kim (2012) Isolation and characterization of Bacillus species possessing antifungal activity against ginseng root rot pathogens. Korean J. Pestic. Sci. 16(4): Lee, S. Y., H. Y. Weon, J. J. Kim, J. H. Han and W. G. Kim (2013) Control effect of the mixture of Bacillus amyloliquefaciens M27 and plant extract against cucumber powdery mildew. Korean J. Pestic. Sci. 17(4): Naqqash, T., S. Hameed, A. Imran, M. K. Hanif, A. Majeed and J. D. van Elsas (2016) Differential response of potato toward inoculation with taxonomically diverse plant growth promoting rhizobacteria. Front. Plant Sci. 7(1):144. Nicholson, L. W. (2002) Roles of Bacillus endospores in the environment. Cell. Mol. Life Sci. 59(3): Ongena, M. and P. Jacques (2008) Bacillus lipopeptides: Versatile weapons for plant disease biocontrol. Trends Microbiol. 16(3): Park, K., D. Paul and W. H. Yeh (2006) Bacillus vallismortis extn-1-mediated growth promotion and disease suppression
8 196 김상윤 상미경 원항연 전영아 류재환 송재경 in rice. Plant Pathol. J. 22(3): Raaijmakers, J. M., I. De Bruijn, O. Nybroe and M. Ongena (2010) Natural functions of lipopeptides from Bacillus and Pseudomonas: More than surfactants and antibiotics. Fems Microbiol. Rev. 34(6): Ramarathnam, R., S. Bo, Y. Chen, W. G. D. Fernando, G. Xuewen and T. de Kievit (2007) Molecular and biochemical detection of fengycin- and bacillomycin d-producing Bacillus spp., antagonistic to fungal pathogens of canola and wheat. Can. J. Microbiol. 53(7): Richardson, A. E., J. M. Barea, A. M. McNeill and C. Prigent- Combaret (2009) Acquisition of phosphorus and nitrogen in the rhizosphere and plant growth promotion by microorganisms. Plant Soil 321(1): Santoyo, G., M. d. C. Orozco-Mosqueda and M. Govindappa (2012) Mechanisms of biocontrol and plant growthpromoting activity in soil bacterial species of Bacillus and Pseudomonas: A review. Biocontrol Sci. Technol. 22(8): Song, J., S. C. Lee, J. W. Kang, H. J. Baek and J. W. Suh (2004) Phylogenetic analysis of streptomyces spp. Isolated from potato scab lesions in korea on the basis of 16s rrna gene and 16s-23s rdna internally transcribed spacer sequences. Int. J. Syst. Evol. Microbiol. 54(1): Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei and S. Kumar (2011) Mega 5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28(10): Velivelli, S. L. S., P. De Vos, P. Kromann, S. Declerck and B. D. Prestwich (2014) Biological control agents: From field to market, problems, and challenges. Trends Biotechnol. 32(10): Wang, L. T., F. L. Lee, C. J. Tai and H. Kasai (2007) Comparison of gyrb gene sequences, 16s rrna gene sequences and DNA-DNA hybridization in the Bacillus subtilis group. Int. J. Syst. Evol. Microbiol. 57(8): Yamamoto, S. and S. Harayama (1995) PCR amplification and direct sequencing of gyrb genes with universal primers and their application to the detection and taxonomic analysis of Pseudomonas putida strains. Appl. Environ. Microbiol. 61(3): 복합기능성 Bacillus sp. GH1-13 균주의특징 김상윤 상미경 원항연 전영아 1 류재환 2 송재경 * 농촌진흥청국립농업과학원농업미생물과, 1 농촌진흥청국립농업과학원농업유전자원센터, 2 전주대학교농생명 EM 환경연구센터 요약바실러스는토양및반추동물의소화기관과같은다양한곳에서분리되고있으며, 작물의생육촉진과병방제를위한미생물재제로서널리사용되고있다. 바실러스 GH1-13 균주는전남완도의간척지논에서분리되었으며, 16S rrna 유전자와 gyrb 유전자를이용하여계통유전학적으로분석한결과 Bacillus velezensis 인것으로동정되었다. GH1-13 균주의특성을분석한결과생육촉진에관련된 IAA 를생성할뿐아니라벼뿌리의생육을촉진하는것을확인하였다. 또한벼의주요병원균의생육을억제할뿐아니라작물의병원균인다양한곰팡이의생육을저해하였다. 더불어식물병원진균및세균의생육억제와밀접하게관련된것으로판단되는 bacillomycin, bacilycin, fengycin, iturin, surfactin 을생성하는생합성유전자를보유한것으로확인되었다. 본연구는 GH1-13 균주가작물의생육촉진과병방제를동시에해결할수있는강력한복합기능성미생물제로의가능성이있음을보여주었다. 색인어 바실러스, 생육촉진, 방제, 복합기능, 이차대사물질
DBPIA-NURIMEDIA
농약과학회지 (Korean J. Pestic. Sci.) Vol. 20, No. 4, pp. 369-374 (2016) Open Access https://doi.org/10.7585/kjps.2016.20.4.369 Online ISSN 2287-2051 Print ISSN 1226-6183 ORIGINAL ARTICLES / BIOPESTICIDE Bacillus
More information- 2 -
- 1 - - 2 - - 3 - - 4 - - 5 - [ 그림 1] 산수유 [ 그림 2] 더덕 - 6 - - 7 - sample [ 그림 3] 균분리를위한접종 - 8 - PCA PCA with inoculum Slide glass [ 그림 4] Slide culture 모식도 - 9 - - 10 - Nutrient Medium Paperdisk with Antibiotics
More information212 Research in Plant Disease Vol. 20 No. 3., 7 (Kim, 2004). Colletotrichum (Park Kim, 1992),.. (Agrios, 2008)... 1,202, 256 92, 147, 11 (RDA, 2014).
식물병연구 Research Article Open Access Res. Plant Dis. 20(3) : 211-215(2014) http://dx.doi.org/10.5423/rpd.2014.20.3.211 Protective Activity of the Mixtures of Pine Oil and Copper Hydroxide against Bacterial
More information492 Korean Journal of Soil Science and Fertilizer Vol. 51, No. 4, 2018 Introduction 인삼은오갈피나무과에속하는다년생초본식물로서작물의특성상동일장소에서 3-5년동안장기간재배하므로작물의생육기간중기상, 재배환경및
Korean J. Soil Sci. Fert. Vol.51, No.4, pp.491-498, 2018 Korean Journal of Soil Science and Fertilizer Article https://doi.org/10.7745/kjssf.2018.51.4.491 pissn : 0367-6315 eissn : 2288-2162 Suppressive
More information1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
More information28 Research in Plant Disease Vol. 21 No 년 4월에 전라북도농업기술원의 노지 시험연구포장에 정식한 콜라비(품종 아삭콜)에서 처음으로 시들음병이 발생 하였다. 이병주에서 병원균을 순수분리하여 균주를 확보하 였다. 균학적 특성 및
식물병연구 Note Open Access Res. Plant Dis. 21(1) : 27-31(2015) http://dx.doi.org/10.5423/rpd.2015.21.1.027 Fusarium oxysporum First Report of Fusarium Wilt Caused by Fusarium oxysporum on Kohlrabi in Korea
More information(....).hwp
sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial
More information이 발명을 지원한 국가연구개발사업 과제고유번호 G1111700300320000000000000 부처명 한국환경산업기술원 연구사업명 토양지하수오염방지기술개발사업 연구과제명 시데로포아(Siderophore)의 대량생산을 통한 토양 및 지하수의 친환경 중금속 제거기술 개 발
(19) 대한민국특허청(KR) (12) 공개특허공보(A) (11) 공개번호 10-2013-0029213 (43) 공개일자 2013년03월22일 (51) 국제특허분류(Int. Cl.) C12N 1/15 (2006.01) C12P 21/00 (2006.01) C12R 1/77 (2006.01) (21) 출원번호 10-2011-0092470 (22) 출원일자 2011년09월14일
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More information(72) 발명자 김성기 경기도수원시영통구영통동살구골 7 단지아파트 소호섭 경기도성남시분당구서현동 301 효자촌삼환아파트 이지영 서울특별시관악구봉천 6 동낙성대현대홈타운아파트 한영희 경기도수원시팔달구지동 김희동 경기
(19) 대한민국특허청 (KR) (12) 공개특허공보 (A) (51) 국제특허분류 (Int. Cl.) C12N 1/20 (2006.01) A01N 63/02 (2006.01) C12R 1/07 (2006.01) (21) 출원번호 10-2011-0138408 (22) 출원일자 2011 년 12 월 20 일 심사청구일자 전체청구항수 : 총 6 항 2011 년 12
More information102 Research in Plant Disease Vol. 20 No. 2...,., (Hynes Boyetchko, 2006; Timmer, 1991).,,.,.,,,. 감귤궤양병균분리와동정. (: ). 55 mm 1% sodium hypochlorite solu
식물병연구 Research Article Open Access Res. Plant Dis. 20(2) : 101-106(2014) http://dx.doi.org/10.5423/rpd.2014.20.2.101 Suppression of Citrus Canker by Pretreatment with Rhizobacterial Strains Showing Antibacterial
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More information(2)-(455 김진철).fm
식물병연구 Res. Plant Dis. 18(2) : 109 116 (2012) http://dx.doi.org/10.5423/rpd.2012.18.2.109 Research Article Open Access Research in Plant Disease The Korean Society of Plant Pathology Bacillus subtilis GDYA-1
More information( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
More information05_06_HM _rev8_ hwp
Korean Journal of Microbiology (2014) Vol. 50, No. 3, pp. 201-209 DOI http://dx.doi.org/10.7845/kjm.2014.4035 Copyright c 2014, The Microbiological Society of Korea 보문 Bacillus sp. CS-52 를이용한고추탄저병 (Colletotrichum
More information42(3)-9(p ).fm
The Korean Journal of Microbiology, Vol., No., September 006, p. -9 Copyright 006, The Microbiological Society of Korea w ³ ƒ ƒ y ³ p»x 1 Á y 1,, * w œw w w 1/6*(# $» w» w w ³ ƒ ƒ y ³ «m l w. ³ w e mw,
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More information식물병연구 Research Article Open Access Res. Plant Dis. 24(3): (2018) Incidence Rates of Major Diseases o
식물병연구 Research Article Open Access Res. Plant Dis. 24(3): 175-181 (2018) https://doi.org/10.5423/rpd.2018.24.3.175 Incidence Rates of Major Diseases on Green-Fleshed Kiwifruit cv. Hayward and Yellow-Fleshed
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More information식물병연구 Res. Plant Dis. 24(4): (2018) Note Open Access Botrytis cinerea Occurrence of Gray Mold Caused
식물병연구 Res. Plant Dis. 24(4): 302-307 (2018) Note Open Access https://doi.org/10.5423/rpd.2018.24.4.302 Botrytis cinerea Occurrence of Gray Mold Caused by Botrytis cinerea on Okra in Korea *Co-corresponding
More informationca_02.hwp
SPSPSPSP SPSPSPS SPSPSP SPSPS SPSP SPS 공기청정기 항균필터 SPS - KACA009-139 한국공기청정협회 2002년 12월 31일 제정 2016년 -월 -일 개정예정 http://www.kaca.or.kr 1.1 적용범위 이 표준은 에어필터로 공기중의 입자제거 및 미생물 제균 성능을 지닌 필터에 대하여
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More information식물병연구 Research Article Open Access Res. Plant Dis. 24(3): (2018) Botrytis cinerea Colletotrichum acu
식물병연구 Research Article Open Access Res. Plant Dis. 24(3): 213-220 (2018) https://doi.org/10.5423/rpd.2018.24.3.213 Botrytis cinerea Colletotrichum acutatum Sorangium cellulosum Subspecies Classifying and
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More information이발명을지원한국가연구개발사업 과제고유번호 SB010 부처명 농림수산식품부 연구사업명 생명산업기술개발사업 연구과제명 천연항생펩타이드발굴및산업적적용 기여율 1/1 주관기관 전남대학교 연구기간 ~
(19) 대한민국특허청 (KR) (12) 등록특허공보 (B1) (45) 공고일자 2014년04월01일 (11) 등록번호 10-1379708 (24) 등록일자 2014년03월25일 (51) 국제특허분류 (Int. Cl.) C12N 1/20 (2006.01) A01N 63/02 (2006.01) (21) 출원번호 10-2012-0013124 (22) 출원일자 2012
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information식물병연구 Res. Plant Dis. 25(1): (2019) Note Open Access Plasmodiophora brassicae Ocurrence of Clubroot Cau
식물병연구 Res. Plant Dis. 25(1): 33-37 (2019) Note Open Access https://doi.org/10.5423/rpd.2019.25.1.33 Plasmodiophora brassicae Ocurrence of Clubroot Caused by Plasmodiophora brassicae on Kohlrabi in Korea
More information01_HM hwp
The Korean Journal of Microbiology (2011) Vol. 47, No. 2, pp. 103-109 Copyright c 2011, The Microbiological Society of Korea Loop-Mediated Isothermal Amplification (LAMP) 법을이용한 Pectobacterium carotovorum
More information<353420B1C7B9CCB6F52DC1F5B0ADC7F6BDC7C0BB20C0CCBFEBC7D120BEC6B5BFB1B3C0B0C7C1B7CEB1D7B7A52E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 13, No. 2 pp. 866-871, 2012 http://dx.doi.org/10.5762/kais.2012.13.2.866 증강현실을 이용한 아동교육프로그램 모델제안 권미란 1*, 김정일 2 1 나사렛대학교 아동학과, 2 한세대학교 e-비즈니스학과
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Feb.; 29(2), 93 98. http://dx.doi.org/10.5515/kjkiees.2018.29.2.93 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) UHF-HF
More information농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 : ~ ) 과제의최종보고서로제출합니다 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 (
농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 :2014. 7. 29 ~ 2016. 7. 28.) 과제의최종보고서로제출합니다. 2016. 7. 28. 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 ( 인 ) 협동연구기관명 : 목원대학교산학협력단 ( 대표자 ) 고대식 ( 인 ) 협동연구기관명
More informationuntitled
理 葉 CNFH-88-04 行 87 年 9 1 88 年 6 30 類 葉 Staphylococcus aureus Staphylococcus epidermidis Streptococcus mutans Streptococcus sanguis Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa Candida
More information식물병연구 Note Open Access Res. Plant Dis. 24(1): (2018) Fusarium oxysporum Fusarium Wilt Caused by Fusariu
식물병연구 Note Open Access Res. Plant Dis. 24(1): 75-80 (2018) https://doi.org/10.5423/rpd.2018.24.1.75 Fusarium oxysporum Fusarium Wilt Caused by Fusarium oxysporum on Passionfruit in Korea 1 2 * 2 2 1 3
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More information(....).hwp
연구기관 한국식품연구원 농림부 연구기관 한국식품연구원 농림부 Analytical Semi-preparative Solution A 1) Solution B 2) Mixing Spreading Coating medium Corona treated OPP 3) film Casting Drying
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More information(52) CPC 특허분류 C12R 1/07 ( ) 이발명을지원한국가연구개발사업 과제고유번호 부처명 연구관리전문기관 연구사업명 연구과제명 기여율 1/2 산업통상자원부 한국산업기술평가관리원 산업융합원천기술개발사업 효과지속형광범위프로바이오틱작물보호
(19) 대한민국특허청 (KR) (12) 등록특허공보 (B1) (51) 국제특허분류 (Int. Cl.) C12N 1/20 (2006.01) A01N 63/02 (2017.01) C12R 1/07 (2006.01) (52) CPC 특허분류 C12N 1/20 (2013.01) A01N 63/02 (2013.01) (21) 출원번호 10-2015-0061418 (22)
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More information27송현진,최보아,이재익.hwp
OSMU전략에 따른 산업 동향 및 발전방안 -영상콘텐츠를 중심으로- A current research & development study on the OSMU strategy in field of game industry -A special study on the popular visual contents- 주저자: 송현진 (Song Hyun Jin) 서울산업대학교
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)
More information<30305FC0D3BFF8B8EDB4DC2DB8F1C2F72DC0B1B8AEB1D4C1A4283450292E687770>
Korean Journal of Environmental Agriculture Korean J Environ Agric. 2015;34(1):46-51. Korean Online ISSN: 2233-4173 Published online 2015 February 10. http://dx.doi.org/10.5338/kjea.2015.34.1.03 Print
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More informationResearch in Plant Disease Vol. 23 No , ,114 ha ,082 ha 10 (Ministry of Agriculture, Food and Rural Affairs, 2017)., ton, 20
식물병연구 Research Article Open Access Res. Plant Dis. 23(4): 322-333 (2017) https://doi.org/10.5423/rpd.2017.23.4.322 Monilinia fructicola Characteristics of Brown Rot Caused by Monilinia fructicola on Stone
More informationJournal of Life Science 2011, Vol. 21. No μ μ
Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information1 1 10-0767050 2 10-1166045 3 10-0895586 4- - 10 4 10-1616887 11 5 10-1358259 12 6 10-0775080 7 10-0973839 8 10-1165269 15 9 10-1056952 16 10 10-1551559 11 10-1179175 12 10-1179177 19 13 10-1136822 20
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More information274 한국문화 73
- 273 - 274 한국문화 73 17~18 세기통제영의방어체제와병력운영 275 276 한국문화 73 17~18 세기통제영의방어체제와병력운영 277 278 한국문화 73 17~18 세기통제영의방어체제와병력운영 279 280 한국문화 73 17~18 세기통제영의방어체제와병력운영 281 282 한국문화 73 17~18 세기통제영의방어체제와병력운영 283 284
More information1
北 地 区 青 少 年 境 研 会 Международный детский симпозиум по проблемам экологии региона Северо-Восточной Азии. 1 2 5 6 7 9 1. 2. 11 12 13 13 14 15 16 . (Nature) 100.. 90%.. 3000 10% 385. 1 1, 500 2kg.........
More information<BCF6BDC3323030392D31385FB0EDBCD3B5B5B7CEC8DEB0D4C5B8BFEEB5B5C0D4B1B8BBF3BFACB1B85FB1C7BFB5C0CE2E687770>
... 수시연구 2009-18.. 고속도로 휴게타운 도입구상 연구 A Study on the Concept of Service Town at the Expressway Service Area... 권영인 임재경 이창운... 서 문 우리나라는 경제성장과 함께 도시화가 지속적으로 진행되어 지방 지역의 인구감소와 경기의 침체가 계속되고 있습니다. 정부의 다각 적인
More information식물병연구 Note Open Access Res. Plant Dis. 23(3) : (2017) Analysis of the Cause of the Twig Blight on Mu
식물병연구 Note Open Access Res. Plant Dis. 23(3) : 283-287 (2017) https://doi.org/10.5423/rpd.2017.23.3.283 Analysis of the Cause of the Twig Blight on Mulberry Based on the Weather Conditions * *Corresponding
More information<B8F1C2F72E687770>
제1장 제17장 성홍열 및 사슬알균 감염증 사슬알균 (Streptococci)은 증식 중의 특징적으로 쌍 또는 사슬모양의 그람양성 알균 으로 catalase 음성, 통성혐기성균이며, 보통 한천배지에서는 발육이 어렵고 혈액이나 혈청 등을 첨가한 배지에서 잘 발육한다. 포도당이나 다른 탄수화물을 분해하나 포도당 을 분해하여 가스를 생성하지 않는다. 이들은 최소
More informationResearch in Plant Disease Vol. 23 No (Han, 2009; Kim, 1998, 2016; Lee, 2011, 2013; Tran Kim, 2012)., Fusarium, Verticillium (Hwang, 2009). R. s
식물병연구 Research Article Open Access Res. Plant Dis. 23(3): 228-233 (2017) https://doi.org/10.5423/rpd.2017.23.3.228 Resistance to Bacterial Wilt of Rootstock Varieties of Tomato and Graft Compatibility
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More informationDBPIA-NURIMEDIA
농약과학회지 (Korean J. Pestic. Sci.) Vol. 20, No. 2, pp. 165-171 (2016) Open Access http://dx.doi.org/10.7585/kjps.2016.20.2.165 Online ISSN 2287-2051 Print ISSN 1226-6183 ORIGINAL ARTICLES / CONTROL 도라지와더덕뿌리썩음병의방제효과에미치는재배환경의영향
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More information- 1 -
발간등록번호 11-1541000-001345-01 전통된장의농가기업형대량생산 system 개발 - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23
More information歯kjmh2004v13n1.PDF
13 1 ( 24 ) 2004 6 Korean J Med Hist 13 1 19 Jun 2004 ISSN 1225 505X 1) * * 1 ( ) 2) 3) 4) * 1) ( ) 3 2) 7 1 3) 2 1 13 1 ( 24 ) 2004 6 5) ( ) ( ) 2 1 ( ) 2 3 2 4) ( ) 6 7 5) - 2003 23 144-166 2 2 1) 6)
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More information44(1)-5( )(p.56-62).fm
The Korean Journal of Microbiology, Vol. 44, No. 1, March 2008, p. 56-62 Copyrightc2008, The Microbiological Society of Korea 송이자실체기저부토양으로부터항균활성을가지는 KM1-15 균주의분리및분류학적특성 김윤지 1 황경숙 1,2 * 1 목원대학교미생물생태자원연구소,
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More information06.hwp
-Original Paper-35 41. 2009. 토양으로부터분리한토착유효미생물을이용한음식물쓰레기의자원화 이상우 함선녀 신택수 김혜경 연익준 * 김광렬 * (2008 8 21, 2009 1 23 ) Resource of Food Waste using Indigenous Bacteria Isolated from Soils Sang-Woo Lee Sun Nyeoo
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information10(3)-12.fm
w y wz 10«3y 273~280 (2010.12.) Journal of Korean Society of Urban Environment p yá xá½k w y œw (2010 9 15, 2010 12 2 k) Analysis of Characteristics of Delivered Nonpoint Source Pollution at Forested Watershed
More information식물병연구 Note Open Access Res. Plant Dis. 22(2): (2016) Monilinia fructicola 에의한살구잿빛무늬병 Occurrence of
식물병연구 Note Open Access Res. Plant Dis. 22(2): 122-126 (2016) http://dx.doi.org/10.5423/rpd.2016.22.2.122 Monilinia fructicola 에의한살구잿빛무늬병 Occurrence of Brown Rot on Apricot Caused by Monilinia fructicola
More information04서종철fig.6(121~131)ok
Development of Mobile Applications Applying Digital Storytelling About Ecotourism Resources Seo, Jongcheol* Lee, Seungju**,,,. (mobile AIR)., 3D.,,.,.,,, Abstract : In line with fast settling trend of
More information( ).fm
Kor. J. Microbiol. Biotechnol. Vol. 38, No. 4, 373 378 (2010) 충청지역누룩에서양조용우수곰팡이의탐색및특성 백성열 1 윤혜주 1 최혜선 1 홍승범 2 구본성 3 여수환 1 * 1 농촌진흥청국립농업과학원농식품자원부, 2 농촌진흥청국립농업과학원농업생물부 3 농촌진흥청국립농업과학원농업생명자원부 Screening and
More information10(3)-10.fm
w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction
More information<32382DC3BBB0A2C0E5BED6C0DA2E687770>
논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학
More information(2)-03(허성기).fm
Res Plant Dis 16() : 136-140 (010) Research in Plant Disease The Korean Society of Plant Pathology l w w z Á 1 Áx»* w w, 1 Suppression Effect on Soft-rot by Bacteriocin-producing Avirulent Pectobacterium
More information<BFACBCBCC0C7BBE7C7D02831302031203139292E687770>
延 世 醫 史 學 제12권 제2호: 29-40, 2009년 12월 Yonsei J Med Hist 12(2): 29-40, 2009 특집논문 3 한국사회의 낙태에 대한 인식변화 이 현 숙 이화여대 한국문화연구원 1. 들어가며 1998년 내가 나이 마흔에 예기치 않은 임신을 하게 되었을 때, 내 주변 사람들은 모두 들 너무나도 쉽게 나에게 임신중절을 권하였다.
More information13(이동운)p fm
Weed Turf. Sci. 2(2):202~206, 2013 DOI:dx.doi.org/10.5660/WTS.2013.2.2.202 Print ISSN 22877924, Online ISSN 22883312 Research Note Open Access Weed & Turfgrass Science The Korean Society of Weed Science
More informationDBPIA-NURIMEDIA
식물병연구 Res. Plant Dis. 17(2) : 184 190 (2011) http://dx.doi.org/10.5423/rpd.2011.17.2.184 보문 Open Access Research in Plant Disease The Korean Society of Plant Pathology 가지과종자에서 Ralstonia solanacearum 의검출을위한
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More information#Ȳ¿ë¼®
http://www.kbc.go.kr/ A B yk u δ = 2u k 1 = yk u = 0. 659 2nu k = 1 k k 1 n yk k Abstract Web Repertoire and Concentration Rate : Analysing Web Traffic Data Yong - Suk Hwang (Research
More information<31325FB1E8B0E6BCBA2E687770>
88 / 한국전산유체공학회지 제15권, 제1호, pp.88-94, 2010. 3 관내 유동 해석을 위한 웹기반 자바 프로그램 개발 김 경 성, 1 박 종 천 *2 DEVELOPMENT OF WEB-BASED JAVA PROGRAM FOR NUMERICAL ANALYSIS OF PIPE FLOW K.S. Kim 1 and J.C. Park *2 In general,
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information<31322D28C0CFB9DD29B7F9C8A3C1F85FBFCFB7E12E687770>
J Plant Biotechnol (2016) 43:99 103 DOI:http://dx.doi.org/10.5010/JPB.2016.43.1.99 ISSN 1229-2818 (Print) ISSN 2384-1397 (Online) Research Article BTH 처리한 배배양 인삼에서 주요 진균병 저항성 증진 효과 류호진 Enhancing resistance
More information<4D6963726F736F667420506F776572506F696E74202D20474D4F20C0CCBDB420B8AEC7C3B8B420BDC3B8AEC1EE36202D20474DB0A8C0DA>
GMO 이슈 리플릿 시리즈6 GM감자 CONTENTS 1. Executive Summary 2. 감자 3. GM감자 history 3 4 7 3. INNATE GM감자 17 Executive Summry 감자는 세계에서 네 번째로 중요한 작물로 전 세계적으로 널리 재배되고 있고, 다양하게 이용되고 있다. 이러한 특징으로 인해, 종자 기업에서는 옥수수와 콩과
More information특허청구의 범위 청구항 1 구제역이나 에이아이(AI) 감염에 의해 살 처분된 가축 매몰지의 붕괴나 침출수 유출에 의한 제2차 오염을 방 지하기 위한 방제방법에 있어서, 매몰지 내부에 고화제(Firming agent) 및 첨가물질이 주입되도록 통로를 형성하기 위한 천공단
(19) 대한민국특허청(KR) (12) 공개특허공보(A) (51) 국제특허분류(Int. Cl.) B09B 1/00 (2006.01) C09K 17/00 (2006.01) E02D 31/00 (2006.01) (21) 출원번호 10-2011-0016170 (22) 출원일자 2011년02월23일 심사청구일자 전체 청구항 수 : 총 9 항 2011년02월23일 (11)
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: * The
Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.243-268 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.243 * - 2001 2015 - The Research Trends on Peer Counseling in Elementary and
More informationhwp
제출문 농림부장관귀하 본보고서를 고항균활성키티나아제활성균주를이용한토마토잎곰팡이병제어용환경친화 적미생물제제개발 과제의최종보고서로제출합니다. 2007 년 05 월 21 일 주관연구기관명 : 동아대학교 총괄연구책임자 : 문병주 세부연구책임자 : 정순재 세부연구책임자 : 이영병 연 구 원 : 김현주 연 구 원 : 이광열 연 구 원 : 백정우 연 구 원 : 전옥주 연
More informationDBPIA-NURIMEDIA
김진주 김수연. 초등학생대상장애이해교육에활용된동화에나타난장애인관분석. 특수교육, 2013, 제12권, 제2호, 135-160... 20.,,. 4.,,.,..... 주제어 : 장애이해교육, 동화, 장애인관 1. ( 1 ) Incheon Munhak Elementary School ( )(, E-mail: sooyoun@ginue.ac.kr) Dept. of
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A S
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.461-487 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.461 * - 2008 2018 - A Study on the Change of Issues with Adolescent Problem
More information(2)-05(김용기).fm
Res. Plant Dis. 16(2) : 163-169 (2010) Research in Plant Disease The Korean Society of Plant Pathology t q Pantoea agglomerans 59-4» w ½»*Á«Á wáy Á x Á yáw Á 1 Á 1 Á 2 w», 1, 2 Elucidation of Mode of Action
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information보도자료 년 5 월 16 일 ( 목 ) 조간부터보도하여주시기바랍니다. 문의 : 에너지환경표준과최철우과장, 류지영연구사 ( ) 화장품에도국제표준이...? - 화장품도이젠표준선점으로세계시장선도를 - [ 붙임 1
보도자료 http://www.motie.go.kr 2013 년 5 월 16 일 ( 목 ) 조간부터보도하여주시기바랍니다. 문의 : 에너지환경표준과최철우과장, 류지영연구사 (509-7272) 화장품에도국제표준이...? - 화장품도이젠표준선점으로세계시장선도를 - [ 붙임 1 참조 ] [ 붙임 2 참조 ] [ 붙임 3, 4 참조 ] 이보도자료와관련하여보다자세한내용이나취재를원하시면산업통상자원부기술표준원에너지환경표준과류지영연구사
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:21~34 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/19, Published: 2016/12/30 [ABSTRACT] With the development of the Internet,
More information(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016) ISSN 228
(JBE Vol. 1, No. 1, January 016) (Regular Paper) 1 1, 016 1 (JBE Vol. 1, No. 1, January 016) http://dx.doi.org/10.5909/jbe.016.1.1.60 ISSN 87-9137 (Online) ISSN 16-7953 (Print) a), a) An Efficient Method
More information09구자용(489~500)
The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal
More information