大韓不妊學會誌 : 第 32 卷第 3 號 2005 Kor. J. Fertil. Steril., Vol. 32, No. 3, 2005, 9 체외배양중인생쥐난소에서초기난포조절인자의발현 차병원여성의학연구소 1, 포천중문의과대학교생명과학대학원 2 윤세진 1 김기령 2 정형민 1,2 윤태기 1 차광렬 1,2 이경아 1,2 mrna Expression of the Regulatory Factors for the Early Folliculogenesis in vitro Se-Jin Yoon 1, Ki-Ryeong Kim 2, Hyung-Min Chung 1,2, Tae-Ki Yoon 1, Kwang-Yul Cha 1,2, Kyung-Ah Lee 1,2 1 Infertility Medical Center, CHA General Hospital, 2 Graduate School of Life Science and Biotechnology, Pochon CHA University College of Medicine, Seoul, Korea Objective: To understand the crucial requirement for the normal early folliculogenesis, we evaluated molecular as well as physiological differences during in vitro ovarian culture. Among the important regulators for follicle development, anti-müllerian hormone (AMH) and FSH Receptor (FSHR) have been known to be expressed in the cuboidal granulosa cells. Meanwhile, it is known that c-kit is germ cell-specific and GDF-9 is also oocyte-specific regulator. To evaluate the functional requirement for the competence of normal follicular development, we investigated the differential mrna expression of several factors secreted from granulosa cells and oocytes between in vivo and in vitro developed ovaries. Materials and Methods: Ovaries from ICR neonates (the day of birth) were cultured for 4 days (for primordial to primary transition) or 8 days (for secondary follicle formation) in α-mem glutamax supplemented with 3 mg/ml BSA without serum or growth factors. The mrna levels of the several factors were investigated by quantitative real-time PCR analysis. Freshly isolated 0-, 4-, and 8-day-old ovaries were used as control. Results: The mrna of AMH and FSHR as granulosa cell factors was highly increased according to the ovarian development in both of 4- and 8-day-old control. However, the mrna expression was not induced in both of 4- and 8-day in vitro cultured ovaries. The mrna expression of GDF-9 known to regulate follicle growth as an oocyte factor was different between in vivo and in vitro developed ovaries. In addition, the transcript of GDF-9 was expressed in the primordial follicles of mouse ovaries. The mrna expression of c-kit was not significantly different during the early folliculogenesis in vitro. Conclusion: This is the first report regarding endogenous AMH and FSHR expression during the early folliculogenesis in vitro. In conclusion, it will be very valuable to evaluate cuboidal granulosa cell factors as functional marker(s) for normal early folliculogenesis in vitro. Key Words: Early folliculogenesis, Ovarian culture, AMH, FSH Receptor, GDF-9, c-kit 주관책임자 : 이경아, 우 ) 135-081 서울특별시강남구역삼 1 동 606-13, 포천중문의과대학교차병원여성의학연구소 Tel: (02) 3468-3441, Fax: (02) 563-2028, e-mail: leeka@ovary.co.kr * 본연구는한국과학재단목적기초연구 (R01-2003-000-10174-0) 지원으로수행되었음. - 207 -
포유류의난포발달과정 (folliculogenesis) 은여러가지호르몬과성장인자들이작용하여난자와과립세포 (granulosa cells), 그리고협막세포 (theca cells) 등의성장과분화를조절하는과정을말한다. 1 난포의성장개시는휴지상태에머물러있던원시난포가성장단계로들어가는것을의미하며이때에편평한 (flattened) 과립세포는입방형 (cuboidal) 으로형태가바뀌고유사분열을통해계속증식하고난자의성장도시작된다. 원시난포가발달하여일차난포가되고과립세포가증식하여두층의입방형과립세포를가지는이차난포로발달하는초기난포발달과정에는성선자극호르몬보다는난소내의성장인자와같은국소조절인자 (paracrine factor) 의작용이중요하다고알려져있다. 따라서초기난포의체외배양시에는적절한조절인자를첨가한배양조건이중요하며난자와과립세포가상호작용을활발히하여난자의성장과더불어과립세포가발달하고증식하게될때정상적인난포발달이일어나게된다. 초기의난포발달, 특히성장이억제된원시난포의성장에영향을주는것으로알려져있는인자로는 kit ligand (KL), 2 growth and differentiation factor-9 (GDF-9), 3 basic fibroblast growth factor (bfgf), 4 nerve growth factor (NGF), 5 leukemia inhibitory factor (LIF), 6 insulin, 7 bone morphogenic protein-7 (BMP-7) 8 등이있고반면에 anti-müllerian hormone (AMH) 9 는원시난포의성장을억제하는것으로알려져있다. 그러나이러한 AMH의생쥐난소에서원시난포의성장을억제한다는기능에반하여최근에인간난소조직을배양한연구에있어서는 AMH를처리함으로써원시난포의성장을촉진했다는상반된연구결과가보고되었다. 10 이외에도 KL의수용체인 c-kit 은난자에서발현하여난자성숙과협막세포의분화를조절하며난포발달에중요한역할을한다고알려져있다. 11 Follicle stimulating hormone (FSH) 의수용체인 FSH receptor (FSHR) 가결여되었을때 c-kit 단백질발현이억제되며난포의환경이바뀌게되고따라서, 난자와과립세포간의상호작용 (oocyte-granulosa interaction) 에문제가생긴다고알려져있다. 12 현재까지원시난포가왜성장이억제되는지또어떻게성장이활성화되는지에대한자세한기전 은아직까지알려져있지않다. 따라서본연구는난포의초기발달과정을이해하기위하여생식세포의대부분이원시난포로구성된출생직후의생쥐의난소를적정호르몬이나성장인자가첨가되지않은기본배양액에서체외배양하면서체내에서발달한난소에비해난포발달에중요한몇몇인자의유전자발현이어떠한양상을보이는지알아봄으로써정상적인초기난포발달을추측할수있는기능성마커를알아보고자수행하였다. 성장하는일차난포와이차난포의과립세포에서특이적으로발현하는 AMH와 FSHR를과립세포인자 (granulosa cell factor) 로서, 그리고난자에서분비되어초기난포발달을조절한다고알려져있는 GDF-9과 c-kit을난자조절인자 (oocyte factor) 로, 각인자의유전자발현을체내발달및체외배양된난소에서비교분석하였다. 연구대상및방법 1. 연구대상본실험에서는출생직후의 ICR 암컷생쥐에서얻은원시난포로만이루어진난소를체외배양에사용하였다. 일차난포로의발달이가장많이일어나고아직이차난포로발달하지않는단계로서태어난날로부터 4일자난소를사용하였고이차난포로의발달이가장활발한단계로서태어난날로부터 8일자난소를사용하여초기난포발달의대조군으로사용하였다. 2. 난소의체외배양태어난날의 ICR 암컷생쥐에서난소를적출하여 Leibovitz L-15 (Gibco) 배양액으로세척한후해부현미경하에서 29 gauge 주사기 (B-D) 를이용하여 bursa를제거하고순수한난소만을얻었다. 배양액은 α-mem glutamax (Gibco) 에 ITS (insulin, 6.25 µg/ ml; transferrin, 6.25 µg/ml; selenium, 6.25 ng/ml; Sigma), 3 mg/ml BSA (Sigma), 50 IU/ml penicillin G, 50 ng/ml streptomycin sulfate를첨가하여기본배양액으로사용하였다. Millicell-CM insert (Millipore) 를 24-well culture plate (Costar) 에넣고 insert 바깥부분에배양액을 400 µl를넣고각각의 membrane 위쪽에준비된난소를 5개씩올려서난소윗부분으로배양액이 - 208 -
얇은막을형성하도록하여 37, 5% CO 2 배양기에서배양하였다. 배양액은 2일에한번 200 µl씩교체하였다. 배양 4일째와 8일째에난소를 PBS로세척하여유전자발현분석을위해서는액체질소에급속냉동시켜사용전까지 -70 의저온냉동기에보관하였고, 조직학적관찰을위해서는 10% neutralbuffered formalin solution (NBF) 에고정하였다. 3. 조직학적관찰각시기별난소의발달과정을형태학적으로관찰하기위해서 paraffin block을제작하여 5 µm 두께로절편하였다. Xylene 처리과정을통해절편으로부터 paraffin을제거하고, 알코올처리과정을거쳐물로세척한후 hematoxylin-eosin으로염색하였다. 각다섯절편마다한개절편씩선택하여절편에있는핵이보이는난포만선택하여난자와난포의지름을재어서각각의평균값을구하였다. 이를통해체내에서발달한생후 4일과 8일자난소와체외에서발달한배양 4일과 8일자난소에서난포발달에차이가있는지분석하였다. 4. Total RNA 분리및정량적역전사중합효소연쇄반응 (Quantitative real-time RT-PCR) 각시기별난소조직을 TRIzol (Invitrogen) 을사용하여균질화시킨후 RNA를분리하였다. 동량의 RNA를사용하여 MMLV reverse transcriptase (Pro- mega) 와 oligo(dt) primer를사용하여역전사반응을수행하여 cdna를합성한후이들을대상으로난포발달에관여하는유전자들의발현양상을 MyiQ system (Bio-Rad) 을사용한 real-time PCR로정량적분석을하였다. 이용한 primer들의염기서열은 Table 1에정리하였다. 각각의 primer에대한 real-time PCR 조건을최적화하였고 internal control 유전자로서 GAPDH를사용하였다. 5. In situ hybridization 각단계별생쥐의난소 ( 출생직후, 생후 10일, 생후 4주령 ) 조직을 4% paraformaldehyde에서하루동안고정시킨후 paraffin block을제작하였으며, 5 µm 두께의연속절편을코팅처리된 ProbeOn 슬라이드 (Fisher) 에부착하였다. 실험에사용할 GDF-9 cdna probe는 Table 1에명시된 GDF-9 특이적인 primer로 PCR하여 446 bp의염기서열을얻은후 pgem-t vector (Promega) 에 subclone한후염기서열분석 (sequencing) 으로확인하였다. Subclone된 GDF-9 cdna는 Sac II 제한효소로절단하여 [ 35 S]- UTP (Amersham) 을이용하여 SP6 RNA polymerase (Promega) 로전사 (in vitro transcription) 시켜 antisense probe를얻었고 control로사용한 sense probe는 Not I 제한효소로절단하여 T7으로전사시켜서얻었다. 준비된조직슬라이드를 paraformaldehyde에고정시키고 antisense와 sense riboprobe로 60 에서 over- Table 1. Sequences of oligonucleotide primers and PCR conditions Genes Oligonucleotide Sequences AT ( ) Size (bp) AMH F 5'-GAGCTCTTGCTGAAGTTCCAAG-3' R 5'-CTGCTTGGTTGAAGGGTTAAGA-3' 60 244 FSHR F 5'- TCTTCACGGACTTTCTCTGC-3' R 5'- TCTTGTAAATCTGGGCTTGC -3' 58 234 GDF-9 F 5'-GGTTCTATCTGATAGGCGAGG-3' R 5'-GGGGCTGAAGGAGGGAGG-3' 60 446 c-kit F 5'- CTGCTTGGCGCATGCACGG-3' R 5'- CCGGCATCCCTGGGTAGGG-3' 60 655 GAPDH F 5'-ACCACAGTCCATGCCATCAC-3' R 5'-TCCACCACCCTGTTGCTGTA-3' 60 452 AT, annealing temperature; F, forward; R, reverse primer - 209 -
A B C D E F Figure 1. Histological sections of in vivo developed and in vitro cultured neonatal mouse ovaries. A, Section of the control ovary of a newborn ICR mouse on the day of birth (Day 0). Note that the only follicles present are primordial follicles. B and C, Sections of the in vivo developed ovaries from 4-day-old (B) and 8-day-old (C) mice; D, E and F, Sections of the in vitro cultured ovaries for 4-day (D and E) and 8-day (F). Note the presence of many growing oocytes in the medullary region of the ovary. The growing oocytes are enclosed within 1~2 layers of granulosa cells. The remaining primordial follicles are mostly located in the ovarian cortex. Scale bars indicate 50 µm. night hybridize 시켰다. 이후 post-hybridization 시키고세척한후 autoradiography X-ray film (Amersham) 으로 3일간감광시킨후 NTB-2 Emulsion (Kodak) 에담근후 4 에서 2주간감광시켰다. D-19 (Kodak) 로 develop한후 hematoxylin-eosin으로염색하고암시야 (dark field) 와명시야 (bright field) 에서관찰하였다. 6. 통계분석통계학적유의성검증은 one-way ANOVA 및 log linear model을이용하여수행하였으며 p 값이 0.05 보다작은경우를통계학적으로유의하다고판정하였다. 결과 1. 생쥐의발달단계와체외배양에따른난소의조직학적관찰출생직후의생쥐난소에서는대부분의생식세포들이원시난포의전형적인형태인한층의편평한 과립세포에의해난자가둘러싸여있으며일부원시난포는이미성장을시작하여다른원시난포에서보다난자의크기가커져있음을관찰할수있었으나대부분의원시난포들이성장을시작하지않은상태에머물러있음이관찰되었다 (Figure 1A). 생후 4일째의경우난소의피질 (cortex) 에수많은전형적인원시난포들이분포하며입방형의과립세포를가진일차난포들이난소의중앙부에위치하는것을볼수있으며아직이차난포는관찰되지않았다 (Figure 1B). 생후 8일째의난소에서는난소의중앙부에성장이활발한이차난포들이다수관찰되었으나아직까지 antrum을형성한난포는관찰되지않았다 (Figure 1C). 태어난날의생쥐난소를체외배양하였을때배양 4일째 (Figure 1D and E) 에서많은일차난포들이체내발달과마찬가지로난소중심에있는것이관찰되었고배양 8일째 (Figure 1F) 에도많은일차난포와이차난포들이발달하였음을관찰할수있었다. 그러나체내발달과체외발달의경우형태적으로다른점을관찰할수있었는데, 체외배양한경우에난포의크기가상당히커있음을알 - 210 -
Figure 2. Mean diameters (µm ± SEM) of healthy follicles and oocytes in the sections of in vivo developed and in vitro cultured ovaries. The diameter of primary (Pri) and secondary (Sec) follicles was determined in every fifth section of the follicles only those in which the nucleus of the oocyte was clearly visible. Separate culture was repeated three times and data were expressed as mean ± SEM. *, p<0.05. 게되었고특히난포안의난자의크기가체내에서발달한난소보다커져있고, 반면에그난자를둘러싸는과립세포는입방형으로잘발달하지못한두층이매우얇아진것을관찰할수있었다. 이렇게관찰된난포및난자의크기를측정한결과배양 4일째에관찰된일차난포의경우, 체내에서성숙된생후 4일째에서의일차난포에비해난자와난포의지름이모두유의적으로컸다. 배양 8일째에서는일차난포와이차난포모두, 난포자체의지름에는차이가없었지만과립세포의층이매우얇은데비해이들이둘러싸는난자의크기가비대하게커져있음이관찰되었다 (Figure 2). 2. 난포발달에관여하는여러유전자의발현양상난포발달에관여한다고알려진유전자중에특히입방형의과립세포에서높게발현하는유전자인 AMH와 FSH 수용체 (FSHR) 의발현양상을알아보고, 반면에난자특이적으로발현하여난포발달에영향을준다고잘알려져있는 GDF-9과생식세포특이적인 c-kit 유전자의발현양상을체내발달한난소와체외배양된난소에서차이가나는지알아보았다. 이들유전자에대한특이적인 primer (Table 1) 를제작하였고, 각시기별난소조직으로부터 RNA를분리하고역전사반응을통해얻어진동일한 cdna로각각의 annealing 온도에서 30회씩증 Figure 3. Expression of mouse AMH, FSHR, GDF-9, and c-kit mrna. RT-PCR products were separated by electrophoresis in 1.5% agarose gels. GAPDH was used as an internal control. Con, a newborn mouse ovary on the day of birth (Day 0); D4 and D8, in vivo or in vitro developed ovaries for 4 days (D4) or 8 days (D8). 폭시킨후이들을 1.5% agarose gel 상에서확인하였다 (Figure 3). 정량적인분석을위하여 real-time PCR을시행하여 GAPDH 유전자발현에대한상대적인발현양을보았는데, 세번의독립된배양실험과각배양실험당두번의정량분석을통해가장높게발현하는유전자의수치를 100% 로보았을때의평균수치를그래프로나타내었다 (Figure 4). 성장하는난포의입방형의과립세포에특이적으로발현하는 - 211 -
A B C D Figure 4. Relative expression levels of mouse AMH (A), FSHR (B), GDF-9 (C), and c-kit (D) mrna from in vivo developed (in vivo) and in vitro cultured (in vitro) ovaries by quantitative real-time PCR analysis. Newborn mouse ovary on the day of birth (Con) was cultured for 4 or 8 days. Experiment was repeated three times and the relative amount of each mrna was normalized to GAPDH mrna levels. Bars with different letters indicate that group means are significantly different at p<0.05. AMH와 FSHR는원시난포로만구성된태어난날의난소에서는거의발현하지않지만난소의발달 4일과 8일에그발현양이현저히높아짐을알수있고반면에체외에서배양한경우에유전자발현이체내발달처럼증가되지못하고현저히낮은수치에머물러있음을관찰하였다. 난자특이적인 GDF-9 유전자발현은원시난포로만이루어진출생직후의난소에서도발현하였고체내의난소발달에따라높게증가하였으나, 체외배양의경우에는체내에서발달한것보다낮은수치로발현하였다. 유전자 c-kit은원시난포에서가장높게존재하다가체내의난소발달단계가진행되면서그발현양이점차감소하였고체외배양에서도비슷하게발현하여유의적인차이는없었다. 3. 생쥐난소에서 GDF-9 의발현양상현재까지도 GDF-9 유전자의원시난포에서의발현여부에대해서는상반된주장이제시되고있으 며생쥐의경우원시난포에서는발현하지않으며일차난포이후의난자에서특이적으로발현한다고알려져있다. 13 그러나우리는앞의정량적분석을통한실험에서원시난포로만이루어진출생직후의난소에서 GDF-9 유전자가높게발현함을확인할수있었고이들이원시난포에서발현하는지를조직상에서다시한번확인하고자 in situ hybridization을시행하였다. 원시난포로만이루어진출생직후의생쥐난소는조직관찰에서와동일하게일차난포는관찰되지않았고대부분의생식세포들이한층의편평한과립세포에의해난자가둘러싸여있는데이중에서도이미성장을시작하여다른원시난포의난원세포보다크기가큰원시난포에서 GDF-9이발현하는것을관찰할수있었다 (Figure 5A and B). 생후 10일자의생쥐난소에서는성장하는일차난포와이차난포가많이존재하며이들의난자에서특이적으로발현하였고원시난포에서도발현하는것을확인하 - 212 -
A B C D E F G H I Figure 5. Localization of GDF-9 transcript by in situ hybridization. Sections of ovaries isolated from newborn (on the day of birth, A-C), postnatal 10-day (D-F), and postnatal 4-week (G-I) old mice were hybridized with either antisense (A, B, D, E, G, and H) or sense (C, F, and I) GDF-9 riboprobes. As seen in brightfield (A, D, and G) and darkfield (B, E, and H) images, GDF-9 hybridization signal was concentrated over oocyte (arrows, primordial; arrow head, primary follicles). Scale bars represent 100 µm (A-F) and 200 µm (G-I). 였다 (Figure 5D and E). 모든 단계의 난포가 다 존 난포가 성장이 활발한 생후 8일자에서 현저히 증가 재하며 특히 antrum이 형성된 난포가 많이 관찰되 했지만 기본 배양액에서 배양된 생쥐 난소에서는 는 생후 4주의 난소에서도 GDF-9의 난자 특이적 이들 유전자의 발현이 체내에서와는 달리 발현이 발현을 관찰하였다 (Figure 5G and H). 억제되는 것을 알 수 있었다. 성장하는 난자에서 특 이적으로 발달하는 GDF-9 역시 이와 같은 양상이 고 찰 었고 반면에, 생식세포 특이적 발현으로 원시난포의 난자에서 발현하고 있던 c-kit 유전자 발현은 유의 본 연구는 난포의 초기발달과정을 이해하고자 원 적 차이가 없었다. 시난포로만 구성되어 있는 출생 직후의 생쥐 난소 Anti-Müllerian hormone은 Müllerian inhibiting sub- 를 호르몬이나 성장인자가 첨가되지 않은 상태에서 stance (MIS)로도 불리는 transforming growth factor-β 체외배양하였을 때 난포발달에 영향을 주는 것으로 (TGF-β) family로서 난포발달에 중요한 역할을 한다 알려진 조절인자들의 유전자 발현을 체내에서 발달 고 알려져 있다.14 AMH가 결여된 생쥐에서 원시난 한 난소와 비교하였다. 성장하는 입방형의 과립세포 포의 초기성장개시가 억제되었고 이들에 FSH를 투 에서 특이적으로 발현하는 AMH와 FSHR의 경우에 여하였을 때 정상 생쥐보다 FSH에 민감하게 반응 는 일차난포로의 성장이 왕성한 생후 4일자와 이차 하여 많은 수의 난포들이 배란하는 단계에 이르렀 - 213 -
다. 15,16 이를통해 AMH는생쥐의원시난포가선택되거나 (primordial follicle selection), 또는성장하는난포 (growing follicle) 의 cyclic recruitment에관여함을알수있다. 이들그룹의생쥐를통한연구에서 AMH는원시난포의성장개시를억제하는 feekback signal로작용하였는데, 이처럼원시난포의 recruitment에있어서억제인자로작용하는것은아마도 AMH가원시난포의 pool의사용을효과적으로조절하는것으로보여지고, 따라서폐경기가일어나는시기를결정하는데관여할것으로보여진다. 17,18 최근, 인간난소의체외배양연구에서는 AMH를첨가하였을때원시난포의성장개시가촉진되었고, 성장하는작은난포 (small growing follicle) 의 survival factor로작용하는가능성이제시되었다. 10 Follicle stimulating hormone은정상적인난포발달에필수적인 endocrine signal로서과립세포에존재하는수용체 (FSH Receptor; FSHR) 에작용함으로써역할을하는데, FSHR가결여된암컷생쥐는 antrum 이형성되지않은초기난포에머물러있어서불임이된다고보고되었다. 19 FSHR 유전자가없음으로해서난자의구조와기능에문제가생기며, 난포의 intracellular communication 이파괴되는결과를보였다. 12 특히나이들난포에서보여지는특징은난자에서분비되는성장인자인 GDF-9이결여된생쥐난소에서관찰된난자와같은양상을보였다. 20 이는, 난자와과립세포간의상호작용의불균형이가져온결과로써, 이를통해 FSHR의결여와난자특이적인유전자의상관관계를규명하는일이요구된다. 본연구의체외배양된난포의특징을보면, 체내에서발달한난포에비해그크기가상당히커져있는데, 난자의크기는현저히증가하고이를둘러싸는과립세포는상대적으로증식과성장이많이저해되어있음을관찰하였다 (Figure 1 and 2). 이러한현상은 GDF-9이결여된생쥐의난포에서보여지는난자의과대성장 (overgrowth) 과동일한결과이다. 20 성장인자가없이체외에서배양된난포는난포발달에불균형을가져왔고, 난자에서발현하는초기난포발달에필수적인 GDF-9 유전자를체외발달개시시점인출생직후난소에서의발현양이상으로발현하지못하였다 (Figure 4C). 특이적인것은본연 구를통해 GDF-9 유전자가원시난포로만이루어진출생직후의생쥐난소에서높게발현함을 RT-PCR 로확인하였고, 이들이원시난포의난자에서발현함을조직학적으로확인하였다 (Figure 5). 지금까지난자특이적인 GDF-9 유전자가원시난포에서발현하는지의여부에대해많은상반된보고들이있다. In situ hybridization을통한조직학적연구결과를보면, 생쥐에있어서는원시난포에서는발현하지않고일차난포이상의난자에서발현되며소와양에서는원시난포에서발현한다고보고되었다. 21,22 인간의난소에서는원시난포에서는발현하지않고일차난포이상에서발현한다는연구와함께정상인의난소에있는원시난포에서는발현하나 PCOS (polycystic ovary syndrome) 환자의원시난포에서는발현하지않는다는상반된연구가보고되었다. 23,24 본연구결과로미루어보면생쥐의경우, 동일한원시난포의형태를가지고있지만성장을시작하지않은원시난포에서는발현하지않으나이미성장을시작하여난자의크기가커진원시난포의경우 GDF-9이발현하는것으로보여진다 (Figure 5). 본연구에사용된출생직후의난소에서는일차난포가존재하지않았지만이러한가능성을배제하기위하여출생전의임신 19일자의생쥐에서난소를얻어 GDF-9 발현을보았을때도출생직후의난소에서와비슷한발현양을보임을본연구진이보고한바있다. 25 GDF-9과는달리, 생식세포특이적인 c-kit 유전자발현은체내발달된난소와체외배양된난소에서그발현양에차이가없었다. 난자성숙과협막세포 (theca cells) 의분화를조절하며난자에서발현하는난포발달인자로알려져있는 c-kit은 FSHR가결여되었을때단백질발현이억제되었다고보고되었으나이들의 mrna 발현에대해서는연구되지않았다. 11,12 본연구의체외배양된초기난포발달에서 c-kit 유전자발현에차이가없었던것은아마도, 이미원시난포에서이들의유전자가발현하고있기때문에체외배양조건에서더많은양을만들필요성이없으며오히려이들의유전자발현양은난포가성숙함에따라줄어드는경향을보이기때문인것으로생각된다. 본연구는원시난포로만이루어진생쥐난소를 - 214 -
체외배양하면서일차난포와이차난포로의초기발달을조절하는여러유전자의발현양상을체내발달한난소와비교한최초의보고이다. 이를통해서, 여러난포발달유전자중에서도성장하는난포에서특이적으로발현하는 AMH와 FSHR와같은과립세포인자의발현양이체외배양시정상적인난포발달여부를대변해주는중요한지표가될수있음을보여주었다. FSHR의경우흰쥐의난소를배양하면서 nerve growth factor (NGF) 를첨가하였을때 FSHR 유전자발현을증가시켰다고보고된바있으나아직도초기난포발달의조절인자에대해서는연구가미흡하다. 26 결론적으로, 난소의체외배양동안 AMH와 FSHR 의발현을측정함으로써난소내난포의초기발달이정상적으로진행되고있는지의여부를간접적으로보여줄수있으며, AMH나 FSHR의유전자발현을정상적으로유도할수있는최적의배양조건을찾아내는일이중요한다음연구단계가될것이다. 본연구진은체외에서이들유전자의발현을촉진하여체내에서발달된난포와동일한수준으로분비할수있는배양방법을발달시킴으로써초기난포발달의조절기작을밝히는데기여할것으로기대한다. 참고문헌 1. Hirshfield AN. Development of follicles in the mammalian ovary. Int Rev Cytol 1991; 124: 43-101. 2. Parrott JA, Skinner MK. Kit-ligand/stem cell factor induces primordial follicle development and initiates folliculogenesis. Endocrinology 1999; 140: 4262-71. 3. Vitt UA, McGee EA, Hayashi M, Hsueh AJ. In vivo treatment with GDF-9 stimulates primordial and primary follicle progression and theca cell marker CYP17 in ovaries of immature rats. Endocrinology 2000; 141: 3814-20. 4. Nilsson E, Parrott JA, Skinner MK. Basic fibroblast growth factor induces primordial follicle development and initiates folliculogenesis. Mol Cell Endocrinol 2001; 175: 123-30. 5. Dissen GA, Romero C, Hirshfield AN, Ojeda SR. Nerve growth factor is required for early follicular development in the mammalian ovary. Endocrinology 2001; 142: 2078-86. 6. Nilsson EE, Kezele P, Skinner MK. Leukemia inhibitory factor (LIF) promotes the primordial to primary follicle transition in rat ovaries. Mol Cell Endocrinol 2002; 188: 65-73. 7. Kezele PR, Nilsson EE, Skinner MK. Insulin but not insulin-like growth factor-1 promotes the primordial to primary follicle transition. Mol Cell Endocrinol 2002; 192: 37-43. 8. Lee WS, Yoon SJ, Yoon TK, Cha KY, Lee SH, Shimasaki S, Lee S, Lee KA. Effects of bone morphogenetic protein-7 (BMP-7) on primordial follicular growth in the mouse ovary. Mol Reprod Dev 2004; 69: 159-63. 9. Durlinger AL, Gruijters MJ, Kramer P, Karels B, Ingraham HA, Nachtigal MW, Uilenbroek JT, Grootegoed JA, Themmen AP. Anti-Mullerian hormone inhibits initiation of primordial follicle growth in the mouse ovary. Endocrinology 2002; 143: 1076-84. 10. Schmidt KL, Kryger-Baggesen N, Byskov AG, Andersen CY. Anti-Mullerian hormone initiates growth of human primordial follicles in vitro. Mol Cell Endocrinol 2005; 234: 87-93. 11. Driancourt MA, Reynaud K, Cortvrindt R, Smitz J. Roles of KIT and KIT LIGAND in ovarian function. Rev Reprod 2000; 5: 143-52. 12. Yang Y, Balla A, Danilovich N, Sairam MR. Developmental and molecular aberrations associated with deterioration of oogenesis during complete or partial follicle-stimulating hormone receptor deficiency in mice. Biol Reprod 2003; 69: 1294-302. 13. McGrath SA, Esquela AF, Lee SJ. Oocyte-specific expression of growth/differentiation factor-9. Mol Endocrinol 1995; 9: 131-6. 14. Baarends WM, Uilenbroek JT, Kramer P, Hoogerbrugge JW, van Leeuwen EC, Themmen AP, Grootegoed JA. Anti-Mullerian hormone and anti-mullerian hormone type II receptor messenger ribonucleic acid expression in rat ovaries during postnatal - 215 -
development, the estrous cycle, and gonadotropininduced follicle growth. Endocrinology 1995; 136: 4951-62. 15. Durlinger AL, Kramer P, Karels B, de Jong FH, Uilenbroek JT, Grootegoed JA, Themmen AP. Control of primordial follicle recruitment by anti- Mullerian hormone in the mouse ovary. Endocrinology 1999; 140: 5789-96. 16. Durlinger AL, Gruijters MJ, Kramer P, Karels B, Kumar TR, Matzuk MM, Rose UM, de Jong FH, Uilenbroek JT, Grootegoed JA, Themmen AP. Anti- Mullerian hormone attenuates the effects of FSH on follicle development in the mouse ovary. Endocrinology 2001; 142: 4891-9. 17. Durlinger AL, Gruijters MJ, Kramer P, Karels B, Ingraham HA, Nachtigal MW, Uilenbroek JT, Grootegoed JA, Themmen AP. Anti-Mullerian hormone inhibits initiation of primordial follicle growth in the mouse ovary. Endocrinology 2002; 143: 1076-84. 18. Weenen C, Laven JS, Von Bergh AR, Cranfield M, Groome NP, Visser JA, Kramer P, Fauser BC, Themmen AP. Anti-Mullerian hormone expression pattern in the human ovary: potential implications for initial and cyclic follicle recruitment. Mol Hum Reprod 2004; 10: 77-83. 19. Dierich A, Sairam MR, Monaco L, Fimia GM, Gansmuller A, LeMeur M, Sassone-Corsi P. Impairing follicle-stimulating hormone (FSH) signaling in vivo: targeted disruption of the FSH receptor leads to aberrant gametogenesis and hormonal imbalance. Proc Natl Acad Sci USA 1998; 95: 13612-7. 20. Elvin JA, Yan C, Wang P, Nishimori K, Matzuk MM. Molecular characterization of the follicle defects in the growth differentiation factor 9-deficient ovary. Mol Endocrinol 1999; 13: 1018-34. 21. Dong J, Albertini DF, Nishimori K, Kumar TR, Lu N, Matzuk MM. Growth differentiation factor-9 is required during early ovarian folliculogenesis. Nature 1996; 383: 531-5. 22. Bodensteiner KJ, Clay CM, Moeller CL, Sawyer HR. Molecular cloning of the ovine Growth/Differentiation factor-9 gene and expression of growth/differentiation factor-9 in ovine and bovine ovaries. Biol Reprod 1999; 60: 381-6. 23. Aaltonen J, Laitinen MP, Vuojolainen K, Jaatinen R, Horelli-Kuitunen N, Seppa L, Louhio H, Tuuri T, Sjoberg J, Butzow R, Hovata O, Dale L, Ritvos O. Human growth differentiation factor 9 (GDF-9) and its novel homolog GDF-9B are expressed in oocytes during early folliculogenesis. J Clin Endocrinol Metab 1999; 84: 2744-50. 24. Teixeira Filho FL, Baracat EC, Lee TH, Suh CS, Matsui M, Chang RJ, Shimasaki S, Erickson GF. Aberrant expression of growth differentiation factor- 9 in oocytes of women with polycystic ovary syndrome. J Clin Endocrinol Metab 2002; 87: 1337-44. 25. Yoon SJ, Lee KA, Ko JJ, Cha KY. Expression of growth differentiation factor-9 in the mouse ovaries at different developmental stages. Dev Reprod 1999; 3: 95-100. 26. Romero C, Paredes A, Dissen GA, Ojeda SR. Nerve growth factor induces the expression of functional FSH receptors in newly formed follicles of the rat ovary. Endocrinology 2002; 143: 1485-94. - 216 -