식물병연구 Research Article Open Access Res. Plant Dis. 22(3): (2016) 콩황화모틀모자이크바이러스의신속검출을위한역전사등온증폭법 Rev

식물병연구 Research Article Open Access Res. Plant Dis. 22(3): 178-183 (2016) http://dx.doi.org/10.5423/rpd.2016.22.3.178 콩황화모틀모자이크바이러스의신속검출을위한역전사등온증폭법 Reverse Transcription Loop-Mediated Isothermal Amplification Assay for Rapid Detection of Soybean yellow mottle mosaic virus 배대현 1,2 ㆍ박충열 1 ㆍ김봉섭 1,2 ㆍ이영훈 2 ㆍ윤영남 2 ㆍ강항원 2 ㆍ오종희 1 ㆍ이수헌 1 * 1 경북대학교응용생명과학부, 2 농촌진흥청국립식량과학원남부작물부생산기술개발과 *Corresponding author Tel: +82-53-950-5763 Fax: +82-53-950-6758 E-mail: suheon@knu.ac.kr These authors contributed equally to this work. Dae Hyeon Bae 1,2, Chung Youl Park 1, Bong-Sub Kim 1,2, Yeong-Hoon Lee 2, Young-Nam Yoon 2, Hang Won Kang 2, Jonghee Oh 1, and Su-Heon Lee 1 * 1 School of Applied Biosciences, Kyungpook National University, Daegu 41566, Korea 2 Crop Production Technology Research Division, Department of Southern Area Crop Science, National Institute of Crop Science, Rural Development Administration, Miryang 50424, Korea Soybean yellow mottle mosaic virus (SYMMV) is a new emerging plant virus detected in soybean (Glycine max) in Korea. Reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for rapid detection of SYMMV has been developed. In this study, we have designed primers (SYMM-F3/ B3/FIP/BIP) specific to sequences from the coat protein gene of SYMMV genome. Sensitivity analysis showed that RT-LAMP was 10 to 100 times more sensitive than reverse transcription polymerase chain reaction (RT-PCR). The optimal reaction condition of RT-LAMP was determined at 65 o C for 50 minutes. The result indicates that RT-LAMP assay does not require special equipment and long time for SYMMV detection. Therefore, it can be an alternative detection method of RT-PCR in laboratory. Received June 1, 2016 Revised July 24, 2016 Accepted August 11, 2016 Keywords: Soybean, Soybean yellow mottle mosaic virus, Reverse transcription loop-mediated isothermal amplification 서론 콩 (Glycine max) 은식물성단백질공급원으로경제적으로 중요한작물중하나이다. 전세계적으로 46 종의바이러스 가콩에감염되는것으로보고되었으며 (Tolin 과 Lacy, 2004), 국내에서는 Soybean mosaic virus (SMV) 를포함하여현재까지 11 종이보고되어있다 (Lee 등, 2013, 2015; Lim 등, 2014; Shin 등, 2014). 이중에서, Kim (2006) 에의해서최초보고된콩황 화모틀모자이크바이러스 (Soybean yellow mottle mosaic virus, SYMMV) 는 Carmovirus 속, Tombusviridae 과에속하는바이러 Research in Plant Disease pissn 1598-2262, eissn 2233-9191 www.online-rpd.org 스이다. SYMMV의게놈은양성-극성외가닥 RNA (positive sense single stranded RNA) 바이러스로여섯개의열린해독틀 (open reading frame) 과비번역영역 (untranslated region) 으로구성되어있다 (Nam 등, 2009). SYMMV는콩, 돌콩 (Glycine soja), 새팥 (Vigna angularis var. nipponensis), 토끼풀 (Trifolium repens), 비수리 (Lespedeza cuneate) 등콩과식물에국한된자연기주범위를가지며, 돌콩에서종자전염을통한안정된생활사를취하는것으로알려져있다 (Lee와 Kim, 2013). 최근콩재배지의바이러스병발생조사결과에따르면 SYMMV는 SMV, Soybean yellow common mosaic virus (SYCMV) 와함께국내콩에서빈번하게발생하는주요바이러스병이며 (Cho 등, 2013; Lee 등, 2013), 2013년국내전국콩단위조사결과발병률이가장높은바이러스로확인되었다 (Seo 등, 2014). The Korean Society of Plant Pathology cc This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/ licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. 178

Research in Plant Disease Vol. 22 No. 3 179 염기서열을기반으로하는진단법이발달하게되면서등온증폭법 (loop-mediated isothermal amplification, LAMP) 이고안되었다 (Notomi 등, 2000). LAMP 방법은등온조건에서 6개의염기서열영역을인식하는 4개의프라이머와 strand displacement activity가높은 Bst 중합효소를사용하여간단하고빠르게목적염기서열을증폭시킨다. LAMP 방법을기반으로한역전사등온증폭법 (reverse transcription loopmediated isothermal amplification, RT-LAMP) 은 Japanese yam mosaic virus, Tomato chlorosis virus, Tomato yellow leaf curl virus, Wheat yellow mosaic virus 등으로야기된병의진단및바이러스의신속검출에도적용되고있다 (Fukuta 등, 2003a, 2003b; Zhang 등, 2011; Zhao 등, 2015). 본연구에서는신속하고정확하며비용효율이높은검출방법인 RT-LAMP 방법을이용하여콩에문제시되고있는 SYMMV의신속검출방법을제안하고자하였다. 재료및방법 SYMMV 감염주의수집및 RT-PCR 진단. 2014년, 대구광역시하빈면에위치한농촌진흥청국립식량과학원남부작물부대구시험지유전자원포에서모자이크, 얼룩, 황화, 퇴록등의전형적인바이러스증상을보이는콩잎을수집하였다. 수집한시료는 easy-spin RNA extraction kit (intron Biotechnology, Seongnam, Korea) 를이용하여제조사의실험방법에따라전체 RNA를추출하였으며, 이를국내콩에발생보고된바이러스 6종 (SMV, SYMMV, SYCMV, Peanut stunt virus [PSV], Bean common mosaic virus [BCMV], Peanut mottle virus [PeMoV]) 에대하여특이적프라이머를이용하여 reverse transcription polymerase chain reaction (RT-PCR) 진단을수행하였다 (Lee 등, 2013). RT-PCR 진단결과를토대로 SYMMV에단독으로감염된시료에한하여본연구의공시시료로사용하였다. RT-LAMP primer 제작. 종특이적프라이머선발을위해 National Center for Biotechnology Information GenBank 에등록되어있는 SYMMV의염기서열정보를수집하였다. 수집된염기서열정보는 DNAMAN software version 7.0 (Lynnon Corporation, Vandreuil, QB, Canada) 을이용하여비교분석한후외피단백질의염기서열정보를이용하여 LAMP 프라이머를설계하였다. 프라이머는 PrimerExplorer (http:// primerexplorer.jp/elamp4.0.0/index.html) 를사용하여제작하였다 (Table 1). RT-LAMP 재료및조성. RT-LAMP는 Loopamp RNA Amplification Kit (Eiken Chemical Co., Ltd., Tokyo, Japan) 를사용하여반응을수행하였다. Total RNA 2 μl와 50 pmol inner primer (FIP, BIP), 5 pmol outer primer (F3, B3), 1 μl Enzyme mix. (Bst DNA polymerase, AMV reverse transcriptase), 12.5 μl Reaction mix. (40 mμ Tris-HCl, 20 mμ KCl, 16 mμ MgSO 4, 20 mμ (NH 4 ) 2 SO 4, 0.2% Tween 20, 1.6 Μ betaine, 2.8 mm deoxynucleoside triphosphate), 5.5 μl distilled water를혼합하여최종 25 μl의반응액을조성하였다. 최적조건확립. 반응온도및반응시간의최적조건을확인하기위하여온도조건은 45 o C 69.5 o C, 시간조건은 10 60 분으로설정하여반응을진행하였다. 반응후에는 80 o C에서 5분간효소를비활성화시킨후반응을종료하였다. 반응산물의확인. 각반응이끝나고반응산물은 2% agarose gel상에서전기영동을실시한후, ethidium bromide (EtBr) 로염색하여확인하였다. 또한 SYBR Green I (Lonza, Rockland, ME, USA) 을적용하여튜브속색의변화또는발광유무통해반응여부를육안으로확인하였다. 색의변화는일반광, UV transilluminator (Sage Creation Science Co., Ltd., Beijing, China) 에서반응여부를확인하였다. Table 1. The sequences of primers used for RT-LAMP assay for Soybean yellow mottle mosaic virus (SYMMV) in this study Primer name Length (nucleotides) Genome position* Sequence (5-3 ) SYMM-F3 20 620 639 TGGTTGCAGCATATGGACAG SYMM-B3 18 799 816 ATTGCTGGATGTGGTGGC SYMM-FIP 42 640 659, 681 102 GAGCAGCTGGAGCGTGTATGAA-AAGCTTCAACAACCCCCTT SYMM-BIP 42 770 789, 720 741 AACTATGGTGCAACGACTCGGG-GTACGCAAGGTTGCGTAAG RT-LAMP, reverse transcription loop-mediated isothermal amplification. *Genome position according to the coat protein sequence of SYMMV (GeneBank accession No. FJ494882).

180 Research in Plant Disease Vol. 22 No. 3 Primer의특이성확인. 설계된프라이머의종특이성을확인하기위해서주요콩바이러스들에대한반응여부를확인하였다. 6종 (SYMMV, SMV, SYCMV, PSV, BCMV, PeMoV) 바이러스의양성대조구를이용하여특이성을검증하였으며, 실험에사용된네개의프라이머들 (FIP, BIP, F3, B3) 에대한반응특이성을확인하기위해서네개의프라이머에서하나혹은두개를제외하고반응을한후에기존의증폭산물과비교하였다. 민감도비교. RT-LAMP와 RT-PCR의민감도를비교하기위하여 RT-LAMP와 RT-PCR을동일한전체 RNA를주형으로 260 ng/μl에서 2.6 10 6 ng/μl까지단계적으로 10배씩희석하여반응을수행하였다. 기기에따른재현성확인. RT-LAMP가등온이유지되는모든기기에서반응할수있는지알아보기위해등온을유지할수있는기기인유전자증폭기 (BIOER, Hangzhou, China), 항온수조 (Daihan LabTech Co., Ltd., Namyangju, Korea), 발열블록 (FINEPCR Co., Ltd., Gunpo, Korea) 을이용하여재현성을확인하였다. 결과및고찰 RT-LAMP의최적반응온도조건을확인한결과 62.8 o C 이상에서반응이시작되는것을확인할수있었고, 69.5 o C에서는오히려반응이저해된것을확인하였다 (Fig. 1). 62.8 o C 69.5 o C 사이의온도조건만유지된다면기계적조건에관계없이 SYMMV에대한증폭이가능하였다. 최적온도조건을설정한후모든반응은 65 o C에서실시하였다. 최적반응시간조건을확인한결과, 반응이 30분이상되었을때처음으로반응이확인되었으며, 50분이상부터최적의반응을보였다 (Fig. 2). LAMP 방법은기존의 PCR 방법과유사하지만등온조건에서변성과정없이접합, 신장이가능하다 (Blomström 등, 2008; Nagamine 등, 2002). RNA 바이러스의실험을위해서는 RNA를 DNA로역전사하는과정을거쳐야하는데 RT-LAMP는일반적인 LAMP 방법과동일하게등온에서역전사과정과 LAMP 반응이동시에진행되기때문에 RT- PCR과비교했을때큰시간차이를보이는장점이있어 RNA 의증폭및검출에적용되고있다 (Fukuta 등, 2003a; Parida 등, 2004). 최적시간조건을설정한후모든반응은 50분으로실시하였다. Primer의특이성을확인한결과, SYMMV에서만양성반응이확인되었다 (Fig. 3). 또한네개의프라이머들에대한작동특이성을확인한결과모든프라이머가함께있어야만프라이머가작동하여반응이일어나는것이확인되었다 (Fig. 4). LAMP primer는 4개의프라이머가총 6부분의염기서열영역과반응하는데이는 PCR과비교하여도높은특이성을나타낼수있을것이라생각된다. RT-LAMP와 RT-PCR의민감도를비교한결과 RT-LAMP는 2.6 10 5 ng/μl까지 RT-PCR은 2.6 10 4 ng/μl까지밴드가형성되는것이확인되었다. RT-PCR 이주형이 2.6 10 4 ng/μl일때매우희미한밴드를형성한것으로보아 RT-LAMP가 RT-PCR M 1 2 3 4 5 6 7 8 9 M Fig. 1. Optimal reaction temperature of reverse transcriptionloop mediated isothermal amplification (RT-LAMP). RT-LAMP was performed under range of 45 o C to 69.5 o C. Lane M, 100 bp DNA ladder (Solgent, Daejeon, Korea); lanes 1 9 (45 o C, 48.5 o C, 49.8 o C, 51.9 o C, 54.8 o C, 58.5 o C, 62.8 o C, 66.6 o C, and 69.5 o C, respectively). Fig. 2. Optimal reaction time of reverse transcription-loop mediated isothermal amplification (RT-LAMP). RT-LAMP was performed under range of 10 to 60 minutes. Lane M, 100 bp DNA ladder; lanes 1 6 (10, 20, 30, 40, 50, and 60 minutes, respectively).

Research in Plant Disease Vol. 22 No. 3 181 보다 10 100배의민감도를가지고있는것으로확인되었다 (Fig. 5). RT-LAMP와 RT-PCR의민감도를비교했을때 RT-LAMP 를적용한바이러스검출법중대다수의바이러스병에대하여 RT-PCR 방법보다민감도가높았다 (Fukuta 등, 2003a; Zhang 등, 2011; Zhao 등, 2015). RT-LAMP는 RT-PCR과달리등온에서증폭이가능하고시간을단축할수있는장점을가지고있으며, 이와같은장점을이용하여농업현장에 RT-LAMP 방법을적용하기위해서는항온수조나발열블럭등의장비와같이이동성과휴대성 이간편한장비가필수적으로요구된다. RT-LAMP 방법의중 요한요소중의하나인등온조건을유지할수있는다양한 기기 ( 유전자증폭기, 항온수조, 발열블록 ) 를이용하여재현 성을확인한결과, 모든기기에서동일한 RT-LAMP 결과를확 인할수있었다 (Fig. 6). 또한, 반응후전기영동이아닌 SYBR A M 1 2 3 4 5 6 7 8 9 M B Fig. 3. Specific reaction of primers for target virus. Lane M, 100 bp DNA ladder; lane 1, Soybean yellow mottle mosaic virus; lane 2, Soybean mosaic virus; lane 3, Soybean yellow common mosaic virus; lane 4, Peanut stunt virus; lane 5, Bean common mosaic virus; lane 6, Peanut mottle virus. Fig. 5. Sensitivity comparison of reverse transcription-loop mediated isothermal amplification (RT-LAMP) and RT-PCR for detecting Soybean yellow mottle mosaic virus (SYMMV). (A) Sensitivity analysis of RT-LAMP for the detection of SYMMV by agarose gel electrophoresis. (B) Sensitivity analysis of RT-PCR for the detection of SYMMV by agarose gel electrophoresis. Lane M, 100 bp DNA ladder; lanes 1 9, 10-fold dilution of total RNA (2.6 10 2 to 2.6 10 6, respectively). Fig. 4. Reverse transcription-loop mediated isothermal amplification (RT-LAMP) primer set requirements for Soybean yellow mottle mosaic virus detection. Lane M, 100 bp DNA ladder; lane 1, negative control; lane 2, B+C+D; lane 3, A+C+D; lane 4, C+D; lane 5, A+B; lane 6, A+B+C+D. A, FIP; B, BIP; C, F3; D, B3. Fig. 6. PCR test of reverse transcription-loop mediated isothermal amplification (RT-LAMP) on various thermostatic equipments. Lane M, 100 bp DNA ladder; lanes 1 and 2, positive and negative control in thermocycler machine; lanes 3 and 4, positive and negative control in heating block; lanes 5 and 6, positive and negative control in water bath.

182 Research in Plant Disease Vol. 22 No. 3 A B C Fig. 7. Visual detection for reverse transcription-loop mediated isothermal amplification (RT-LAMP) product with fluorescent dye. (A) Positive (luminescence, left) and negative (matte, right) fluorescent detection under UV transilluminator. (B) Positive (luminescence, left) and negative (matte, right) fluorescent detection under ultraviolet light. (C) Positive (yellow, left) and negative (orange, right) naked-eye detection under daylight. green I을이용하여육안확인이가능한지알아보기위해서튜브속변색또는발광유무통하여반응여부를육안으로확인한결과일반광, 자외선모두에서양성및음성대조군의구분이가능하였다 (Fig. 7). 위의특징을이용한다면현장에서전기영동없이증폭산물의반응유무를육안으로간편하게확인가능할것으로생각된다. 식물바이러스진단을위하여개발된다양한방법중에서국내에서는효소결합면역흡착검사 (enzyme-linked immunosorbent assay, ELISA) 법과 RT-PCR 방법이주로이용되고있다. ELISA 방법의경우대량의시료를비교적저렴한비용으로신속하게진단이가능하지만검출민감도가낮고검사결과를판독하는과정에서오류발생에대한한계가있다 (Lee 등, 2010). RT-PCR 방법은검사대상의양적증가에따른진단비용과소요시간또한증가하고, 기술숙련자와고가의장비가필요하다는단점이있다 (Li와 Mock, 2005). 위와같은기존진단법들의단점을극복하기위해개발된 LAMP 방법은이미많은저널의논문을통하여보고되었으며, 신속성및정확성그리고비용적인부분에서효율이높은방법으로평가되고있다 (Mori와 Notomi, 2009; Parida 등, 2004). 본실험결과를바탕으로 RT-LAMP는 SYMMV에대한신속, 정확한진단에적용될수있을것이라생각된다. 요약 SYMMV는콩에서빈번하게발생하는바이러스이며, 이바이러스의발생률은계속해서증가하고있다. 본연구에서는콩에발생하는 SYMMV를신속하게검출하기위해서 RT- LAMP를적용하였다. RT-LAMP 방법은등온에서단시간에유전자증폭이가능하고, 전기영동없이도형광물질을이용해바이러스를검출할수있는이점이있다. 프라이머는 SYMMV coat protein gene 의염기서열을기반으로 4 개의프 라이머를설계하였다. 실험결과 SYMMV RT-LAMP 는 65 o C 에 서 50 분간증폭시켰을때최적의효율을보였다. 또한, RT- LAMP 와 RT-PCR 과의민감도를비교한결과 RT-LAMP 방법이 10 100 배정도더우수한민감도를가지는것으로밝혀졌 다. 본실험결과를토대로기존의진단법과비교하여높은 민감도와짧은소요시간에이점이있는 RT-LAMP 는 SYMMV 의현장및연구실에서의진단에적용될수있을것이라생 각된다. Conflicts of Interest No potential conflict of interest relevant to this article was reported. Acknowledgement This research was carried out with the support Research & Development Program (Project No. PJ01124902) of National Institute of Crop Science, RDA, Republic of Korea. References Blomström, A. L., Hakhverdyan, M., Reid, S. M., Dukes, J. P., King, D. P., Belák, S. and Berg, M. 2008. A one-step reverse transcriptase loop-mediated isothermal amplification assay for simple and rapid detection of swine vesicular disease virus. J. Virol. Methods 147: 188-193. Cho, S. H., Kim, J. K., Li, M., Seo, E. Y., Lim, S. M., Hong, S. M., Moon, J. S., Hammond, J. and Lim, H. S. 2013. Occurrence of three major soybean viruses, Soybean mosaic virus, Soybean yellow mottle mosaic virus and Soybean yellow common mosaic virus revealed

Research in Plant Disease Vol. 22 No. 3 183 by a nationwide survey of subsistence farming soybean fields. Res. Plant Dis. 19: 319-325. (In Korean) Fukuta, S., Iida, T., Mizukami, Y., Ishida, A., Ueda, J., Kanbe, M. and Ishimoto, Y. 2003a. Detection of Japanese yam mosaic virus by RT-LAMP. Arch. Virol. 148: 1713-1720. Fukuta, S., Kato, S., Yoshida, K., Mizukami, Y., Ishida, A., Ueda, J., Kanbe, M. and Ishimoto, Y. 2003b. Detection of Tomato yellow leaf curl virus by loop-mediated isothermal amplification reaction. J. Virol. Methods 112: 35-40. Kim, S. M. 2006. Identification of legume-infecting viruses in Korea and characterization of Soybean yellow mottle mosaic virus. Ph.D. thesis. Kyungpook National University, Daegu, Korea. Lee, H. I., Kim, J. H. and Yea, M. C. 2010. Immunocapture RT-PCR for detection of seed-borne viruses on cucurbitaceae crops. Res. Plant Dis. 16: 121-124. (In Korean) Lee, S. H. and Kim, C. S. 2013. Natural hosts and disease cycle of Soybean yellow mottle mosaic virus. Res. Plant Dis. 19: 281-287. (In Korean) Lee, Y. H., Lim, S. T., Yoon, Y. N., Jeon, M. G., Yun, H. T., Ko, J. M., Lee, S. H., Lee, K. W. and Baek, I. Y. 2013. Incidence of soybean viral diseases in Korea. Korea Soybean Digest. 29: 7-15. (In Korean) Lee, Y. H., Yoon, Y. N., Yun, H. T., Baek, I. Y., Lim, S., Moon, J. S. and Lee, S. H. 2015. First report of Bean common mosaic virus infecting soybean in South Korea. Plant Dis. 99: 1189. Li, R. and Mock, R. 2005. An imporved reverse transcription-polymerase chain reaction (RT-PCR) assay for the detection of two cherry flexiviruses in Prunus spp. J. Virol. Methods 129: 162-169. Lim, S., Lee, Y. H., Igori, D., Zhao, F., Yoo, R. H., Lee, S. H., Baek, I. Y. and Moon, J. S. 2014. First report of Peanut mottle virus infecting soybean in South Korea. Plant Dis. 98: 1285. Mori, Y. and Notomi, T. 2009. Loop-mediated isothermal amplification (LAMP): a rapid, accurate, and cost-effective diagnostic method for infectious disease. J. Infect. Chemother. 15: 62-69. Nagamine, K., Hase, T. and Notomi, T. 2002. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol. Cell. Probes 16: 223-229. Nam, M., Kim, S. M., Domier, L. L., Koh, S., Moon, J. K., Choi, H. S., Kim, H. G., Moon, J. S. and Lee, S. H. 2009. Nucleotide sequence and genomic organization of a newly identified member of the genus Carmovirus, Soybean yellow mottle mosaic virus, from soybean. Arch. Virol. 154: 1679-1684. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N. and Hase, T. 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28: e63. Parida, M., Posadas, G., Inoue, S., Hasebe, F. and Morita, K. 2004. Real-time reverse transcription loop-mediated isothermal amplification for rapid detection of West Nile virus. J. Clin. Microbiol. 42: 257-263. Seo, J. K., Park, J. Y., Kwak, H. R., Kim, M. K., Nam, M., Lee, S. H., Kim, J. S. and Choi, H. S. 2014. Severe outbreak of the emerging soybean viruses in Korea: an increasing threat. Plant Health Prog. 15: 122-123. Shin, J. C., Kim, M. K., Kwak, H. R., Choi, H. S., Kim, J. S., Park, C. Y., Lee, S. H. and Cha, B. J. 2014. First report of Clover yellow vein virus on Glycine max in Korea. Plant Dis. 98: 1283. Tolin, S. A. and Lacy, G. H. 2004. Viral, bacterial, and phytoplasmal diseases of soybean. In: Soybean: Improvement, Production, and Uses. 3rd ed, eds. by H. R. Boerma and J. E. Specht, pp. 765-819. American Society of Agronomy, Crop Science Society of America, Soil Science Society of America, Madison, WI, USA. Zhang, Z. Y., Liu, X. J., Li, D. W., Yu, J. L. and Han, C. G. 2011. Rapid detection of Wheat yellow mosaic virus by reverse transcription loop-mediated isothermal amplification. Virol. J. 8: 550. Zhao, L. M., Li, G., Gao, Y., Zhu, Y. R., Liu, J. and Zhu, X. P. 2015. Reverse transcription loop-mediated isothermal amplification assay for detecting Tomato chlorosis virus. J. Virol. Methods 213: 93-97.