Microsoft Word - 05-황수명.doc

Journal of Bacteriology and Virology 2013. Vol. 43, No. 2 p.111 119 http://dx.doi.org/10.4167/jbv.2013.43.2.111 Original Article Molecular Typing of Cryptococcus neoformans Isolated from Korean Patients So Hae Park 1, Sung-il Cho 1 and Soo Myung Hwang 2 * 1 Department of Public Health, The Graduate School of Public Health, Seoul National University, Seoul; 2 Department of Clinical Laboratory Science, Catholic University of Pusan, Busan, Korea Cyptococcosis is generally caused by Cryptococcus neoformans, the opportunistic agent which has two species such as C. neoformans and C. gattii. Both C. neoformans and C. gattii species contain a number of genetically diverse subgroups that can be differentiated by various molecular typing methods. We conducted a molecular epidemiological analysis of 30 clinical isolates of the C. neoformans from cryptococcosis patients who had been hospitalized between 2008 and 2010 in medical centers located in Seoul and Busan in Korea. To determine the genetic diversity, 30 strains of C. neoformans were typed using PCR fingerprinting with the microsatellite specific primer of the phage M13 and the restriction fragment length polymorphism (RFLP) of orotidine monophosphosphate pyrophosphorylase (URA5) gene. All isolates were identified as serotype A, mating type MATa and molecular type VNI. The random amplified polymorphic DNA (RAPD) profiles obtained by using two primers revealed a single pattern. Our study shows that 30 strains of clinical C. neoformans are genetically homogeneous, with all of the isolates were molecular type VN1, serotype A, mating type MATa. Key Words: Cryptococcus neoformans, Molecular type, PCR-fingerprinting, URA5-RFLP, RAPD 서론 Cryptococcus neoformans는협막을보유한효모양진균으로사람과동물의폐, 중추신경계및전신에감염을일으키며면역기능저하환자에흔히감염되지만선행질환이없는환자에서도감염될수있다. 장기이식, 항암치료, 후천성면역결핍증 (acquired immunodeficiency syndrome, AIDS) 등으로인하여면역기능저하환자가증가하면서 Cryptococcus에의한기회감염발생이증가되고있다 (1, 2). Cryptococcosis의주요원인균인 Cryptococcus species는 C. neoformans와 C. gattii 2종으로분류되며. 이들균종의다당체협막성분의항원성과생태학적특성차이에 의하여 C. neoformans는변종 var. grubii( 혈청형 A) 와 var. neoformans( 혈청형 D) 그리고 hybrid형 AD, C. gattii는혈청형 B와 C형으로나누어진다 (3, 4). 또한분자유전학적특성에의하여 C. neoformans는 VNI-VNIV형, C. gattii 는 VGI-VGIV형의각각 4종류의유전자형으로분류된다 (4, 5). C. neoformans var. grubii 혈청형 A에는유전자형 VNI 또는 VNII이존재하며, 이중에서 VNI 유전자형은전세계적으로널리분포되어있으며특히비둘기배설물을비롯하여조류분변에오염된토양그리고썩은나무등이이균종의자연서식처로잘알려져있다 (6). 이에비교하여 C. gattii 혈청형 B 또는 C형은오세아니아지역을중심으로열대와아열대지역에서만제한적으로분리되며자연서식처는오스트레일리아원산 Eucalyptus 나무로알려져있으며 (7), 일부열대지역을제외하고 Received: May 2, 2013/ Revised: May 17, 2013/ Accepted: May 21, 2013 * Corresponding author: Soo Myung Hwang. Department of Clinical Laboratory Science, College of Health Sciences, Catholic University of Pusan, Busan 609-757, Korea. Phone: +82-51-510-0740, Fax: +82-51-510-0749, e-mail: smhwang@cup.ac.kr CC This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/license/by-nc/3.0/). 111

112 SH Park, et al. AIDS 환자에서 C. gattii에의한감염증은거의없는것으로보고되었다 (8, 9). 그러나최근연구보고에의하면기후에따른제한적분리균종인 C. gattii가온대지역인캐나다밴쿠버, 북아메리카및일부아시아지역에서분리되고있으며, 지역에따른유전자형의특성이보고됨으로써역학적연구가활발히진행되고있다 (10~12). Cryptococcus의인체감염은자연환경에서 basidiospore를흡입함으로써감염되는것으로알려져있으나생태학적, 역학적관련성은여전히의문으로남아있다 (1). C. neoformans는 heterothallic basidiomycetes로두종류의 mating type이존재하며 mating type 관련유전자좌위에기능이다른대립형질 alpha (MATa) 와 a (MATa) 에의하여조절된다. 일반적으로환경이나임상검체에서분리되는 C. neoformans의 mating type은대부분이 MATa 이며, 드물게 MATa/a인 diploid 균주도분리된다 (13, 14). C. neoformans 균종에관한분자역학적인연구방법으로는 M13 phage의 microsatellite 특이염기서열 (M13 primer) 과, (GACA) 4 또는 (GTG) 5 반복서열을이용한 PCR fingerprint 분석법, orotidine monophosphosphate pyrophosphorylase (URA5) 유전자의 restriction fragment length polymorphism (RFLP) 분석법, random amplified polymorphic DNA (RAPD) 분석법, amplified fragment length polymorphisms (AFLP), rdna intergenic space regions (IGS) I과 II 분석, multi-locus sequence typing (MLST) 등이이용되고있으며, 이들분석법에의하여 8종류의유전자형이알려져있다 (4, 5, 15). 우리나라에서는 Cryptococcus 균종의분리율이저조하며, 2008년이후이균종에관한분자역학적연구가없는실정이다. 본연구에서는 2008년에서 2010년사이에서울과부산지역의종합병원임상검체에서분리된 C. neoformans 균주를사용하여혈청형, mating type, M13 primer PCRfingerprinting, URA5-RFLP 그리고 2종류의 random primer 를이용한 RAPD법에의한분자생물학적특성을분석하여우리나라에서분리되는 C. neoformans 균주와다른나라에서의분리된균주와비교할수있는분자역학적기초자료를얻고자실시하게되었다. 재료및방법실험균주서울및부산지역종합병원 2곳에서 2008년에서 2010 년사이분리된임상균주총 30주를사용하였다 (Table 1). 여러종류의임상가검물에서분리된 30균주는각병원미생물검사실에서 C. neoformans로동정된균주로써, Sabouraud dextrose agar (SDA, BBL, Sparks, MD, USA) 로옮긴다음다시재배양한후에사용하였다. C. neoformans의재동정을위하여 API 20C AUX system (biomerieux, Marcy-l'Etoile, France) 을이용한당동화시험과 Christensen's urea broth (Difco, Detroit, MI, USA) 를이용한 urease 시험양성인지를확인하였고, 멜라닌색소생성에의한갈색집락을확인하기위하여 Staib's bird seed media (BSM) 을제조하여사용하였다 (16). 실험에사용된 C. neoformans 표준균주는 CBS 10085 (C. neoformans serotype A, VNI형 ), CBS 10084 (C. neoformans serotype A, VNII 형 ), CBS10080 (C. neoformans serotype AD, VNIII형 ), CBS 10079 (C. neoformans serotype D, VNIV형 ), 4종류를사용하였다. 혈청형과변종확인시험 C. neoformans 변종의확인은협막다당체성분의항혈청을이용한혈청형분석과생화학적반응시험을실시하여결정하였다. 혈청형분석은 C. neoformans 협막의다당체항원에대한항혈청을이용한 slide agglutination test (Crypto Check Iatron RM 304-K kit; Iatron Laboratories, Tokyo, Japan) 를실시하였다. 변종확인생화학적검사는 Kwon-Chung법 (17) 에따라 canavanine-glycine bromthymol blue (CGB) 를제조하여사용하였다. CGB 배지에함유된 glycine을탄소원으로이용할수있는 glycine decarboxylase 의생성유무를관찰하는것으로, 최종동정된균주들을 CGB 배지에접종하고 30 에서 24~48시간배양한다음, CGB 배지의색깔이원래배지의색깔인녹황색에서청색으로색깔변화를보이면양성, 색깔변화가없거나균이자라지않으면음성으로판정하였으며, glycine decarboxylase 생성균주인 C. gattii는양성반응, 이효소를생성하지않는 C. neoformans var. grubii 또는 var. neoformans는음성반응으로변종을확인하였다. 균체 DNA 분리 C. neoformans 균체 DNA 분리는 Yamamoto (18) 방법을응용하여실시하였다. Brain Heart Infusion broth (BHI, BBL TM ) 에서각실험균주를 30, 48시간배양한후원심분리하여약 100 μl pellet를수집하여 100 mm Tris-HCl

Molecular Typing of Clinical C. neoforomans Isolates in Korea 113 Table 1. Characteristics of C. neoformans isolates used in this study No. Strain Gender Age Source Serotype Mating type Molecular type Year Location 1 sh98 M 58 Blood A α VNI 2008 Seoul 2 sh99 F 75 Bronchial fluid A α VNI 2008 Seoul 3 sh100 M 73 CSF a A α VNI 2008 Seoul 4 sh107 M 48 Tissue A α VNI 2008 Seoul 5 sh108 M 62 Abdominal fluid A α VNI 2008 Seoul 6 sh109 M 35 CSF A α VNI 2009 Seoul 7 sh110 M 77 Pleural fluid A α VNI 2009 Seoul 8 sh111 F 70 Bronchial fluid A α VNI 2009 Seoul 9 sh112 M 80 CSF A α VNI 2009 Seoul 10 sh113 F 27 Blood A α VNI 2009 Seoul 11 sh114 F 70 Blood A α VNI 2009 Seoul 12 sh115 F 68 Abdominal fluid A α VNI 2009 Seoul 13 sh116 F 51 Tissue A α VNI 2009 Seoul 14 sh117 M 57 Blood A α VNI 2009 Seoul 15 sh119 F 60 Urine A α VNI 2009 Seoul 16 sh120 F 68 Blood A α VNI 2009 Seoul 17 sh121 F 67 Bronchial fluid A α VNI 2010 Seoul 18 sh122 F 65 Blood A α VNI 2010 Seoul 19 sh123 F 63 Tissue A α VNI 2010 Seoul 20 sh124 F 61 Sputum A α VNI 2010 Seoul 21 sh126 M 49 Blood A α VNI 2010 Seoul 22 sh127 M 66 Blood A α VNI 2010 Seoul 23 sh128 F 54 Ascitic fluid A α VNI 2010 Seoul 24 sh79 F 74 CSF A α VNI 2008 Seoul 25 sh102 F 68 Blood A α VNI 2009 Seoul 26 sh103 M 70 CSF A α VNI 2009 Seoul 27 sh104 M 78 Sputum A α VNI 2009 Busan 28 sh105 F 54 Blood A α VNI 2009 Busan 29 sh106 F 77 Blood A α VNI 2009 Busan 30 sh118 M 55 Ascitic fluid A α VNI 2009 Busan a CSF, cerebrospinal fluid buffer (TE ph 8.0, 1 mm EDTA) 로두번세척하였다. 각검체에 250 μl 100 mm TE (ph 9.0, 40 mm EDTA), 50 μl 10% sodium dodecyl sulfate 와 200 μl benzyl chloride를가하여혼합한후 50 에서 30분동안가볍게진탕하면서방치한다음 1,0000 rpm에서 10분간원심분리한후상층액 을분리하였다. 상층액에 3 M sodium acetate 50 μl를가한후 0 에서 10분간방치한후 250 μl isopropanol를가하여 -70 냉동실에서 1시간방치하여 DNA 침전물을얻었다. 침전된 DNA를 70% ethanol로세척하여건조한후 40 μl 10 mm TE (ph 8.0) 로용해하여사용하였다.

114 SH Park, et al. Mating type 분석 Mating type 분석은 Chaturvedi법 (14) 에따라 C. neoformans 혈청형 A의 mating type alpha (a) 와 a형의특이 primer (Table 2) 을이용하여 PCR을실시하였다. PCR 반응혼합액은 AccuPower PCR premix kit (Bioneer Co. Daejeon, Korea) 를사용하여, DNA 시료 (75 ng) 1 μl, MATa primer (10 pmol) 를각각 1 μl 넣고증류수로최종부피 20 μl를맞추었다. PCR 반응조건은 95 에서 3분간초기반응, 94 1분, 57.5 1분, 72 1분의과정으로 30회반복하였고, 마지막으로 72 에서 7분연장으로 PCR을종결하였다. 또한 MATa primer를사용하여동일한조건으로 PCR 반응을실시하였다. 증폭된 DNA 시료는 2% agarose gel을통하여전기영동을실시하였고, 증폭산물의크기에따라 mating type, MATa (101 bp) 또는 MATa (117 bp) 형을확인하였다. Molecular type 분석 Molecular type 분석은 M13 primer를이용한 PCR fingerprint법과 URA5 유전자-RFLP 분석법으로실시하였다. M13 phage의 microsatellite 특이염기서열의 primer을이용한 PCR fingerprint 분석은 Meyer 등 (15) 의방법을응용하여다음과같이실시하였다. PCR 반응혼합액은 AccuPower PCR premix kit (Bioneer Co.) 를사용하여, DNA 시료 (25 ng) 1 μl, M13 primer (Table 2) 10 pmol를 1 μl 넣고, 증류수로최종부피 20 μl를맞추었다. PCR 반응조건은 94 에서 5분간초기반응, 93 20초, 50 1분, 72 20초의과정으로 40회반복하였고, 마지막으로 72 에서 5분 연장으로 PCR을종결하였다. 증폭된 DNA 시료는 1.5% agarose gel에서전기영동을실시하여, 증폭산물의크기를표준균주의결과와비교확인하였다. URA5 유전자-RFLP 분석은 URA5 유전자의특이 primer (Table 2) 를사용하여실시하였다 (5). PCR 반응혼합액은 AccuPower PCR premix kit (Bioneer Co.) 를사용하여, DNA 시료 (75 ng) 1 μl, 두종류의 primer (10 pmol) 를각각 1 μl 씩넣고증류수로최종부피 20 μl를맞추었다. PCR 반응조건은 94 에서 4분간초기반응, 94 45초, 61 1분, 72 2분의과정으로 35회반복하였고, 마지막으로 72 에서 10분연장으로 PCR을종결하였다. URA5 유전자 PCR 산물을 1.5% agarose gel 상에서확인한후 gene clean kit (Bioneer Co.) 를사용하여증폭된 600 bp DNA을분리하였다. RFLP 분석은 600 bp DNA PCR 산물에 2종류의제한효소 Sau 96I과 Hha I (BioLabs, Ipswich, MA, USA) 를각각첨가하여 37 에서 6시간반응시킨후 2.5% agarose gel에서전기영동을실시하여, DNA 밴드유형을표준균주의결과와비교확인하였다. RAPD 분석 RAPD 분석은 2종의 random primer, OPH-02 와 OPH-12 (Table 2) 를사용하여실시하였다 (19). PCR 반응혼합액은 AccuPower PCR premix kit (Bioneer Co.) 를사용하여, DNA 시료 (75 ng) 1 μl, 한종류의 primer (10 pmol) 를 1 μl 넣고증류수로최종부피 20 μl를맞추었다. PCR 반응조건은 94 에서 4분간초기반응, 92 30초, 34 1분, 72 1분의과정으로 35회반복하였고, 마지막으로 72 에서 5분연장으로 PCR을종결하였다. 증폭된 DNA 시료는 Table 2. List of primers used in this study Primer Nucleotide sequence (5'-3') Reference M13 GAGGGTGGCGGTTCT (15) MATa F CTTCACTGCCATCTTCACCA (14) MATa R GACACAAAGGGTCATGGCCA (14) MATa F CGCCTTCACTGCTACCTTCT (14) MATa R CGCCTTCACTGCTACCTTCT (14) URA5 F ATGTCCTCCCAAGCCCTC GACTCCG (5) URA5 R TTAAGACCTCTGAACACCGTACTC (5) OPH-02 TCGGACGTGA (19) OPH-12 ACGCGCATGT (19)

Molecular Typing of Clinical C. neoforomans Isolates in Korea 115 Figure 1. PCR-fingerprint profiles amplified with the primer M13. Lane #1~#4, C. neoformans molecular type reference strains VNI, VNII, VNIII, and VNIV; Lane #5~#16, selected clinical strains (sh98, sh99, sh100, sh107, sh108, sh109, sh110, sh111, sh104, sh105, sh106, and sh118); M, molecular marker (100 bp DNA ladder). Figure 2. URA5-RFLP profiles identified after double digestion with the restriction enzymes HhaI and Sau 96I. Lane #1~#4, C. neoformans molecular type reference strains VNI, VNII, VNIII, and VNIV; Lane #5~#16, selected clinical strains (sh98, sh99, sh100, sh107, sh108, sh109, sh110, sh111, sh104, sh105, sh106, and sh118); M, molecular marker (100 bp DNA ladder). 2% agarose gel에서전기영동을실시하여, 증폭산물의크기를비교확인하였다. 결과 Cryptococcus neoformans 혈청형및 Mating type 확인서울및부산지역 2곳의종합병원에서 2008년에서 2010년동안여러종류의가검물에서분리동정된 C. neoformans 30균주의생화학적성상을재확인한결과, 30 주모두 C. neoformans임을확인하였다. 협막다당체항원성분의혈청형 (serotype) 분석결과에서는모두혈청형 A이었으며, 변종확인생화학적검사결과에서 CGB 배지에서음성을나타냄으로써임상균주 C. neoformans는모두 C. neoformans var. grubii( 혈청형 A) 로확인되었으며 C. gattii 균주는검출되지않았다. C. neoformans 30주의 mating type을 MATa와 MATa 두종류의특이적 primer를이용하여 PCR법을실시한결과모두 101 bp가검출되어 MATa 임을확인하였다. Molecular type M13 primer에의한 PCR fingerprinting의결과는 Fig. 1 과같다. C. neoformans 4종류의유전자형표준균주 (VNI, VNII, VNIII 및 VNIV) 를이용하여임상균주 30주와의결과를분석한결과, 임상균주 30주모두는표준균주 VNI 형과동일한패턴을나타냄으로써 VNI 유전자형임을확인하였다. 또한 URA5 유전자를증폭하여 Sau 96I과 Hha I 제한효소을이용하여 RFLP 분석한결과 (Fig. 2) 에서 30 주모두표준균주 VNI형과동일한밴드를나타냄으로써 C. neoformans var. grubii VNI 유전자형임을확인하였다.

116 SH Park, et al. RAPD 분석 Random primer 2종류, OPH-02와 OPH-12를이용하여 RAPD 분석결과는 Fig. 3과같다. Primer OPH-02를이용한 RAPD profile을분석결과 (Fig. 3A), 임상균주간의동일한패턴으로각균주의차이가없었으며, primer OPH- 12를이용한결과에서도 (Fig. 3B) 균주간에동일한패턴의결과를나타내었다. RAPD 결과에서임상균주는모두동일한패턴을나타냄으로써, 실험에사용된 C. neoformans는 VNI 유전자형으로 subtype도동일한것임을확인하였다. 고찰 Cryptococcosis는 AIDS 환자를비롯하여면역기능이현저히떨어진사람에게기회감염을일으키는것으로잘알려져있다 (1, 2). 최근에 C. neoformans 균종의분류는 C. neoformans와 C. gattii으로나누어지며, 이들균종의 유전적다양성으로 C. neoformans에는 VNI-VNIV형, C. gattii에는 VGI-VGIV형의각각 4종류의유전자형이존재한다 (20). 전세계적으로 C. neoformans, VNI 유전자형, 혈청형 A 균종이면역기능저하환자에서주로질병을유발하는것으로잘알려져있다 (21). Meyer 등 (22) 은 C. neoformans에의한감염증은면역기능저하환자에서 78.3%, 면역기능정상의환자에서 21.7% 로발병되는것으로보고하였고, C. neoformans 감염증중에서 C. neoformans VNI형, 혈청형 A 균주가면역기능저하환자의 83.9% 에서발병되는것으로보고하였다. C. neoformans와이들변종들로인해야기되는임상질환과지역적인분포사이에는유의한상관관계가있는것으로보고되고있으며, 전세계적으로많은연구가진행되고있다 (10, 21). AIDS 환자에서 Cryptococcus 감염의윈인균은주로 C. neoformans var. grubii, 혈청형 A으로알려져있으나, 브라질에서는 C. neoformans var. grubii와 C. gattii 모두윈인균으로보고되었다 (23). 우리나라에서는 Hwang 등 (24) 은 1993년에서 2005년사이분리된임상균주 51주와환경균주 7주의혈 A B Figure 3. RAPD profiles amplified with the primer OPH-02 (A) and OPH-12 (B). Lane #1, C. neoformans molecular type reference strains VNI; Lane #2~#16, selected clinical strains (sh98, sh99, sh100, sh107, sh108, sh109, sh110, sh111, sh112, sh114, sh115, sh104, sh105, sh106, and sh118); M, molecular marker (100 bp DNA ladder).

Molecular Typing of Clinical C. neoforomans Isolates in Korea 117 청형을분석한결과혈청형 A가 55주, B 2주, D 1주이었으며, 환경균주는모두혈청형 A로보고한바있으며, 최근 Choe 등 (25) 은 1990년에서 2008년까지우리나라에서분리된 78주의 C. neoformans의특성을분석한결과 75주는 C. neoformans 혈청형 A, VNI형, 3주는 C. gattii 혈청형 B이었으며그유전자형은 VGII(2주 ) 와 VGIII(1주 ) 임을보고하였다. 최근에미생물의분자유전학적특성을밝히기위한다양한분석법이소개됨으로써 C. neoformans 균종에관한분자유전학적연구도활발히진행되고있다. 지역적으로이들균종의분자역학적특성을살펴보면 C. neoformans 혈청형 A, VNI형이아시아, 아프리카, 그리고센트랄아메리카지역에서차지하는비율은각각 77%, 72.6% 및 78% 로서주종을이루고있으며, 유럽, 오세아니아, 북아메리카지역에서는 VNI형이각각 45%, 31%, 및 41% 로서상대적으로분리율이낮다. 유럽지역에서는 VNI형대신에 VNIII와 VNIV형이각각 26% 와 20% 을차지하고있어 C. neoformans 균종이지역간의큰차이가있음이보고되었다 (22). C. gattii 유전자형의분리율을살펴보면아시아지역은 C. gattii VGI형이 15% 로주종을이루며, 아프리카지역에서는 VGIV형이 6%, 센트랄아메리카지역에서는 VGII형이 11% 로우위를차지하고있다. 오세아니아지역에서는 VGI형이 43%, 북아메리카는 VGII형이 26% 로지역적특성을잘나타내고있다 (22). 우리나라에서는 2012년 Hwang (26) 의연구보고에의하면 1993 년에서 2010년동안분리동정된임상균주 C. neoformans 125균주중에서 C. gattii 분리와분자생물학적특성을분석한결과 1993년, 1999년및 2006년에각각 1균주씩총 3균주가확인되었으며, 혈청형은모두 B형이었고유전자형은각각 VGI, VGII 및 VGIII형을나타내었다. Mihara 등 (27) 은일본나가사키지역에서 1996년에서 2010년사이에분리된 35주임상균주 C. neoformans의유전자형분석을한결과에서 32주는 C. neoformans VNI형, 3주는 VNII형으로분리됨을보고하였다. 또한 Chen 등 (4) 은 1980년에서 2006년까지분리된 C. neoformans 129균주의분자유전학적특성을분석한결과 120주는모두 C. neoformans 혈청형 A, VNI형이었으며, 9주는 C. gattii 혈청형 B, VGI형으로보고하였다. 본연구에서는 Hwang (26) 의논문에사용되지않은 2008년에서 2010년사이에일부종합병원에서분리된임상균주 30주를이용하여분자생물학적특성을살펴본결과모두 C. neoformans 혈청 형 A, VNI형으로확인되었으며, C. gattii는분리되지않았다. 이와같은결과는동아시아지역인일본과중국에서분리된 C. neoformans 균종의유전자형특성이유사함을확인하였으며 C. gattii 균종은기후와지역적특성에따라우리나라를비롯하여온대지역아시아지역에서아직은그분리율이매우저조함을확인할수있었다. 그러나지금까지아열대및열대기후조건과자연서식처의제한적특성을갖고있던 C. gattii 균종이북아메리카온대지역에서의분리율증가와다양한유전자형출현은전세계적으로역학연구의중요과제로생각된다. C. neoformans mating type은 MATa 와 MATa 두종류가존재하며이균종의생태학적특성과병원성관련연구에중요하다. 임상균주또는환경균주에있어서대부분이 (~95%) MATa 로주종을이루며, mating type에관계없이적절한환경에서균사를만들거나눈으로볼수있는 basidiospore를형성하는것으로알려져있다. 또한 mating type 결정유전자는잠재적병원성인자로서의영향을나타내는것으로서, 동물실험결과 MATa 균주가 MATa 균주보다병원성이더강한것으로보고되었다 (13, 28). 기존의연구와본실험의결과에서 C. neoforamns 임상균주는모두 MATa형을나타냄으로써 MATa Cryptococcus 균종이우세함을재확인하였다. Cryptococcus 균종의분자유전학적분석방법으로여러가지방법이사용되고있는데, 이중에서 M13 primer 및 (GACA) 4 반복서열에의한 PCR fingerprint법, random amplification polymorphic DNA (RAPD) 분석법, amplified fragment length polymorphism (AFLP), URA5 또는 phospholipase B (PLB1) 유전자 RFLP 분석법, multi-locus sequence typing (MLST) 등널리이용되고있다 (29, 30). 이중에서 M13 phage 특이 primer PCR-fingerprint법과 URA5 유전자 RFLP 분석법은 C. neoformans 유전자형을확인할수있는방법으로잘알려져있다. Random primer 을이용한 RAPD 분석법은 C. neoformans의분자역학적연구에보다손쉽게응용할수있는방법으로유전자형의 subtype 결정, 변이균종출현, 임상균주와환경균주간의상관성등을연구하는데많은도움이되고있다 (5, 19). 본실험에서 2종류의 random primer, OPH-02와 OPH- 12를사용하여 RAPD 분석을한결과에서임상균주 30주모두동일한패턴으로, 균주간의차이가없음을확인하였다. Hwang (19) 은 2000년에서 2005년사이부산지역에서분리된임상균주 7주와환경균주 5주의 C. neoformans

118 SH Park, et al. 은모두혈청형 A이었으나, RAPD 분석결과두종류의다른패턴이확인되어균종간의차이가있음을보고한바있다. Yamamoto 등 (18) 은나가사키지역에서분리된 C. neoformans 21주의 RAPD 분석결과에서 4종류의 RAPD 패턴이존재하는것을보고하였다. RAPD 분석법은변이균종의유전적특성을쉽게발견할수있는방법으로그이용가치가높은실험이며 random primer의선별과지속적인반복실험의결과는다양한변이균종을확인하는데많은도움이될것으로생각된다. C. neofmormans 균종은면역기능저하환자에서주된기회감염균이며면역기능정상인에서도감염을일으키는병원성진균이다. 본실험에사용된임상균주가분리된환자의평균연령은 62.7세로고령화에따른영향을보여주고있으며, 데이터는제공하지않았지만기저질환이존재한경우가 80% 로서, 기저질환과 Cryptococcus 감염의상관성에관한연구가더필요할것으로생각된다. 우리나라종합병원 2곳에서 2008년에서 2010년사이에분리된임상균주 30주는일본나가사키지역 (27) 과중국지역 (4) 에서일정기간동안분리된균종의분리율에비하여상대적으로높은분리율을나타내고있다. 그러므로 Cryptococcus 균종의감염에관한다양한연구가이루어져야될것으로생각되며감염역학의기초자료를얻기위해서는임상진단, 미생물의분리동정에의한균주보관및역학연구에관한관리시스템이전국적으로이루어져서지속적인데이터구축이필요할것으로사료된다. 참고문헌 1) Heiman J, Kozel TR, Kwon-Chung KJ, Perfect JR, Casadevall A. Cryptococcus from human pathogen to model yeast. Washington D. C. USA: ASM Press, 2011. 2) Matsumoto MT, Fusco-Almeida AM, Baeza LC, Melhem Mde S, Medes-Giannini MJ. Genotyping, serotyping and determination of mating-type of Cryptococcus neoformans clinical isolates from São Paulo State, Brazil. Rev Inst Med Trop Sao Paulo 2007;49:41-7. 3) Liaw SJ, Wu HC, Hsueh PR. Microbiological characteristics of clinical isolates of Cryptococcus neoformans in Taiwan: serotypes, mating types, molecular types, virulence factors, and antifungal susceptibility. Clin Microbiol Infect 2010;16: 696-703. 4) Chen J, Varma A, Diaz MR, Litvintseva AP, Wollenberg KK, Kwon-Chung KJ. Cryptococcus neoformans strains and infection in apparently immunocompetent patients, China. Emerg Infect Dis 2008;14:755-62. 5) Meyer W, Castañeda A, Jackson S, Huynh M, Castañeda E. Molecular typing of Ibero American Cryptococcus neoformans isolates. Emerg Infect Dis 2003;9:189-95. 6) Bennett JE, Kwon-Chung KJ, Howard DH. Epidemiologic differences among serotypes of Cryptococcus neoformans. Am J Epidemiol 1977;105:582-6. 7) Ellis DH, Pfeiffer TJ. Natural habitat of Cryptococcus neoformans var. gattii. J Clin Microbiol 1990;28:1642-4. 8) Kuroki M, Phichaichumpon C, Yasuoka A, Chiranairadul P, Chosa T, Sirinirund P, et al. Environmental isolation of Cryptococcus neoformans from an endemic region of HIVassociated cryptococcosis in Thailand. Yeast 2004;21:809-12. 9) Pappalardo MC, Melhem MS. Cryptococcosis: a review of the Brazilian experience for the disease. Rev Inst Med Trop Sao Paulo 2003;45:299-305. 10) Datta K, Bartlett KH, Marr KA. Cryptococcus gattii: emergence in western North America: exploitation of a novel ecological niche. Interdiscip Perspect Infect Dis 2009;2009:176532 11) Byrnes EJ 3rd, Li W, Ren P, Lewit Y, Voelz K, Fraser JA, et al. A diverse population of Cryptococcus gattii molecular type VGIII in southern Californian HIV/AIDS patients. PLoS Pathog 2011;7:e1002205. 12) Feng X, Yao Z, Ren D, Liao W, Wu J. Genotype and mating type analysis of Cryptococcus neoformans and Cryptococcus gattii isolates from China that mainly originated from non- HIV-infected patients. FEMS Yeast Res 2008;8:930-8. 13) Yan Z, Li X, Xu J. Geographic distribution of mating type alleles of Cryptococcus neoformans in four areas of the United States. J Clin Microbiol 2002;40:965-72. 14) Chaturvedi S, Rodeghier B, Fan J, McClelland CM, Wickes BL, Chaturvedi V. Direct PCR of Cryptococcus neoformans MATalpha and MATa pheromones to determine mating type, ploidy, and variety: a tool for epidemiological and molecular pathogenesis studies. J Clin Microbiol 2000;38:2007-9. 15) Meyer W, Marszewska K, Amirmostofian M, Igreja RP, Hardtke C, Methling K, et al. Molecular typing of global isolates of Cryptococcus neoformans var. neoformans by polymerase chain reaction fingerprinting and randomly amplified polymorphic DNA-a pilot study to standardize techniques on which to base a detailed epidemiological survey. Electrophoresis 1999;20:1790-9.

Molecular Typing of Clinical C. neoforomans Isolates in Korea 119 16) Staib F. The green colour effect (GCE) of the killer strain Cryptococcus laurentii CBS 139 on Staib agar. Mycoses 1999; 42:103-6. 17) Kwon-Chung KJ, Polacheck I, Bennett JE. Improved Diagnostic medium for separation of Cryptococcus neoformans var. neoformans (serotypes A and D) and Cryptococcus neoformans var. gattii (serotype B and C). J Clin Microbiol 1982;15:535-7. 18) Yamamoto Y, Kohno S, Koga H, Kakeya H, Tomono K, Kaku M, et al. Random amplified polymorphic DNA analysis of clinically and environmentally isolated Cryptococcus neoformans in Nagasaki. J Clin Microbiol 1995;33:3328-32. 19) Hwang SM. Molecular characterization of clinical and environmental strains of Cryptococcus neoformans isolated from Busan, Korea. J Bacteriol Virol 2010;40:91-8. 20) Kwon-Chung KJ, Varma A. Do major species concepts support one, two or more species within Cryptococcus neoformans? FEMS Yeast Res 2006;6:574-87. 21) Illnait-Zaragozi MT, Martínez-Machín GF, Ferníndez-Andreu CM, Boekhout T, Meis JF, Klaassen CH. Microsatellite typing of clinical and environmental Cryptococcus neoformans var. grubii isolates from Cuba shows multiple genetic lineages. PLoS One 2010;5:e9124. 22) Meyer W. Trilles, L. Genotyping of the Cryptococcus neoformans/c.gattii species complex. Australian Biochemist 2010;41:12-5. 23) Ohkusu M, Tangonan N, Takeo K, Kishida E, Ohkubo M, Aoki S, et al. Serotype, mating type and ploidy of Cryptococcus neoformans strains isolated from patients in Brazil. Rev Inst Med Trop Sao Paulo 2002;44:299-302. 24) Hwang SM, Oh KS, Lee KW. Serotype and enzymatic profile of Cryptococcus neoformans isolates from clinical and environmental sources in Korea. Korean J Microbiol 2006;42:257-64. 25) Choi YH, Ngamskulrungroj P, Varma A, Sionov E, Hwang SM, Carriconde F, et al. Prevalence of the VNIc genotype of Cryptococcus neoformans in non-hiv-associated cryptococcosis in the Republic of Korea. FEMS Yeast Res 2010;10: 769-78. 26) Hwang SM. Molecular typing of clinical Cryptococcus gattii isolates in Korea. J Bacteriol Virol 2012;42:152-5. 27) Mihara T, Izumikawa K, Kakeya H, Ngamskulrungroj P, Umeyama T, Takazono T, et al. Multilocus sequence typing of Cryptococcus neoformans in non-hiv associated cryptococcosis in Nagasaki, Japan. Med Mycol 2013;51:252-60. 28) Kwon-Chung KJ, Bennett JE. Distribution of α and α mating types of Cryptococcus neoformans among natural and clinical isolates. Am J Epidemiol 1978;108:337-40. 29) Diaz MR, Boekhout T, Kiesling T, Fell JW. Comparative analysis of the intergenic spacer regions and population structure of the species complex of the pathogenic yeast Cryptococcus neoformans. FEMS Yeast Res 2005;5:1129-40. 30) Brandt ME, Hutwagner LC, Kuykendall RJ, Pinner RW. Comparison of multilocus enzyme electrophoresis and random amplified polymorphic DNA analysis for molecular subtyping of Cryptococcus neoformans. The Cryplococcal Disease Active Surveillance Group. J Clin Microbiol 1995;33:1890-5.