Microsoft Word - 03-황수명.doc

Size: px

Start display at page:

Download "Microsoft Word - 03-황수명.doc"

가영 천
7 years ago
Views:

1 Journal of Bacteriology and Virology Vol. 41, No. 3 p Original Article Correlation Between the Prevalence of Superantigenic Toxin Genes and Coagulase Serotypes of Staphylococcus aureus Isolates Yeo Gyeong Kim, Han Sol Lee, Seong Kyun Kang, Kyung Soo Chang and Soo Myung Hwang * Department of Clinical Laboratory Science, Catholic University of Pusan, Busan, Korea A heterogenic group of staphylococcal exotoxins, including staphylococcal superantigenic toxins, enterotoxin (SE), toxic shock syndrome toxin-1 (TSST-1), and coagulase are the most important virulence factors of Staphylococcus aureus. We analyzed the prevalence of genes encoding five enterotoxins and TSST-1 in S. aureus isolated from clinical ear discharges. The genes were identified by multiplex PCR and we compared the results to references of coagulase serotypes. In 102 isolates of S. aureus, 44 of them were methicillin-resistant S. aureus (MRSA) and the others were methicillin-susceptible S. aureus (MSSA). Among both types of S. aureus, 33 strains were positive for sea, 2 for seb, 23 for sec, 26 for see, and 26 for tst. Overall, 59 (57.8%) isolates were positive for one or more superantigenic toxin genes. From these, 71.2% (42/59) strains harbored more than one toxin gene in different combinations. The major combinations of genes were sea and see, and sec and tst. The degree of possession of superantigenic toxic genes was similar in both MRSA and MSSA isolates (56.8% vs 58.6%, respectively), yet significant differences in toxin gene profiles and coagulase serotypes between two isolates were detected. All of 13 positive strains for sec and tst were MRSA and belonged to coagulase serotype II. On the other hand, 80.0% of 20 positive strains for sea and see were MSSA with coagulase serotype IV and VII, whereas 20.0% of them were MRSA with coagulase serotype IV. This data indicates that the profile of superantigenic toxin genes correlates to coagulase serotype and methicillin resistance in S. aureus isolates. Key Words: Staphylococcus aureus, Staphylococcal enterotoxins, Toxic shock syndrome toxin-1, Coagulase serotype 서론 Staphylococcus aureus (S. aureus) 는광범위한화농성질환의주원인균이며, 건강한사람의피부나비강에서도빈번히집락을형성하는균으로잘알려져있다. 1960년대초 methicillin 내성 S. aureus의출현이래로다약제내성균주증가는병원내감염뿐아니라지역사회관련 Received: June 15, 2011/ Revised: July 25, 2011 Accepted: August 8, 2011 * Corresponding author: Soo Myung Hwang. Department of Clinical Laboratory Science, College of Health Sciences, Catholic University of Pusan, Busan , Korea. Phone: , Fax: smhwang@cup.ac.kr ** This works was supported by research fund from Catholic University of Pusan in 감염으로이어져사회적문제가되고있다 (1, 2). S. aureus는병독성인자로서여러가지종류의효소와독소성분을생성분비함으로써숙주세포의침투와면역작용을방해하는것으로알려져있다. 효소성분으로는 coagulase, thermonuclease, lipase, hyaluronidase 등이있으며, 독소로는식중독의원인인장독소 (staphylococcal enterotoxin, SE), toxic shock syndrome을일으키는 toxic shock syndrome toxin-1 (TSST-1), 백혈구파괴독소인 leukocidin, 피부박피독소인 exfoliative toxin 등이있다 (3~5). 이중에서장독소 (SE) 와 TSST-1 성분은주조직적합성복합체 (major histocompatibility complex, MHC) class II와 T 림프구수용체의 Vβ 사슬에결합하여비특이적 T 세포증식에의한사이토카인의과다분비를유도하는수퍼항원성독소 (pyrogenic toxin superantigens, PTSAgs) 로잘알려져있다 (6, 7). 장독소 (SE) 단백질성분은내열성이며, trypsin 등 157

2 158 YG Kim, et al. 단백질분해효소에저항성을나타내는식중독의주원인물질로서, 위장관성독소로작용할뿐아니라알러지및자가면역성질환에관여하며, 항원성차이에의하여 5종류의주요혈청형 (SEA, SEB, SEC, SED, SEE) 을포함하여 SEF, SEG, SEH. SEI 및 SEJ 등의 19종류가밝혀져있다 (7~9). TSST-1은발열, 발적및혈압저하등의 toxic shock syndrome을일으키는원인독소로서치명적인질환을유발한다 (6~9). S. aureus 균주에있어서 SE와 TSST-1 독소유전자의전달양상은 plasmid, prophage 또는 staphylococcal pathogenicity islands (SaPI) 등의이동성유전인자에의해이루어지며이들병독성인자의유전자발현은 accessory gene regulator (agr) 에의하여조절된다. 또한 agr 유전자는염기서열차이에의하여 4종류의그룹으로나누어지며, agr type과 SE 또는 TSST-1 유전자형이 S. aureus 균주의클론성유전자형과연관성이있는것으로알려져있다 (10, 11). S. aureus 의분리동정에결정적요소이며, 사람이나동물의 prothrombin 을활성화하여혈전을생성하는 coagulase는항원성의차이에의하여 10종의혈청형이알려져있다. S. aureus의 coagulase 혈청형과유전자형분석은항생제내성균주, 분리되는검체의종류에따라그특성이다르게나타나고있어분자역학적연구에이용되고있다 (12~14). 병원내감염으로인한다약제내성 MRSA 분리율증가는사회적으로문제가되고있으며또한최근에지역사회관련된 MRSA의증가추세는균주간의내성인자획득, 전파그리고병독성인자의변형등의변이균종으로이어져새로운 superbacteria 출현이라는어려움에직면하고있다. 이들내성균과변이균주의출현을확인하고, 예방하기위해서는다양한분자역학적분석법을이용하여지속적인연구가이루어져야될것으로생각된다. Coagulase 형별분석, 독소생성능, 항생제감수성결과의비교분석은 S. aureus 균주의유전적변이에따른특성변화를예측할수있는가장기초적인방법으로쉽게이행할수있는역학적분석법이라생각된다. 본연구에서는임상검체귀분비물에서분리된 S. aureus 균주에서수퍼항원성독소인 5종류의 SE와 TSST- 1 독소생성유전자의보유양상을분석하고생물학적특성인 coagulase 혈청형과 methicillin 내성과의상관성을비교하였다. 재료및방법실험균주 2005년과 2006년부산시소재 2개종합병원에내원한 102명환자의귀분비물에서개별적으로분리동정된 S. aureus 102주를실험균주로사용하였다. 총 102주의항생제감수성시험결과에서 oxacillin 내성 (> 4 mg/l) 균주로확인된 MRSA 균주는 44주이었으며, 나머지 58주는 methicillin 감수성 (MSSA) 균주이었다. SE 독소생성표준균주는 ATCC13565 (sea), ATCC14458 (seb), ATCC (sec), ATCC23235 (sed), ATCC (see) 를, TSST-1 생성균주는 SM103 균주를사용하였다. DNA 분리및 methicillin 내성유전자 (meca) 확인균주의 genomic DNA 분리는 AccuPrep Genomic DNA Extraction Kit (BIONEER Co. Ltd. Seoul, Korea) 를이용하여추출하였다. Methicillin 내성유전자인 meca 검출은 Mehrotra (4) 등의방법을응용하여 PCR 법으로실시하였다. Multiplex PCR법에의한 SE와 TSST-1 독소유전자분석 SE와 TSST-1 유전자분석은 Mehrotra (4) 와 Johnson (5) 등의방법을응용하여 3조합 (set A: sea와 see, set B: seb와 sed, set C: sec와 tst) 으로나누어실시하였으며, 사용된 primer는 Table 1과같다. PCR 반응혼합액은 AccuPower PCR Premix Kit를사용하여, DNA 시료 (75 ng) 1 μl, 각조합별 primer (10 pmol) 를각각 0.5 μl 넣고증류수로총 20 μl로최종부피를맞추었다. PCR 조건은 94 에서 4 분간초기반응, 94 30초, 53 30초, 72 1분의과정으로 35회반복하였고, 마지막으로 72 에서 4분연장으로 PCR을종결하였다. 증폭된 DNA 시료는 1.5% agarose gel 을통하여전기영동을실시하였고, 각증폭산물의크기를확인하여독소유전자유무를결정하였다. Coagulase 혈청형시험 S. aureus의 coagulase 혈청형분석은 8종 (Type I-VIII) 의항혈청 (Denka Seiken Co, Tokyo Japan) 을사용하여 Hwang 등 (15) 의방법으로분석하였다. Nutrient agar 배지에자란한집락을 5 ml brain heart infusion broth (BHI) 에접종

sec sed GSEBR-1 GSEBR-2 SEC-1 SEC-2 GSEDR-1 GSEDR-2 GTATGGTGGTGTAACTGAGC CCAAATAGTGACGAGTTAGG GACATAAAAGCTAGGAATTT AAATCGGATTAAATCCATTC CCAATAATAGGAGAAATAAAAG ATTGGTATTTTTTTTCGTTC 164 4 257 5 278 4

3 Correlation between Toxin Genes and Coagulase Serotypes in S. aureus 159 Table 1. Primers for PCR amplification of toxin gene typing Genes Primer names Primer sequences (5'-3') Amplified size (bp) Reference sea SEA12-1 SEA12-2 TTGGAAACGGTTAAAACGAA GAACCTTCCCATCAAAAACA seb sec sed GSEBR-1 GSEBR-2 SEC-1 SEC-2 GSEDR-1 GSEDR-2 GTATGGTGGTGTAACTGAGC CCAAATAGTGACGAGTTAGG GACATAAAAGCTAGGAATTT AAATCGGATTAAATCCATTC CCAATAATAGGAGAAATAAAAG ATTGGTATTTTTTTTCGTTC see GSEER-1 GSEER-2 AGGTTTTTTCACAGGTCATCC CTTTTTTTTCTTCGGTCAATC tst TSST-1 TSST-2 ATGGCAGCATCAGCTTGATA TTTCCAATAACCACCCGTTT meca MEC163-1 MEC163-2 ACTGCTATCCACCCTCAAAC CTGGTGAAGTTGTAATCTGG Figure 1. Agarose gel analysis of PCR-amplified meca genes from MRSA isolates. Lanes: M, 100 bp ladder; 1 to 7, MRSA isolates. 하여 37 shaking incubator에서하룻밤배양한후, 0.1 ml 의균배양액을새로운 5 ml BHI broth에접종하여 4~5시간배양을하여균의농도가 10 8 CFU/ml 되게조정하고, 6,000 g, 20분동안원심분리하여그상층액을분석시료로사용하였다. Coagulase 기질용액으로는 polyethyleneaminocarpronic acid-fibrinogen (PAF) 를사용하였다. U- microplate 각 well에항혈청 8종을각각 10 μl 집어넣고, 시료 10 μl를각항혈청이들어있는 well에가하여가볍게혼합한다음실온에서 5분방치하였다. 그다음으로 PAF 기질용액을각 well에 20 μl 넣은후 37 incubator 에서 2시간이후부터 30분간격으로형특이 coagulase와항혈청간의중화반응에의한응고억제반응여부를관찰하였다. Figure 2. Agarose gel analysis of PCR-amplified toxin genes from the standard strains of S. aureus. Lanes: M, 100 bp ladder; 1, sea (120 bp); 2, seb (164 bp); 3, sec (257 bp); 4, sed (278 bp); 5, see (209 bp); 6, tst (350 bp). 결과 Methicillin 내성균주로부터 meca 유전자확인 항생제감수성시험에서 oxacillin 내성 (>4 mg/l) 인 44 균주를대상으로 meca 유전자를분석한결과, 163 bp 크기의 meca 유전자가모두검출되어 methicillin 내성균임을확인하였다 (Fig. 1). SE 와 TSST-1 독소유전자확인 표준균주에서의 SE와 TSST-1 유전자확인과 multiplex PCR법으로분석한결과는 Fig. 2와 Fig. 3과같다.

160 YG Kim, et al. Table 3. Combination of SE and TSST-1 genes in S. aureus isolates Figure 3. Multiplex PCR patterns of toxin genes from S. aureus isolates. Lanes: M, 100 bp ladder; 1 to 3, primer set A; 4, primer set B; 5 to 7, primer set C.

4 160 YG Kim, et al. Table 3. Combination of SE and TSST-1 genes in S. aureus isolates Figure 3. Multiplex PCR patterns of toxin genes from S. aureus isolates. Lanes: M, 100 bp ladder; 1 to 3, primer set A; 4, primer set B; 5 to 7, primer set C. Table 2. Prevalence of SE and TSST-1 genes in S. aureus isolates Toxin gene MRSA (n=44) No. (%) of isolates MSSA (n=58) Total (n=102) p value sea 7 (15.9) 26 (44.8) 33 (32.4) seb - 2 ( 3.4) 2 ( 2.0) sec 14 (31.8) 9 (15.5) 23 (22.5) sed see 4 ( 9.1) 22 (38.0) 26 (25.5) tst 19 (43.2) 7 (12.1) 26 (25.5) MRSA, methicillin-resistant S. aureus; MSSA, methicillinsusceptible S. aureus. P value based on Pearson chi-square test. p < 0.05, statistical significance. 총 102 S. aureus 균주에서 5종류의 SE와 TSST-1 각각의유전자분리율을살펴보면 sea 보유균주는 33주, seb 2주, sec 23주, see 26주, tst 26주로, 가장분리율이높은독소유전자는 sea (32.4%) 이었으며, 그다음으로 see (25.5%) 와 tst (25.5%), sec (22.5%) 순이었으며 sed 유전자는검출되지않았다 (Table 2). se 또는 tst 유전자중에서하나또는둘이상의유전자보유균주는총 102균주중 59주 (57.8%) 이었고, MRSA와 MSSA 균주에서의유전자보유율은각각 56.8% 와 58.6% 로나타내어 MRSA 균주와 MSSA 균주간의독소유전자분리율은유사하였다. 그러나보유유전자의종류및조합은크게다른것으로확인되었다. sea 또는 sea와 see 유전자는주로 MSSA 균주에서분리되었고, 반면에 sec와 tst 유전자는 MRSA 균주에서분리되어, S. aureus 균주의 methicillin 내성과상관성이있음을확인하였다 (Table 3). Toxin gene Coagulase 혈청형 MRSA (n=44) No. (%) of isolates MSSA (n=58) Total (n=102) sea sea, seb sea, seb, tst sea, sec, tst 1-1 sea, sec, see sea, sec, see, tst sea, see sea, see, tst sec sec, tst tst Total 25 (56.8) 34 (58.6) 59 (57.8) 총 102주 S. aureus 의 coagulase 혈청형을분석한결과, I형에서 VIII형까지 8종의 coagulase형이분리되었다. MRSA와 MSSA 균주의 coagulase 형별차이를비교한결과는 Table 4와같다. MRSA 44주에서 coagulase II형이 19주로가장분리율이높았으며다음으로 IV형 : 15주, V 형 : 7주순이었다. MSSA 58주에서는 VII형이 16주, IV형 : 15, V형 : 14주이었으며, MRSA에서는분리되지않았던 III 형, VI, VIII형이분리되었다. SE, TSST-1 독소유전자와 coagulase 혈청형과의상관성 수퍼항원성독소유전자인주요 5종의 SE 및 TSST-1 유전자형과 coagulase 혈청형과의상관성을비교한결과는 Table 5와같다. MRSA 균주에서만분리된 19주의 coagulase II형에서 sea, sec, tst 세종류를보유한 1균주를포함하여 sec와 tst 두개의유전자를보유한균주가 14주, tst만보유한균주는 5주로, 모두 sec 또는 tst 유전자가검출되었다. 30주의 coagulase IV형균주에서는 20 주가독소유전자를보유하고있었으며, sec만갖고있는 1균주를제외한 19균주는모두 sea 또는 sea와 see 두유전자를갖고있음을확인하였다. 또한 coagulase IV형균

5 Correlation between Toxin Genes and Coagulase Serotypes in S. aureus 161 Strains No. (%) of isolates Table 4. Distribution of coagulase serotypes of S. aureus isolates Coagulase serotype I II III IV V VI VII VIII ND MRSA MSSA Total ND, not determined. 102 (100) 1 (1.0) 19 (18.6) 4 (3.9) 30 (29.4) 21 (20.6) 2 (2.0) 17 (16.7) 3 (2.9) 5 (4.9) Table 5. Correlation between prevalence of superantigenic toxin genes and coagulase serotypes in S. aureus isolates Coagulase serotype Toxin gene No. of isolates I II III IV V VI VII VIII ND sea (2) * sea, seb sea, seb, tst sea, sec, tst 1 - (1) * sea, sec, see sea, sec, see, tst sea, see (4) * sea, see, tst sec sec, tst 13 - (13) * tst 8 - (5) * ( ) *, No. of MRSA strains. 주중 6주의 MRSA는나머지 MSSA 균주와같이 sea 또는 sea와 see 유전자를갖고있어서, coagulase IV형과독소유전자형간의상관성이있음을확인하였다. Coagulase VII형인경우는모두 MSSA 균주에서분리되었으며, 이들균주에서도 sea와 see 보유균주가 6주, sea, sec와 see 보유균주가 3주로, sea와 see 유전자가많이분리되었다. Coagulase V형에서는 5주의 MSSA 균주에서 sea와 seb (1 주 ), sec (1주), tst (3주) 가분리되었다. 반면에 coagulase I, III, VI형의균주에서는독소유전자가분리되지않았다. 고찰 S. aureus는가장흔히발견되는병원성세균으로다양한치명적질환을유발한다. 이들균종의다약제내성균출현은병원감염및지역 사회감염에의한사회적문제가되고있다 (16, 17). 본실험에서는임상검체중귀분비물에서분리한 MRSA와 MSSA 균주에서수퍼항원성독소유전자인 5종의 SE 유전자와 TSST-1 유전자를 multiplex PCR법으로확인하였다. 총실험균주의 57.8% 에서한종류또는두종류이상의독소유전자가확인되었으며, MRSA와 MSSA 균주간의유전자분리율은각각 56.8% (25/44주) 와 58.6% (34/58주) 로유사하였으나, 이들균주간의보유유전자종류에서큰차이를나타내었다. MRSA 균주에서분리된주요유전자는 sec와 tst이었으며, 두유전자모두보유한균주는 29.5% (13/44주) 이었다. MSSA 균주에서는 sec와 tst 유전자보유균주는현저히낮았으며, 반면에 sea와 see 유전자를갖는균주가우세하였고, 두유전자를동시에갖는균주는 27.6% (16/58주) 를나타냄으로써, methicillin 내성에따른균주간의차이를확인할수있었다. S. aureus

6 162 YG Kim, et al. 의독소유전자와항생제내성유전자획득은 plasmid, prophage, transposon 등의유전인자에의하여이루어지나, 최근연구결과에의하면 chromosomal islands 삽입의이동성유전자복합체인 staphylococcal pathogenicity islands (SaPIs) 와 staphylococcal cassette chromosome mec (SCCmec) 유전자가수퍼항원성독소유전자와 methicillin 내성 meca 유전자전달에각각작용하는것으로보고되었다 (6, 9). 또한이들유전자복합체의특성에따라 S. aureus의유전자형을분류할수있다. MRSA 균주가 MSSA 균주보다이동성유전인자인 SaPIs를포함하여 prophages, plasmid 를더많이보유하고있다는연구결과에서 SE와 TSST-1 독소유전자형과상관성이있는것으로보고하고있으나, 특정독소유전자보유와이동성유전인자와의관련성은아직규명되지않았다 (9). Hu 등 (9) 의연구결과에의하면다양한임상검체에서분리된 MRSA 균주에서분리된주요유전자는 sec와 tst이었으며, MSSA 균주에서는 sea 가우세한유전자로서, 본실험결과와유사하였으나 see 분리율에서차이를나타내었다. Peck 등 (3) 은혈액과비강검체에서분리된 S. aureus의독소유전자비교분석에서 MRSA 균주에서만 sec 유전자를확인하였고, tst 유전자는 MRSA와 MSSA 균주에서각각 72.2%, 53.3% 의분리율을나타내었으며, Kim 등 (1) 은혈액에서분리된균주에서 sea와 see 유전자가 MSSA 보다 MRSA 균주에서더많이분리되었음을보고함으로써본실험의결과와차이가있음을확인하였다. 또한 Collery 등 (18) 은유럽지역건강한대학생 48명의비강에서분리된 S. aureus 균주에서 seb 유전자가 5종의 SE 유전자중 75% 로가장많이분리됨을보고하였으며, Sila 등 (19) 의연구에서는 MSSA 균주에서 sec와 tst 양성균주가더많은것으로보고함으로써연구결과에따른차이를나타내었다. S. aureus 균주가생성하는 coagulase는 coa 유전자의특성에따라 10종의항원성이다른혈청형이존재한다 (12). 본실험에사용된귀분비물검체에서분리된 MRSA 균주의 coagulase는혈청형 II형이가장많았고, 다음으로 IV형, V형순이었으며, MSSA 균주에서는 VII, IV 및 V형과, III, VI과 VIII형이분리되었다. 이와같은결과는귀분비물에서분리된 MRSA와 MSSA의 coagulase 혈청형은다른임상검체에서분리된 MRSA의혈청형과그분포도가유사하였으나 (20), 상대적으로 coagulase IV형의분리율이더높은것으로확인되어검체에따른차이를나타내었다. S. aureus 균주에서 coagulase 유전자의전환에 의한혈청형변화와내성유전자 SCCmec 획득기전은아직정확히밝혀져있지않지만, 숙주세포의방어체계에대처하기위한미생물의유전적변이로설명하고있다 (12). SE와 TSST-1 유전자형과 coagulase 혈청형과비교한결과에서, coagulase II형 MRSA 균주모두는 sec, tst 또는 sec와 tst 유전자가분리되었고 (p < 0.05), coagulase IV형 30 주중 19주에서분리된유전자는 sea 또는 sea와 see로서 (p < 0.05), MRSA 균주에서 40% (6/15주), MSSA 균주에서는 93.3% (13/15주) 의분리율을나타내었다. Coagulase VII형과 V형인경우 MSSA 균주에서만 sea와 see 유전자를포함하여 sea와 seb, sec, tst 유전자가확인되었고 MRSA 균주에서는검출되지않았다. Hwang 등 (20) 은 coagulase 항원성의변화와 meca 유전자획득과상관성이있음을보고한바있다. 특히 coagulase V형은 MSSA 균주에서만분리되었으나 2005년이후 coagulase V형 MRSA 균주의증가와이들균주의 methicillin 내성유전자복합체 SCCmec형은 IV형임을보고하였다 (21). Coagulase V 형 MSSA 균주에서만독소유전자가분리되었고, MRSA 균주에서분리되지않은결과에서, methicillin 내성유전자획득과독소유전자의조절기능에상호관련이있음을추정할수있겠다. 국내에서분리된 MRSA 균주중에는 sec와 tst 유전자를동시에갖고있는균주가가장많으며 (43.6%), 이들대부분은 SCCmec II형에속하는것으로알려져있다 (22). 일본에서병원내감염의주요 MRSA의유전자형은뉴욕 / 일본클론으로 SCCmec II형, sequence type 5 (ST5), agr type 2, coagulase II형, sec와 tst 유전자양성의특성을갖고있다 (11). 이들균주는우리나라에서분리되는 MRSA 균주와관련이있는것으로생각되어지나독소유전자를비롯하여 coagulase 형별분석, 항생제내성유전자의분석과그상관성에관한연구결과는거의없는실정이다. 본실험에서일부분의수퍼항원성독소유전자형을분석하였지만 coagulase형에따라, 또한 methicillin 내성과상관성이있음을예측할수있었다. S. aureus의분자역학연구방법으로 pulse-field gel electrophoresis (PFGE) 를비롯하여, multilocus sequence typing (MLST), protein A 유전자, toxin 조절유전자등 PCR 분석법을이용하여유전자형을결정하고있다 (23~ 25). 이중에서생물학적특성을이용한 coagulase형, 항생제내성율및수퍼항원성독소생성능등의연구는균종의특성변화와변이균주출현을예측할수있는기본적인방법이다. 특히 S. aureus의 coagulase 혈청형분

7 Correlation between Toxin Genes and Coagulase Serotypes in S. aureus 163 석은간편하고재현성이좋은검사방법으로서, 분자역학적인방법인 random amplified polymorphism DNA analysis (RAPD) 분석결과와비교하였을때 coagulase형에따라유의성있는결과를얻을수있었다 (data not shown). 본실험에서부산지역에서분리된 methicillin 내성 S. aureus (MRSA) 와 methicillin 감수성 S. aureus (MSSA) 균주에서 5종의주요 SE와 TSST-1 유전자형을분석한결과 methicillin 내성과 coagulase 혈청형에따른독소유전자형의특성을확인하였다. 특히지역사회관련 MRSA균주의분리율이높은검체로알려진귀분비물에서 (26) 분리된 S. aureus 균주에서의비교분석결과는이들균종의병원성과분자역학적연구의기초자료로이용될수있을것으로생각된다. 참고문헌 1) Kim YK, Kim JS, Kim HS, Song W, Cho HC, Lee KM. Molecular typing of Staphylococcus aureus isolated from blood on the basis of coagulase gene polymorphism and toxin genes. Korean J Lab Med 2008;28: ) Eady EA, Cove JH. Staphylococcal resistance revisited: community-acquired methicillin resistant Staphylococcus aureus-an emerging problem for the management of skin and soft tissue infections. Curr Opin Infect Dis 2003;16: ) Peck KR, Baek JY, Song JH, Ko KS. Comparison of genotypes and enterotoxin genes between Staphylococcus aureus isolates from blood and nasal colonizers in a Korean hospital. J Korean Med Sci. 2009;24: ) Mehrotra M, Wang G, Johnson WM. Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance. J Clin Microbiol 2000;38: ) Johnson WM, Tyler SD, Ewan EP, Ashton FE, Pollard DR, Rozee KR. Detection of genes for enterotoxins, exfoliative toxins, and toxic shock syndrome toxin 1 in Staphylococcus aureus by the polymerase chain reaction. J Clin Microbiol 1991;29: ) Ortega E, Abriouel H, Lucas R, Gáalvez A. Multiple Roles of Staphylococcus aureus enterotoxins: pathogenicity, superantigenic activity, and correlation to antibiotic resistance. Toxins 2010;2: ) Becker K, Friedrich AW, Lubritz G, Weilert M, Peters G, Von Eiff C. Prevalence of genes encoding pyrogenic toxin superantigens and exfoliative toxins among strains of Staphylococcus aureus isolated from blood and nasal specimens. J Clin Microbiol 2003;41: ) Diep BA, Carleton HA, Chang RF, Sensabaugh GF, Perdreau- Remington F. Roles of 34 virulence genes in the evolution of hospital- and community-associated strains of methicillinresistant Staphylococcus aureus. J Infect Dis 2006;193: ) Hu DL, Omoe K, Inoue F, Kasai T, Yasujima M, Shinagawa K, et al. Comparative prevalence of superantigenic toxin genes in methicillin-resistant and methicillin-susceptible Staphylococcus aureus isolates. J Med Microbiol 2008;57: ) Novick RP. Mobile genetic elements and bacterial toxinoses: the superantigen-encoding pathogenicity islands of Staphylococcus aureus. Plasmid 2003;49: ) Zaraket H, Otsuka T, Saito K, Dohmae S, Takano T, Higuchi W, et al. Molecular characterization of methicillin-resistant Staphylococcus aureus in hospitals in Niigata, Japan: divergence and transmission. Microbiol Immunol 2007;51: ) Watanabe S, Ito I, Takeuchi E, Endo M, Okuno E, Hiramatsu K. Structural comparison of ten serotypes of staphylocoagulases in Staphylococcus aureus. J Bacteriol 2005;187: ) Kanemitsu K, Yamamoto H, Takemura H, Kaku M, Shimada J. Relatedness between the coagulase gene 3'-end region and coagulase serotypes among Staphylococcus aureus strains. Microbiol Immunol 2001;45: ) Ishino K, Tsuchizaki N, Ishikawa J, Hotta K. Usefulness of PCR-Restriction Fragment Length Polymorphism typing of the coagulase gene to discriminate arbekacin-resistant Methicillin- Resistant Staphylococcus aureus strains. J Clin Microbiol 2007;45: ) Hwang SM, Seki K, Sakurada J, Ogasawara M, Murai M, Ohmayu S, et al. Improved methods for detection and serotyping of coagulase from Staphylococcus aureus. Microbiol Immunol 1989;33: ) Hisata K, Kuwahara-Arai K, Yamamoto M, Ito T, Nakatomi Y, Cui L, et al. Dissemination of methicillin-resistant staphylococci among healthy Japanese children. J Clin Microbiol 2005;43: ) Hanssen AM, Fossum A, Mikalsen J, Halvorsen DS, Bukholm G, Sollid JU. Dissemination of Community-acquired methicillinresistant Staphylococcus aureus clones in Northern Norway: sequence types 8 and 80 predominate. J Clin Microbiol 2005;

8 164 YG Kim, et al. 43: ) Collery MM, Smyth DS, Twohig JM, Shore AC, Coleman DC, Smyth CJ. Molecular typing of nasal carriage isolates of Staphylococcus aureus from an Irish university student population based on toxin gene PCR, agr locus types and multiple locus, variable number tandem repeat analysis. J Med Microbiol 2008;57: ) Sila J, Sauer P, Kolar M. Comparison of the prevalence of genes coding for enterotoxins, exfoliatins, panton-valentine leukocidin and tsst-1 between methicillin-resistant and methicillin-susceptible isolates of Staphylococcus aureus at the university hospital in olomouc. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub 2009;153: ) Hwang SM, Kim TU. Changes in coagulase serotype of Staphylococcus aureus isolates in Busan, Kor J Microbiol 2007;43: ) Cha EK, Chang KS, Hwang SM. Correlation between staphylococcal cassette chromosome mec type and coagulase serotype of methicillin-resistant Staphylococcus aureus. J Bacteriol Viol 2009;39: ) Kim JS, Song W, Kim HS, Cho HC, Lee KM, Choi MS, et al. Association between the methicillin resistance of clinical isolates of Staphylococcus aureus, their staphylococcal cassette chromosome mec (SCCmec) subtype classification, and their toxin gene profiles. Diagn Microbiol Infect Dis 2006;56: ) Durand G, Bes M, Meugnier H, Enright MC, Forey F, Liassine N, et al. Detection of new methicillin-resistant Staphylococcus aureus clones containing the toxic shock syndrome toxin 1 gene responsible for hospital-and community-acquired infections in France. J Clin Microbiol 2006;44: ) Kim JS, Kim HS, Song W, Cho HC, Lee KM, Kim EC. Molecular epidemiology of methicillin-resistant Staphylococcus aureus isolates with toxic shock syndrome toxin and staphylococcal enterotoxin C genes. Korean J Lab Med 2007;27: ) Chini V, Dimitracopoulos G, Spiliopoulou I. Occurrence of the enterotoxin gene cluster and the toxic shock syndrome toxin 1 gene among clinical isolates of methicillin-resistant Staphylococcus aureus is related to clonal type and agr group. J Clin Microbiol 2006;44: ) Song JS, Choe PG, Song KH, Cho JH, Kim SH, Bang JH, et al. Multicenter study for frequency and clinical features of community-associated methicillin-resistant Staphylococcus aureus in Korea. Infect Chemother 2006;38:

Microsoft Word - 2-황수명.doc

Microsoft Word - 2-황수명.doc Journal of Bacteriology and Virology 2009. Vol. 39, No. 2 p.71 78 DOI 10.4167/jbv.2009.39.2.71 Correlation Between Staphylococcal Cassette Chromosome mec Type and Coagulase Serotype of Methicillin-Resistant