Microsoft Word - 10-Application of Loop-Mediated Isothermal Amplification (LAMP) Assay to Rapid Detection of Methicillin-Resist
|
|
- 이석 어
- 5 years ago
- Views:
Transcription
1 Biomedical Science Letters 2019, 25(1): 75~82 eissn : Original Article Application of Loop-Mediated Isothermal Amplification (LAMP) Assay to Rapid Detection of Methicillin-Resistant Staphylococcus aureus from Blood Cultures Yun-Hee Baek 1,,*, Mi-Young Jo 2,3,,*, Min-Suk Song 1,*, Seung-Bok Hong 4,* and Kyeong-Seob Shin 2,,* Department of Microbiology 1, Laboratory Medicine 2, Chungbuk National University College of Medicine, Cheongju 28644, Korea 3 Department of Nursing Science, Kyungbuk College of Natural Sciences, Yeongju 36133, Korea 4 Department of Clinical Laboratory Science, Chungbuk Health & Science Unviersity, Cheongju 28150, Korea We developed the multiplex LAMP assay using 16S rrna, fema and meca genes for direct detection of the methicillin resistance in Staphylococci from positive blood culture. To simultaneously recognize Staphylococci genus, S. aureus and methicillin resistance, three sets of six primers for 16S rrna, fema and meca were designed, respectively. The performance of LAMP assay was affirmed using VITEK system for the phenotypic methods of identification and for oxacillin and cefoxitin antimicrobial susceptibility. The optimal condition for LAMP assay was obtained under 64 for 50 min. The detection limit was determined to be of 20 copies and CFU/reaction (10 4 CFU/mL). For clinical application of comparison with phenotypic methods, the sensitivity and specificity of the LAMP with fema gene for detecting S. aureus was 95.31% and 100%, respectively. The sensitivity and specificity of the LAMP with meca gene for detecting methicillin resistance was 98.46% and 100%, respectively. The multiplex LAMP assay with fema and meca gene successfully detected all of MRSA (38 isolates) isolates from 103 Staphylococci in blood cultures. The LAMP assay developed in this study is sensitive, specific, and of excellent agreement with the phenotypic methods. Key Words: Blood culture, Methicillin-resistant Staphylococcus aureus, 16S rrna, fema, meca, Loop-mediated isothermal amplification 서론 Staphylococcus aureus 는의료기관연계감염 (hospital associated infection) 뿐만아니라지역사회연계감염 (community associated infection) 의주요한원인균으로모낭염 (folliculitis) 이나봉와직염 (cellulitis) 과같은국소감염부터 심내막염 (endocarditis), 패혈증 (sepsis) (Lowy, 1998), 그리고독성쇽증후군 (toxic shock syndrome) (Shands et al., 1980) 과같은전신성감염도일으킨다. Methicillin-resistant Staphylococcus aureus (MRSA) 는 meca 유전자를획득하여 penicillin binding protein 2a (PBP2a) 를발현함으로써 methicillin 을포함한모든 β-lactam 항균제와의결합력을감소시켜내성을나타낸다 (Hartman and Tomasz, 1984). 또한 MRSA Received: February 8, 2019 / Revised: March 17, 2019 / Accepted: March 19, 2019 These authors contributed equally to this study. * Professor. Corresponding author: Kyeong-Seob Shin. Department of Laboratory Medicine, Chungbuk National University College of Medicine, Cheong-ju 28644, Korea. Tel: , Fax: , ksshin@chungbuk.ac.kr C The Korean Society for Biomedical Laboratory Sciences. All rights reserved. CC This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited
2 는 β-lactam 항균제외에도여러종류의항균제에내성을나타나게되어사용할수있는항균제가제한되기때문에 MRSA에감염된환자의유병률 (morbidity) 과사망률 (mortality) 은 methicillin-susceptible S. aureus (MSSA) 감염환자보다높다 (Cosgrove et al., 2003). 따라서혈액배양에서 MRSA의빠르고정확한검사는이들환자의적절한치료에매우중요하다. 혈액배양양성검체에서 MRSA의검출을위해자동화기기를이용한동정이나감수성검사는검사실에서가장흔히이용하는방법이지만, 이방법은 18~36 시간이상이소요되므로치료시기가늦어질수밖에없다. 한편 PCR 과같은분자유전학적방법은빠르고정확한검출이가능하지만 thermocycler 나증폭산물을검출해야하는특별한장비가필요하며경험이있는검사자가필요하다. Notomi 등 (Notomi et al., 2000) 이 Bst polymerase 에의해가닥변위핵산자가합성 (autocycling strand displacement nucleic acid amplification) 에기초한 loop-mediated isothermal amplification (LAMP) 방법을개발한이후이방법을이용한검사가다양한균의동정에이용되고있다 (Iwamoto et al., 2003; Hara- Kudo et al., 2005; Ito et al., 2006; Curtis et al., 2008; Hara-Kudo et al., 2008; Yamazaki et al., 2008). LAMP 방법은 4~6개의 primer 를이용하여 PCR 보다특이하며, 등온조건 (isothermal condition) 에서증폭하기때문에증폭시간이더빠른장점이있다. 게다가증폭산물도매우많아증폭산물을검출하는특별한방법이필요치않으며 ph 지시자 (indicator) 나형광을이용하면눈으로증폭산물의확인이가능하다 (Li et al., 2017). 이연구에서저자들은혈액배양에서 S. aureus 와 methicillin 내성을직접검출하기위해 3가지유전자를이용한다중 (multiplex) LAMP 방법을개발하였고이방법의성능을평가하고자하였다. 재료및방법대상균주충북지역한대학병원의미생물검사실에서혈액배양양성검체를대상으로하였다. 또한 16S rrna 의특이도를평가하기위해 10개의그람양성표준균주 (Staphylococcus aureus [ATCC 25923, ATCC 25913], Staphylococcus epidermidis, Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus bovis, Streptococcus pneumoniae, Streptococcus salivarius, Enterococcus faecalis, Enterococcus casseliflavus), 6개의그 람음성표준균주 (Escherichia coli, Klebsiella pneumoniae, Enterobacter cloacae, Citrobacter freundii, Pseudomonas aeruginosa, Acinetobacter baumannii), 그리고 1개의진균 (Candida albicans) 등총 17개의표준균주를이용하였다. 혈액배양및혈액배양양성균주의전처리환자로부터 10 ml의혈액을무균적으로채혈하여 BacT /ALERT SA standard aerobic bottle (biomérieux Inc., Marcy-I Étoile, France) 과 BacT/ALERT SN standard anaerobic bottle 에각각 5 ml씩넣었다. 배양은 BacT/ALERT 3D 자동혈액배양기 (biomérieux Inc., Durham, NC, USA) 에서 5일까지시행하였다. 배양양성신호가나올경우그람염색을시행한후혈액우무배지 (Blood agar plate, Asan, Korea) 및 MacConkey 우무배지 (Asan, Korea) 에계대배양하여균의동정및항균제감수성검사에이용하였다. 그람염색에서 Staphylococcus species 가관찰될경우혈액배양병에서혈액 5 ml를취하여혈청분리관 (serum separator tube) 에옮긴후 3,000 rpm에서 10분간원심분리하여상층액을버리고겔바로위에있는균침사를면봉으로 eppendorf 튜브에옮겨시험을할때까지 -20 에보관하였다. 균의동정및 methicillin 감수성검사균의동정은생화학적검사로 catalase, coagulase, mannitol 검사를포함하였고 VITEK 2 자동미생물분석기 (biomérieux Inc., Hazelwood, MO, USA) 로확인하였다. Methicillin 항생제감수성검사는 Vitek system (biomérieux) 을이용하여 oxacillin 과 cefoxitin 감수성검사를시행하였다 (CLSI, 2018). LAMP primer 의설계및최적반응조건 Staphylococcus species, S. aureus 및 methicillin 내성유전자를검출하기위해 16S rrna, fema 및 meca 유전자를 GenBank 에서검색하였고각각의염기서열을결정하였다. 이후 LAMP assay를위한 primer 설계프로그램인 Primer Explorer V5 software ( Eiken chemical Co. Ltd, Japan) 를사용하여각유전자별로 2종의외부 primer (F3와 B3), 2종의내부 primer (FIP 와 BIP) 및 2종의 loop primer (F loop primer () 와 B loop primer ()) 등총 6종의 primer 를설계하였다 (Table 1 & Fig. 1). LAMP assay 반응은 primer (FIP & BIP, 40~80 pmol; F3 & B3, 5~10 pmol; &, 20 pmol) 3 μl, genomic DNA 2 μl, WarmStart colorimetric LAMP master mix (New England Biolabs Inc., MA, USA) 5 μl를더하여최종용량을 10 μl
3 Table 1. The sequences of primers for LAMP assay used in this study Target gene Primer Sequence (5' 3') 16S rrna F3 * TGGAATTCCATGTGTAGCGG B3 * FIP BIP AGGCGGAGTGCTTAATTGC TCGCACATCAGCGTCAGTTACA-ATGCGCAGAGATATGGAGGA AGATACCCTGGTAGTCCACGCC-CACTAAGGGGCGGAAACC CCAGAAAGTCGCCTTCGCCACT AAACGATGAGTGCTAAGTGTTAGG fema F3 * CAGAATCAAAAGCTTTTGCTG B3 * FIP BIP AAGTTATCTCGCTTGTTGTG CTAAAGGTACTAACACACGGTCTTT-TCGTGATGACAAATTTTACTACA AAGAACTAAACGAAGAGCGTGAT-CAGGACGTTTTTCAATATCCTT GTAATATTTTAAGCGAT TAAAGATTTAAATAAAGCGT meca F3 * TGATGCTAAAGTTCAAAAGAGT B3 * FIP BIP GTAATCTGGAACTTGTTGACC AGGTGTGCTTACAAGTGCTAATAAT-CAACATGAAAAATGATTATGGCT TGACGTCTATCCATTTATGTATGGC-GAGGTTCTTTTTTATCTTCGGTTA TGAGGGTGGATAGCAGTACC TGAGTAACGAAGAATAT *Two outer primers F3 and B3 were also used as primers for PCR of 16S rrna, fema and meca. Abbreviations: loop-mediated isothermal amplification; FIP, forward inner primer; BIP, backward inner primer;, forward loop primer;, backward loop primer A. 16S rrna 621 TGGAATTCCATGTGTAGCGGTGAAATGCGCAGAGATATGGAGGAACACCAGTGGCGAAGGCGACTTTCTGGTCTGTAACTGACGCTGATGTGCGAAAGCGTGGGGA F3 F2 F1c TCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGAGTGCTAAGTGTTAGGGGGTTTCCGCCCCTTAGTGCTGCAGCTAACGCATTAAGCACTCCGCCT B1 B2c B3 834 B. fema 635 CAGAATCAAAAGCTTTTGCTGATCGTGATGACAAATTTTACTACAATCGCTTAAAATATTACAAAGACCGTGTGTTAGTACCTTTAGCGTATATCAACTTTGATGAATATATTA 748 F3 F2 F1c 749 AAGAACTAAACGAAGAGCGTGATATTTTAAATAAAGATTTAAATAAAGCGTTAAAGGATATTGAAAAACGTCCTGAAAATAAAAAAGCACACAACAAGCGAGATAACTT 857 B1 B2c B3 C. meca 982 ATTGATGCTAAAGTTCAAAAGAGTATTTATAACAACATGAAAAATGATTATGGCTCAGGTACTGCTATCCACCCTCAAAC AGGTGAATTATTAGCACTTGTAAGCACACCT 1092 F3 F2 F1c 1093 TCATATGACGTCTATCCATTTATGTATGGCATGAGTAACGAAGAATATA ATAAATTAACCGAAGATAAAAAAGAACCTCTGCTCAACAAGTTCCAGATTACAACTTCACCA 1204 B1 B2c B3 Fig. 1. Primers designed for 16S rrna, fema, meca loop-mediated isothermal amplification (LAMP) assays. Nucleotide sequences of 16S rrna (A), fema (B), meca (C) and the location of LAMP primers. The forward and backward inner primers are F1c-F2 and B1c-B2 sequences, respectively. The forward and backward outer primers are F3 and B3, respectively
4 A B Fig. 2. Visual (A) and agarose gel (B) images of the 16S rrna, meca, fema loop-mediated isothermal amplification (LAMP) product of MSSA and MRSA on various reaction times. The yellow color change of ph indicator was interpreted positive for amplification of DNA (A). The electrophoresis was performed at 2% agarose gel and the amplified products typically showed the ladder like shape (B). The best reaction was obtained at 64 and 50 min. Abbreviations: NEG, negative; MSSA, methicillin-susceptible Staphylococcus aureus; MRSA, methicillin-resistant Staphylococcus aureus; M, molecular size marker 로하여시행하였다. LAMP assay 의반응최적시간및온도를확인하고자다양한시험조건으로하였으며, T100 TM Thermal cycler (Bio-Rad Laboratories Inc., Foster City, CA, USA) 를이용하여증폭을한후효소활성을제거하기위해 80 에서 5분간반응시킨후종료하였다. 반응이끝난후튜브의색변화를육안으로관찰하여양성여부를판독하였고, 동시에 2% agarose gel에서전기영동을하여 LAMP assay에서특이적으로나타나는사다리모양의증폭유전자밴드를확인하여양성여부를판정하였다. LAMP, PCR 및 RT-PCR 의검출한계 MRSA 부유액 ( CFU/mL) 을 CFU/ ml까지 10배수단계희석하여각농도에서 16S rrna, fema 및 meca 에대한 LAMP 및 PCR을시행하였다. 검출한계실험은 3회씩반복실험하였다. LAMP assay 는본연구에서확립된표준조건대로시행하였으며, PCR은 F3 및 B3 primer 를이용하였으며 DNA 2 μl를 PCR kit (Enzymomics, Daegeon) 에섞어최종용 량 10 μl가되게한후시행하였다. PCR 반응은 T100 TM Thermal cycler (Bio-Rad) 를이용하여 denaturation (95 ) 30초, annealing (58 ) 30초, elongation (72 ) 60초로 35회시행하였고 72 에서 7분간최종반응을시행하였다. 증폭산물은 2% agarose gel에서전기영동하였다. 16S rrna LAMP assay 의특이도 17개의표준균주를이용하여 16S rrna LAMP assay 의특이도를평가하였다. 임상균주를이용한 LAMP assay 의성능평가혈액배양이의뢰된검체중균이증식하였고그람염색에서 Staphylococcus species 가관찰된 103개의임상검체를대상으로 Vitek 2 system 에의한균의동정그리고감수성검사를시행하였고동시에 16S rrna, fema 및 meca 에대한 multiplex LAMP assay를시행하여 2가지검사간의성능을비교하였다
5 A B Fig. 3. Visual (A) and agarose gel (B) images of the 16S rrna, meca, fema loop-mediated isothermal amplification (LAMP) product of clinical MRSA isolate at serial diluted concentration (10 1 ~ 10 7 CFU/mL). The yellow color change of ph indicator was interpreted positive for amplification of DNA (A). The electrophoresis was performed at 2% agarose gel and the amplified products typically showed the ladder like shape at 10 4 CFU/mL except faint amplification products of 16S rrna (B). Abbreviation: Neg, negative 결과 MSSA와 MRSA 균을대상으로 60~65 와 30, 40, 50, 60분의반응시간으로 LAMP assay 를시행하여 64 50분에서가장뚜렷한결과를보였으므로이후의모든실험은 64 에서 50분으로진행하였다 (Fig. 2). LAMP assay 검출민감도측정 S. aureus 를이용한 16S rrna, fema, meca gene 에대한 LAMP과 conventional PCR에대한검출민감도는 Table 2 과같았다 (Table 2 & Fig. 3). Conventional PCR은 16S rrna 에서는 10 5 CFU/mL 이상에서증폭되었고 fema와 meca 는 10 6 CFU/mL 이상에서증폭되었지만 LAMP 방법은 3개의유전자모두 10 4 CFU/mL 농도에서증폭되어 conventional PCR에비해 10~100 배민감하였다. 16S rrna LAMP assay 의특이도 17개의표준균주 ( 그람양성알균 10주, 그람음성간균 6주, Table 2. Detection limits of LAMP assay, conventional PCR for 16S rrna, fema and meca genes of Staphylococcus aureus C. albicans 1 주 ) 를대상으로한 16S rrna LAMP 검사에서 모두일치하는결과를보였다 (Table 3). 임상검체를적용한 LAMP assay 의민감도에특이도 평가 Gene Detection limit CFU/mL (copies/run) LAMP PCR 16S rrna 10 4 (20 copies) 10 5 (200 copies) fema 10 4 (20 copies) 10 6 (2,000 copies) meca 10 4 (20 copies) 10 6 (2,000 copies) Abbreviation: CFU, colony forming unit 혈액배양에서분리된 103 개의포도알균을대상으로한 16S rrna LAMP 검사에서모두양성을보였다. fema LAMP 검사는 3 개의 MSSA 를검출하지못하였으나나머 지 100 균주는정확한결과를보여생화학적동정및감
6 Table 3. Specificity of LAMP assay for detecting the 16S rrna gene of Staphylococci in reference strains Microorganisms Gram positive bacteria Reference strains Result for 16S rrna LAMP assay Staphylococcus aureus ATCC Positive Staphylococcus aureus ATCC Positive Staphylococcus epidermidis ATCC Positive Streptococcus pyogenes ATCC Negative Streptococcus agalactiae ATCC Negative Streptococcus bovis ATCC Negative Streptococcus pneumoniae ATCC Negative Streptococcus salivarius ATCC Negative Enterococcus faecalis ATCC Negative Enterococcus casseliflavus Gram negative bacteria ATCC Negative Escherichia coli ATCC Negative Klebsiella pneumoniae ATCC Negative Enterobacter cloacae ATCC Negative Citrobacter freundii ATCC 8090 Negative Pseudomoas aeruginosa ATCC Negative Acinetobacter baumannii ATCC Negative Fungus Candida albicans TIMM 3316 Negative 수성검사결과를기준으로평가한예민도와특이도는각각 95.31% (61/64) 와 100% (39/39) 이었다. meca LAMP 검사는 1개의 MRCoNS 를검출하지못하였으나나머지 102개의검체는정확한결과를보여예민도와특이도는각각 98.46% (64/65) 와 100% (38/38) 이었다 (Tables 4 & 5). 고찰전통적으로혈액배양에서 MRSA 의검출은표현형적방법 (phenotypic method) 으로균을동정하고 methicillin 감수성검사를하는것이참고방법으로되어있지만이방법은균의계대배양, 동정및감수성검사에 36시간이상소요된다. 검사시간을단축하기위해혈액배양양성검체에서직접분자유전학적검사방법또는 MALDI-TOF 등을이용하는여러검사들에대한보고들이 (Stamper et al., 2007; Stevenson et al., 2010; Clerc et al., 2014; Verroken et al., 2015) 있다. 그렇지만분자유전학적방법은 DNA의증폭및검출장비가필요하며증폭시간이 3시간이상소요되며 batch 방식으로시행해야한다. 그리고 MALDI-TOF 방법은 mass spectrophotometry 가필요하며, methicillin 내성을검출하기위해서는특별한단계가추가로필요하다 (Opota et al., 2015). 최근에소개된 LAMP 검사방법은 6~8개특이부위를인지하는 6개의 primer 를이용하여 Bst DNA 중합효소에의한 autocycling strand displacement DNA 합성을통하여적 Organisms Table 4. Results of LAMP assay for detecting fema and meca genes in 103 clinical isolates from positive blood culture Multiplex LAMP assay fema+meca+ fema+meca- fema-meca+ fema-meca- Number of clinical isolates MRSA MSSA MRCoNS MSCoNS Abbreviations: MRSA, methicillin-resistant Staphylococcus aureus; MSSA, methicillin-susceptible Staphylococcus aureus; MRCoNS, methicillin-resistant coagulase negative Staphylococci; MSCoNS, methicillin-susceptible coagulase negative Staphylococci Table 5. Sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV) of LAMP assay with fema and meca genes for detection of MRSA 103 clinical isolates from positive blood cultures Genes Sensitivity (%) Specificity (%) PPV (%) NPV (%) fema 61/64 (95.31) 39/39 (100) 61/61 (100) 38/41 (92.68) meca 64/65 (98.46) 38/38 (100) 64/64 (100) 38/39 (97.43)
7 은양의 DNA도정확하고빠르게증폭시킬수있다. 또한 60 정도의등온에서증폭하기때문에온도가변화하는데필요한시간을절약할수있으며 PCR에비해검체에의한억제효과도거의없다. 게다가증폭산물을혼탁도 (turbidity) 나색변화 (ph indicator 또는 SYBRE Green I) 를육안으로도확인할수있는장점이있다 (Li et al., 2017). 한편몇몇유전자를이용한 LAMP 검사가 S. aureus 및 MRSA를검출하는데이용되었다. spa (Misawa et al., 2007), nuc (Chen et al., 2017), fema (Xihong et al., 2013) 가 S. aureus 를검출하는데이용되었고, methicillin 내성을검출하는데 meca가이용되었다. 또한 orfx는 S. aureus 와 MRSA를검출하는데이용되기도하였다 (Su et al., 2014). 본연구에서는 16S rrna, fema 및 meca 유전자를이용한다중 LAMP 검사를이용하여혈액배양양성검체에서 Staphylococcus species, S. aureus 및 methicillin 내성을동시에검출하고자하였다. LAMP assay의검출예민도를 conventional PCR과비교한결과, Table 2과같이 LAMP assay 에서 3개의유전자에대해검출예민도는 10 4 CFU/mL (20 copies) 였다. 한편 10 4 CFU/mL 농도의 MRSA에서 fema와 meca의유전자에대한 LAMP 검사에서명확한사다리모양의증폭산물이관찰되었지만 16S rrna LAMP 검사는 10 4 CFU/mL 에서는희미하지만 3회반복실험모두에서확실하게증폭되어 3개의유전자에대한 LAMP 의검출예민도를 10 4 CFU/mL 로결정할수있었다. 결론적으로 LAMP 방법은 conventional PCR의 16S rrna는 10배, fema와 meca는 100배정도민감하였다. 이는 LAMP assay에서 strand displacement activity 가높고 DNA 손실률이적어증폭효율이높다는것을의미한다. 103개의임상검체를대상으로생화학적동정및항균제감수성시험결과와비교한 fema와 meca LAMP 방법의민감도와특이도는 Table 4와 Table 5와같다. 64개의 S. aureus 중 fema에대해음성인균이 3균주로 fema 의민감도는 95.31% (61/64) 였으며 39개의 CNS는모두 fema에음성이어서특이도는 100% 이었다. fema 음성인 S. aureus 가 3균주가존재하기때문에 S. aureus 의감별에 fema 이외에 nuc 등유전자를추가해볼필요가있을것이다. 65개의 MRSA와 MRCoNS 중 1균주를제외하고모두 meca LAMP은양성을보였고 38 MSSA와 MSCoNS 는음성을보여예민도특이도는각각 98.46% 와 100% 이었다. 위음성인 MRCoNS의경우 methicillin 내성에관여하는유전자가 meca 뿐만아니라, meca1, A2, mecb, mecc와같은 mec 유전자유사체 (homologues) 의경우통상적인 meca 증폭에의해검출되지않았을가능성이있다 (Wu et al., 2001). 한편혈액배양에서 MRSA와 non-mrsa 의감별이치료에가장중요한데, 본연구에서 fema 와 meca 를동시에검사할때 MRSA와이외의균주와감별은 100% 가능하였다 (Tables 4 & 5). LAMP assay 뿐만아니라분자검사방법의단점은혈액배양에서 MSSA 와 MRCoNS 가동시에존재하면 MRSA 의위양성 (false positive) 결과가나올수있는것이다 (Becker et al., 2006). 혈액배양에서그런경우는매우드물지만앞으로 MRSA에대한특이 marker 의개발또는보완이나 LAMP assay 이후균의배양결과를확인해야할것이다. 결론적으로위와같은분자생물학적단점에도불구하고혈액배양양성병에서 MRSA의직접검출하는데 LAMP assay의적용은 MRSA 균혈증환자의신속한치료를가능케하는데매우도움이될것으로사료된다. ACKNOWLEDGEMENT 이논문은 2018년도정부 ( 미래창조과학부 ) 의재원으로한국연구재단의지원을받아수행된기초연구사업임 (No. NRF-2018M3A9H ). CONFLICT OF INTEREST The authors have no conflicts of interest to disclose. REFERENCES Becker K, Pagnier I, Schuhen B, Wenzelburger F, Friedrich AW, Kipp F, et al. Does nasal cocolonization by methicillinresistant coagulase-negative staphylococci and methicillinsusceptible Staphylococcus aureus strains occur frequently enough to represent a risk of false-positive methicillin-esistant S. aureus determinations by molecular methods? J Clin Microbiol : Chen C, Zhao Q, Guo J, Li Y, Chen Q. Identification of methicillinresistant Staphylococcus aureus (MRSA) using simultaneous detection of meca, nuc and femb by loop-mediated isothermal amplification (LAMP). Curr Microbiol : Clerc O, Prod'hom G, Senn L, et al. Matrix-assisted laser desorption ionization time-of-flight mass spectrophotometry and PCRbased rapid diagnosis of Staphylococcus aureus bacteremia. Clin Microbial Infect : Cosgrove SE, Sakaoulas G, Perencevich EN, Schwaber MJ,
8 Karchmer AW, Carmeli Y. Comparison of mortality associated with methicillin-resistant and methicillin susceptible Staphylococcus aureus bacteremia: a meta-analysis. Clin Infect Dis : Curtis KA, Rudolph DL, Owen SM. Rapid detection of HIV-1 by reverse-transcription, lood-mediated isothermal amplification (RT-LAMP). J Virol Methods : Hara-Kudo Y, Konishi N, Ohtsuka K, Hiramatsu R, Tanaka H, Konuma H, Takatori K. Detection of verotoxigenic Escherichia coli O157 and O26 in food by plating methods and LAP method: a collaborative study. Int J Food Microbiol : Hara-Kudo Y, Yoshino M, Kojima T, Ikedo M. Loop-mediated isothermal amplification for the rapid detection of salmonella. FEMS Microbiol Lett : Hartman BJ, Tomasz A. Low-affinity penicillin-binding protein associated with beta-lactam resistance in Staphylococcus aureus. J Bacteriol : Ito M, Watanabe M, Nakagawa N, Ihara T, Okuno Y. Rapid detection and typing of influenza A and B by loop-mediated isothermal amplification: comparison with immunochromatography and virus isolation. J Virol Methods : Iwamoto T, Sonobe T, Hayashi K. Loop-mediated isothermal amplification for direct detection of Mycobacterium tuberculosis complex, M. avium, and M. intracellulare in sputum samples. J Clin Microbiol : Li Y, Fan P, Zhou S, Zhang L. Loop-mediated isothermal amplification (LAMP): a novel rapid detection platform for pathogens. Microb Pathog : Lowy FD. Staphylococcus aureus infections. N Engl J Med : Misawa Y, Yoshida A, Saito R, Yoshida H, Okuzumi K, Ito N, et al. Application of loop-mediated isothermal amplification technique to rapid and direct detection of methicillin-resistant Staphylococcus aureus (MRSA) in blood cultures. J Infect Chemother : Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, et al. Loop-mediated isothermal amplification of DNA. Nucleic Acid Res : e63. Opota O, Croxatto A, Prod'hom G, Greub G. Blood culture-based diagnosis of bacteremia: state of the art. Clin Microbiol Infect : Shands KN, Schmid G, Dan BB, Blum D, Guidotti RJ, Hargrett T, et al. Toxic-shock syndrome in menstruating womenassociation with Tampon use and Staphylococcus aureus and clinical features in 52 cases. N Engl J Med : Stamper PD, Cai M, Howard T, Speser S, Carroll KC. Clinical validation of the molecular BD geneohm staphsr assay for direct detection of Staphylococcus aureus and methicillinresistant Staphylococcus aureus in positive blood cultures. J Clin Microbiol : Su J, Liu X, Li Y, Chen D, Li Y, Yu G. Rapid and simple detection of methicillin-resistance Staphylococcus aureus by orfx loopmediated isothermal amplification assay. BMC Biotechnology : 18. Verroken A, Defourny L, Lechgar L, Magnette A, Delmee M, Glupczynski Y. Reducing time to identification of positive blood cultures with MALDI-TOF MS analysis after a 5-h subcultlure. Eur J Clin Microbiol Infect Dis : Wu SW, Lencastre H, Tomaz A. Recruitment of the meca gene homologue of Staphylococcus sciuri into a resistance deter- minant and expression of the resistance phenotype in Staphylo- coccus aureus. J Bacteriol : Xihong Z, Li Y, Park M, Wang J, Zhang Y, He X, et al. Loopmediated isothermal amplification assay targeting the fema gene for rapid detection of Staphylococcus aureus from clinical and food samples. J Microbiol Biotechnol : Yamazaki W, Seto K, Taguchi M, Ishibashi M, Inoue K. Sensitive and rapid detection of cholera toxin-producing Vibrio chol- erae using a loop-mediated isothermal amplification. BMC Microbiol : Cite this article as: Baek YH, Jo MY, Song MS, Hong SB, Shin KS. Application of Loop-Mediated Isothermal Amplification (LAMP) Assay to Rapid Detection of Methicillin-Resistant Staphylococcus aureus from Blood Cultures. Biomedical Science Letters :
( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
More informationORIGINAL ARTICLE Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist
ORIGINAL ARTICLE http://dx.doi.org/10.15263/jlmqa.2015.37.4.209 Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resistance: MicroScan versus Etest Goeun Kang, Hyun Soo Kim,
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More information316 Research in Plant Disease Vol. 21 No. 4, (Seo, 2009). Enzyme-Linked Immuno Sorbent Assay(ELISA) Reverse Transcription- Polymerase Chain Reaction(R
식물병연구 Research Article Open Access Res. Plant Dis. 21(4) : 315-320(2015) http://dx.doi.org/10.5423/rpd.2015.21.4.315 Reverse transcription Loop-mediated isothermal amplification Soybean mosaic virus Detection
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More informationMicrosoft PowerPoint - PDFCoTemp.PPT
주요유방염세균의검출및 항생제감수성검사 임숙경 1. 검사시료 1. 시료채취 유방염우유 2. 체세포수측정 3. 대상세균 - Staphylococcus aureus - Coagulase negative staphylococci -Escherichia coli 3. 균분리방법 E. coli CHEC Agar 직접도말 (37 18-24h) 보라색집락 EMB Agar
More information1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
More information단신 ISSN 일산병원학술지 2017;16(2): 혈류감염진단을위한신속한검사법비교분석 국민건강보험일산병원진단검사의학과 김영아, 이상선, 손영준 Rapid Diagnostic Tests for Bloodstream Infection Youn
단신 ISSN 2093-9272 일산병원학술지 2017;16(2):237-241 혈류감염진단을위한신속한검사법비교분석 국민건강보험일산병원진단검사의학과 김영아, 이상선, 손영준 Rapid Diagnostic Tests for Bloodstream Infection Young Ah Kim, Sang Sun Lee, Young Jun Son Department of
More information< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770>
대한임상검사학회지 : 40권제2호, 75-79, 2008 ISSN 1738-3544 대구지역병원에서분리된 Acinetobacter baumannii와 Pseudomonas aeruginosa의항생제내성현황 대구보건대학임상병리과 1, 세명대학교임상병리학과 2 김수정 1 이재식 2 Antibiotic Resistance Patterns of Acinetobacter
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More information원저 Lab Med Online Vol. 6, No. 1: 36-40, January 임상미생물학 혈액배양검체접종을위한 Previ Isola 시스템과수기법의비교평가 Evaluation
원저 Lab Med Online Vol. 6, No. 1: 36-40, January 2016 임상미생물학 혈액배양검체접종을위한 Previ Isola 시스템과수기법의비교평가 Evaluation of Automated Specimen Inoculation for Blood Culture Samples by Use of the Previ Isola System
More information2 - ceftazidime-clavulanate 디스크를이용하여 ESBL 생성균주를확인하였다. 또한 2009년도에수집된균주인 P. aeruginosa(386주 ), A. baumannii(349주 ) 를대상으로 imipenem에대한감수성을확인하였고 imipenem-h
1 - 국내종합병원을대상으로한항균제내성모니터링 Monitoring of antimicrobial resistance on general hospitals in Korea 질병관리본부국립보건연구원감염병센터약제내성과 연세대학교의과대학진단검사의학교실, 세균내성연구소 Ⅰ. 들어가는말 항균제내성세균의출현과확산으로인하여세균감염증치료는점점어려워지고있다 [1-4]. 항균제내성률은흔히국가간,
More information..........5-45..
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More information보도자료 년 5 월 16 일 ( 목 ) 조간부터보도하여주시기바랍니다. 문의 : 에너지환경표준과최철우과장, 류지영연구사 ( ) 화장품에도국제표준이...? - 화장품도이젠표준선점으로세계시장선도를 - [ 붙임 1
보도자료 http://www.motie.go.kr 2013 년 5 월 16 일 ( 목 ) 조간부터보도하여주시기바랍니다. 문의 : 에너지환경표준과최철우과장, 류지영연구사 (509-7272) 화장품에도국제표준이...? - 화장품도이젠표준선점으로세계시장선도를 - [ 붙임 1 참조 ] [ 붙임 2 참조 ] [ 붙임 3, 4 참조 ] 이보도자료와관련하여보다자세한내용이나취재를원하시면산업통상자원부기술표준원에너지환경표준과류지영연구사
More informationuntitled
ORIGINAL ARTICLE Korean J Clin Lab Sci. Vol. 45, No. 1, Mar. 2013 21 Korean J Clin Lab Sci. 2013, 45(1):21-25 ISSN 1738-3544 Errors of Antibiotic Susceptibility Testing from Automated and Manual Systems
More information01_HM hwp
The Korean Journal of Microbiology (2011) Vol. 47, No. 2, pp. 103-109 Copyright c 2011, The Microbiological Society of Korea Loop-Mediated Isothermal Amplification (LAMP) 법을이용한 Pectobacterium carotovorum
More informationuntitled
理 葉 CNFH-88-04 行 87 年 9 1 88 年 6 30 類 葉 Staphylococcus aureus Staphylococcus epidermidis Streptococcus mutans Streptococcus sanguis Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa Candida
More information- 2 -
- 1 - - 2 - - 3 - - 4 - - 5 - [ 그림 1] 산수유 [ 그림 2] 더덕 - 6 - - 7 - sample [ 그림 3] 균분리를위한접종 - 8 - PCA PCA with inoculum Slide glass [ 그림 4] Slide culture 모식도 - 9 - - 10 - Nutrient Medium Paperdisk with Antibiotics
More information<B8F1C2F72E687770>
제1장 제17장 성홍열 및 사슬알균 감염증 사슬알균 (Streptococci)은 증식 중의 특징적으로 쌍 또는 사슬모양의 그람양성 알균 으로 catalase 음성, 통성혐기성균이며, 보통 한천배지에서는 발육이 어렵고 혈액이나 혈청 등을 첨가한 배지에서 잘 발육한다. 포도당이나 다른 탄수화물을 분해하나 포도당 을 분해하여 가스를 생성하지 않는다. 이들은 최소
More informationK O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis
More information<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한
More information03(12-65)p fm
한국임상약학회지제 23 권제 1 호 Kor. J. Clin. Pharm., Vol. 23, No. 1. 2013 화상감염소아환자에서분리된주요균종에대한항생제의내성률 강주연 신혜순 * 덕성여자대학교약학대학 (2012 년 12 월 28 일접수 2013 년 3 월 2 일수정 2013 년 3 월 4 일승인 ) Antimicrobial Resistance of Clinically
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More information강정옥(원저).indd
Original Article DOI: 10.3947/ic.2011.43.3.240 Infect Chemother 2011;43(3):240-244 pissn 2093-2340 eissn 2092-6448 Infection & Chemotherapy 중심정맥도관관련혈류감염의신속한진단을위한실시간다중핵산증폭검사의유용성평가 김봉영 1* 박세우 1* 김태형 1 김지은
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More informationuntitled
Korean J Clin Microbiol Vol. 11, No. 2, October, 2008 Biocidal Effect of a Sanitizer/Disinfectant, Foodsafe, against Bacteria, Yeast, and Mycobacteria Tae Youn Choi Department of Laboratory Medicine, College
More informationMicrosoft Word - 05-김종배.doc
J. Exp. Biomed. Sci. 11 (2005) 447 453 Patterns of Antimicrobial Resistance and Detection of meca Gene from Methicillin Resistant Staphylococcus aureus Isolated from Healthcare Facilities and U.S. Military
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More informationuntitled
Korean J Clin Microbiol Vol. 14, No. 1, March, 2011 DOI: 10.5145/KJCM.2011.14.1.7 The Value of Serum Procalcitonin Level for Differentiation between Contaminants and Pathogens in Bacteremia Hei Kyung Jin
More informationuntitled
병원감염관리 : 제19권제1호 2014 Korean J Nosocomial Infect Control 2014;19(1):29-36 http://dx.doi.org/10.14192/kjnic.2014.19.1.29 원저 국내중환자실환자에서분리된세균의항균제내성 이양순 1 ㆍ김영아 2 ㆍ송원근 3 ㆍ이혁민 4 ㆍ이혜수 5 ㆍ장숙진 6 ㆍ정석훈 1 ㆍ홍성근 7 용동은
More informationDBPIA-NURIMEDIA
J Korean Soc Food Sci Nutr 한국식품영양과학회지 39(4), 595~601(2010) DOI: 10.3746/jkfn.2010.39.4.595 Multiplex Polymerase Chain Reaction(PCR) 법을이용한 Staphylococcus aureus, Salmonella enterica subsp., Vibrio parahaemolyticus
More informationuntitled
ORIGINAL ARTICLE Korean J Clin Lab Sci. 2017;49(3):279-284 https://doi.org/10.15324/kjcls.2017.49.3.279 pissn 1738-3544 eissn 2288-1662 Korean J Clin Lab Sci. Vol. 49, No. 3, September 2017 279 An Evaluation
More information<3037C1D6BCBCC0CD2E687770>
대한임상검사학회지 : 38 권제 1 호, 38-44, 2006 포도구균의 Erythromycin 유도성 Clindamycin 내성검출을위한간편한디스크확산법의유용성 서울대학교병원진단검사의학과 1, 서울대학교의과대학검사의학교실 2 주세익 1 이현 1 임규상 1 김의종 1, 2 An Easy Method of Disk Diffusion Antibiotic Susceptibility
More information<5BC0FAC0DABCF6C1A430355D434D30362D313320BEE7BAB4BCB12D E687770>
대한임상검사학회지 : 38 권제 3 호, 173-178, 2006 Multiplex Polymerase Chain Reaction 을이용한 Extended-Spectrum β-lactamase 생성 Klebsiella pneumoniae 균주의검출 진주보건대학임상병리과 양병선 Detection of Extended-Spectrum β-lactamase Producing
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More informationuntitled
Korean J Clin Microbiol Vol. 14, No. 1, March, 2011 DOI: 10.5145/KJCM.2011.14.1.1 Clinical Aspects of Bacterial Meningitis in Cerebrospinal Fluid Culture Positive Patients in a Tertiary Care University
More informationMicrosoft Word - 03-황수명.doc
Journal of Bacteriology and Virology 2011. Vol. 41, No. 3 p.157 164 http://dx.doi.org/10.4167/jbv.2011.41.3.157 Original Article Correlation Between the Prevalence of Superantigenic Toxin Genes and Coagulase
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More information식물병연구 Research Article Open Access Res. Plant Dis. 22(3): (2016) 콩황화모틀모자이크바이러스의신속검출을위한역전사등온증폭법 Rev
식물병연구 Research Article Open Access Res. Plant Dis. 22(3): 178-183 (2016) http://dx.doi.org/10.5423/rpd.2016.22.3.178 콩황화모틀모자이크바이러스의신속검출을위한역전사등온증폭법 Reverse Transcription Loop-Mediated Isothermal Amplification
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More information(59-69)Kjcm13.hwp
Korean J Clin Microbiol Vol. 10, No. 1, April, 2007 Antimicrobial Resistance of Clinically Important Bacteria Isolated from 12 Hospitals in Korea in 2005 and 2006 Hyukmin Lee 1, Chang Ki Kim 2, Jongwook
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More informationfm
Korean J. Food Sci. An. Vol. 33, No. 5, pp. 610~616(2013) DOI http://dx.doi.org/10.5851/kosfa.2013.33.5.610 ARTICLE 분유에오염된 Cronobacter sakazakii 검출을위한중합효소연쇄반응, 실시간중합효소연쇄반응, 등온검출법의비교 김영주 1 서승우 왕효우 서동주 이민화
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More informationDBPIA-NURIMEDIA
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic
More informationFlowers
Intermediate M. tuberculosis PCR 검사결과의임상적의의와결과보고 짂단검사의학과 미생물파트 김태라 차례 1. 결핵이란? 2. 결핵의미생물학적검사법소개 3. PCR ( 중합효소연쇄반응 ) 결핵짂단의문제점 4. 결론 결핵이란? 결핵은 Mycobacterium tuberculosis complex 이라는세균에의해발생하는감염병 결핵은인류역사상가장맋은생명을앗아간전염병으로기원전
More information<32382DC3BBB0A2C0E5BED6C0DA2E687770>
논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information°Ç°�°úÁúº´6-2È£
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine
More informationKJFP Jeongsook Yoon. Bacterial Strains and Antimicrobial Resistance in Burn Patients 심부화상인경우 Clostridium, Bacteroides 등을감별하기위해무산소성배양을시행해야한다고권장하고있다. 6)
KJFP Original Article http://dx.doi.org/10.21215/kjfp.2016.6.3.179 pissn 2233-9019 eissn 2233-9116 화상창 감염의 균종 및 항균제 감수성률 윤정숙* 서울베스티안병원 진단검사의학과 Bacterial Strains and Antimicrobial Resistance of Wound Infection
More informationMicrosoft PowerPoint - 3.이혁민
감염관리를위한진단검사 관동의대진단검사의학교실 부교수이혁민 검사실의원내감염관리에서역할 ( 병원 ) 감염질환진단을위한검사 지속적인감염관리자료보고 보균자및병원환경의감시배양 역학검사 세균의분류및명칭 계 (kingdom) 문 (division) 강 (class) 목 (oder) 과 (family) 속 (genus) 종 (species) 균종 주 (strain) 균주
More information주간건강과질병 제 12 권제 16 호 연구단신, Brief report 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : s
연구단신, Brief report 2 2013 2017 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : sea2sky@korea.kr, 043-719-7580 Results of healthcare-associated infection
More information< D34312D303628BEE7BAB4BCB12CC0B0B1D9B5B9292E687770>
대한임상검사학회지 : 41권제4호, 153-157, 2009 ISSN 1738-3544 SHV ESBL 생성 Klebsiella pneumoniae 균주의실시간중합효소반응분석 진주보건대학임상병리과 1, 대전보건대학임상병리과 2 양병선 1 육근돌 2 Real-Time PCR Analysis of SHV Extended-Spectrum beta-lactamases
More information원저 Lab Med Online Vol. 3, No. 3: , July 임상미생물학 중심정맥관유치암환자에서혈액배양 6 회의뢰의비효율성 Inefficiency in 6-Se
원저 Lab Med Online Vol. 3, No. 3: 155-159, July 2013 임상미생물학 중심정맥관유치암환자에서혈액배양 6 회의뢰의비효율성 Inefficiency in 6-Set Requests for Blood Culture Analysis of Cancer Patients with the Central Venous Catheter 이동현
More information2101
대한진단검사의학회지제 28 권제 3 호 2008 Korean J Lab Med 2008;28:185-90 DOI 10.3343/kjlm.2008.28.3.185 원저 임상미생물학 Escherichia coli, Klebsiella spp., Proteus mirabilis에서 Phoenix Automated Microbiology System의 Extended-Spectrum
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information원저 Lab Med Online Vol. 6, No. 4: , October 임상미생물학 임상미생물검사실업무효율증대를위한협진활용분석 Changing Guidelines f
원저 Lab Med Online Vol. 6, No. 4: 228-232, October 16 임상미생물학 임상미생물검사실업무효율증대를위한협진활용분석 Changing Guidelines for Clinical Microbiology Laboratories and Their Influences on Workflows Related to Consultations
More information???? 1
The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1
More information632 Korean J Lab Med 2010;30:631-6 있어서는장내집락화의유무를조기에검출하여사람간의전파방지및격리를해야한다. 그러므로대변에서의 VRE 선별검사는 VRE의조기검출을위한여러가지선별배지를이용하는것과최근에신속증균 PCR법을사용하는방법등이소개되고있다 [1,
Korean J Lab Med 2010;30:631-6 DOI 10.3343/kjlm.2010.30.6.631 Original Article Clinical Microbiology Evaluation of the Usefulness of Selective Chromogenic Agar Medium (ChromID VRE) and Multiplex PCR Method
More information2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285
13 2 ( 25 ) 2004 12 Korean J Med Hist 13 284 296 Dec 2004 ISSN 1225 505X 1) * ** ** 1 1920 1930 40 ( 1896-1973) 80 * ** 1) 2003 284 2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914
More informationViridans Streptococci 균혈증 247 나이며, 이는류마티스성열, 승모판탈출, 선천성결손, 인공판막등으로인한심장판막손상이나결손이있는사람에서주로발생한다 [4]. 최근에는혈액종양이나고형암또는골수이식등의치료에사용된항암제에따른심각한호중구감소증, 구강점막의궤양등과
대한진단검사의학회지 : 제 23 권제 4 호 2003 Korean J Lab Med 2003; 23: 246-50 임상미생물학 Viridans Streptococci 균혈증의임상적의의 조은해 이남용 성균관대학교의과대학삼성서울병원진단검사의학교실 Clinical Significance of Viridans Streptococcal Bacteremia Eun Hae
More information°Ç°�°úÁúº´5-44È£ÃÖÁ¾
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis
More information(2005\263\342\271\351\274\255_final.hwp)
제 2 절 식 의약품 종합정보서비스 243 제1장 평 가 분 야 제1절 식품규격평가 분야 제2절 식품안전평가 분야 제3절 의약품평가 분야 제4절 생약평가 분야 제5절 생물의약품평가 분야 제6절 의료기기평가 분야 제 1 절 식품규격평가 분야 245 제1장 평가분야 제1절 식품규격평가 분야 제1 항 식품의 기준 규격 1. 식품공전 식품의 기준 규격은 식품위생법
More information(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016) ISSN 228
(JBE Vol. 1, No. 1, January 016) (Regular Paper) 1 1, 016 1 (JBE Vol. 1, No. 1, January 016) http://dx.doi.org/10.5909/jbe.016.1.1.60 ISSN 87-9137 (Online) ISSN 16-7953 (Print) a), a) An Efficient Method
More information???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun
More informationuntitled
대한내과학회지 : 제 72 권제 1 호 27 Streptococcus pneumoniae와 Haemophilus influenzae 임상분리주에대한 Cefditoren의시험관내항균력 인제대학교의과대학일산백병원감염내과, 울산대학교의과대학서울아산병원감염내과 2, 울산대학교항균제내성ㆍ미생물유전학연구센터 3 곽이경 추은주 2, 3 박수진 3 이정은 3 정진용 2,
More information< D34312D303328C0CCC7F62CC0CCB4F6C8F12CC1D6BCBCC0CD2CB1E8C0C7C1BE292E687770>
대한임상검사학회지 : 41권제2호, 52-56, 2009 ISSN 1738-3544 당뇨병환자의연조직염에서분리된 Arcanobacterium haemolyticum 1 예 서울대학교병원진단검사의학과 이현 1 이덕희 1 주세익 1 김의종 1,2 A Case Report of Arcanobacterium haemolyticum Isolated from Diabetic
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More informationuntitled
154 Chae-Won Lim and Jin-Gak Kim. A Study on the Risk of Occupational Infectious Disease of Police Scientific Investigator ORIGINAL ARTICLE Korean J Clin Lab Sci. 2013, 45(4):154-158 pissn 1738-3544 eissn
More information(....).hwp
연구기관 한국식품연구원 농림부 연구기관 한국식품연구원 농림부 Analytical Semi-preparative Solution A 1) Solution B 2) Mixing Spreading Coating medium Corona treated OPP 3) film Casting Drying
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More informationMicrosoft Word - 2-황수명.doc
Journal of Bacteriology and Virology 2009. Vol. 39, No. 2 p.71 78 DOI 10.4167/jbv.2009.39.2.71 Correlation Between Staphylococcal Cassette Chromosome mec Type and Coagulase Serotype of Methicillin-Resistant
More information목차 Ⅰ. 개요 1 Ⅱ. 용어의정의 4 Ⅲ. 관련규정 13 Ⅳ. 신청서기재항목및기술문서제출자료 14 Ⅴ. 제조 수입허가신청서기재항목 15
체외진단용의료기기 ( 인플루엔자바이러스및 A형간염바이러스 ) 의허가 심사가이드라인 2015. 2. 의료기기심사부체외진단기기과 - 1 - 목차 Ⅰ. 개요 1 Ⅱ. 용어의정의 4 Ⅲ. 관련규정 13 Ⅳ. 신청서기재항목및기술문서제출자료 14 Ⅴ. 제조 수입허가신청서기재항목 15 Ⅵ. 기술문서등의심사를위한제출자료 37 Ⅶ. 성능시험에대한상세사항 44 Ⅷ. 참고문헌
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More informationAutomated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets
PCR FlashGel System 2013. 04. 24 PCR 2013. 04. 24 순서 1. PCR 이란 2. PCR 실험의기본조건 3. PCR 효소선택가이드 4. Hot Start PCR의원리 5. PCR 실험시 Troubleshooting 6. PCR 장비 _TP350 소개 PCR(Polymerase Chain Reaction) PCR 이란? -
More information2107
대한진단검사의학회지제 28 권제 4 호 2008 Korean J Lab Med 2008;28:286-92 DOI 10.3343/kjlm.2008.28.4.286 원저 임상미생물학 혈액에서분리된 Staphylococcus aureus 의 Coagulase 유전자의다형성과독소유전자에의한유전형분석 김용균 김재석 김한성 송원근 조현찬 이규만 한림대학교의과대학진단검사의학교실
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More informationECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 16 Jul.; 27(7), 64662. http://dx.doi.org/./kjkiees.16.27.7.646 ISSN 1226-3133 (Print)ISSN 2288-226 (Online) 2D Microwave Image
More informationMicrosoft Word doc
1994-2003 년혈액배양에서분리된병원균및세균의항균제감수성 연세대학교대학원 의학과 고은미 1994-2003 년혈액배양에서분리된병원균및세균의항균제감수성 지도교수이경원 이논문을석사학위논문으로제출함 2006 년 12 월일 연세대학교대학원의학과고은미 고은미의석사학위논문을인준함 심사위원 인 심사위원 인 심사위원 인 연세대학교대학원 2006 년 12 월일 감사의글 본눈문을완성함에있어서많은지도편달과가르침을주신이경원교수님과바쁘신중에도따뜻하게지도하여주신김준명교수님과이경호교수님께도깊은감사를드립니다.
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More information( ) 이남용.hwp
임상검사와정도관리 : 제 32 권제 12 호 2010 J Lab Med Qual Assur 2010; 32:11-24 11 임상미생물학검사신빙도조사결과보고 (2009) 이남용 ( 집필대표 ) 김명숙 김미나 김민중 김선주 김성일 김의종 김재석 용동은 윤남섭 이장호 주세익 대한임상검사정도관리협회임상미생물학분과위원회 Annual Report on External
More information고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn
TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna
More information<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
More information한수지 52(2), , 2019 Note Korean J Fish Aquat Sci 52(2), ,2019 국내유통김 (Porphyra sp.) 의미생물오염도평가 노보영 황선혜 1 조용선 1 * 한국식품연구원식품표준센터, 1 한국식품연구원식품분석
한수지 52(2), 80-84, 209 Note Korean J Fish Aquat Sci 52(2),80-84,209 국내유통김 (Porphyra sp.) 의미생물오염도평가 노보영 황선혜 조용선 * 한국식품연구원식품표준센터, 한국식품연구원식품분석센터 Microbial Contamination Levels in Porphyra sp. Distributed in
More information1508 고려 카달록
트레이용난연케이블의특징 0./1kV XLPE Insulated and Tray FlameRetardant PVC ed Cable (TFRCV) 0./1kV XLPE Insulated and Tray FlameRetardant PVC ed Aluminium Power Cable (TFRCV/AL) 0./1kV XLPE Insulated HalogenFree Flame
More information<5B313132385D32303039B3E220C1A634B1C720C1A632C8A320B3EDB9AEC1F628C3D6C1BE292E687770>
디지털 영상에서의 자막추출을 이용한 자막 특성 분석에 관한 연구 이세열 * 요약 본 연구는 방송 프로그램 제작에 있어서 중요한 역할을 담당하고 있는 영상 자막의 특성과 영상 커 뮤니케이션 기능적인 관점에서 나타나고 있는 현상을 살펴본다. 다양한 방송 프로그램에서 활용되고 있는 디지털 영상 자막의 기능은 단순하게 간략한 정보를 전달하는 기능적인 역할을 수행하였다.
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Feb.; 29(2), 93 98. http://dx.doi.org/10.5515/kjkiees.2018.29.2.93 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) UHF-HF
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education
More information