Microsoft Word - 05-김종배.doc
|
|
- 뢰하 연
- 4 years ago
- Views:
Transcription
1 J. Exp. Biomed. Sci. 11 (2005) Patterns of Antimicrobial Resistance and Detection of meca Gene from Methicillin Resistant Staphylococcus aureus Isolated from Healthcare Facilities and U.S. Military Hospital in Korea Chin-Su Sin 1, Gyu-Sang Lee 2, Kwan-Hun Lim 2 and Jong-Bae Kim 1,2 1 Department of Biomedical Laboratory Science, Graduate School of Health and Environment, 2 College of Health Science, Yonsei University, Wonju , Korea A total of 108 strains of MRSA (Methicillin-resistant Staphylococcus aureus) clinical isolates was collected from 121 st general hospital (U.S. military hospital), Korean healthcare facility from January to March in 2005 and Wonju Christian hospital in Antimicrobial susceptibility test by Vitek System and MIC test using oxacillin and cephalothin stripes by E-test were executed. PCR based detection of meca gene was performed on the all of MRSA clinical isolates, too. MRSA clinical isolates were characterized with antimicrobial resistance patterns, PCR based detection of meca gene and validation of the multiplex PCR strategy of SCCmec among clinical isolates. Key Words: MRSA, VITEK, E-test, MIC, meca, PCR, SCCmec 서 Methicillin-resistant Staphylococcus aureus (MRSA) 는 1961 년처음으로영국에서분리된이래현재는전세계에널리분포하고있으며, 원내감염의집단적발생뿐만아니라지역사회감염에서도그원인균으로분리되는빈도가증가하여문제가되고있다. 현재임상에서분리되는황색포도구균의 90% 이상은 penicillin에내성균주며 methicillin 내성균주의비율은나날이증가하고있다 (Kim et al., 1997, Hanssen et al., 2004, Ko et al., 2005). 미국의경우병원내에서분리되는전체황색포도구균 (Staphylococcus aureus) 중에서 methicillin 내성균주가차지하는비율은 1975년당시 2.4% 에불과하였으나 1999년에는 50% 이상으로급격히증가하였다 (Sakoulas et al., 2001; Matsumura et al,. 2002; Coombs et al., 2004; Shukla et al., 2004). 국내사정도마찬가지여서 1970년대에 5% 정도를차지하던 MRSA 비율이 80년대부터급격히증가하였고 1996년전국병원감염률조사연구에서병원에서분리되는황색포도구균중 methicillin 내성균주가차지하는비율은 83.7% 나타났다 (Lee et al., 1996; Chong et al., 1997; * 논문접수 : 2005 년 11 월 3 일수정재접수 : 2005 년 11 월 29 일 교신저자 : 김종배, ( 우 ) 강원도원주시흥업면매지리 234, 연세대학교보건과학대학임상병리학과 Tel: , Fax: kimjb@dragon.yonsei.ac.kr 론 Woo et al., 2000; Lee et al., 2001; Ko et al., 2005). 최근에는지역사회에서분리되는 MRSA 내성비율도점차증가하고있는실정이다 (Coombs et al., 2004; Shukla et al., 2004; Lu et al., 2005). MRSA 균주가증가하면서감염증또한심각한문제로대두되고있다. 특히병원내감염에서문제가되는데미국의자료에의하면 MRSA에의한병원내감염이 25% 에달하는것으로보고되었다. 국내의경우 1996년실시된병원감염률에대한연구에서 MRSA 균이원인균의 14.4% 를차지하였으며점차증가하는추세이다 (Lee et al., 1996, Lim et al., 1997, Sakoulas et al., 2001, Campbell et al., 2004, Ko et al., 2005). 한편유럽각국의 MRSA의비율은스칸디나비아지역은 1% 미만, 스페인, 프랑스, 이탈리아등지에서는 30% 로지역과국가에따라많은차이가있지만, 평균 12.8% 의높은비율로보고되어있다 (Felten et al., 2002; Robinson et al., 2003; Hanssen et al., 2004, 2005; Nathalie van der Mee-Marquet et al., 2004). 우리나라의경우대부분의대학병원과종합병원에서분리되는 MRSA는병원내감염중창상감염, 폐렴, 균혈증등의주요원인균으로작용하며, 전체병원감염원인균의 50% 내외를차지한다. 현재임상에서분리되는황색포도구균의 90% 이상은 penicillin 내성균주며 methicillin 내성균주인 MRSA 균은 beta-lactams, aminoglycosides, macrolides와같은많은항생제에내성을나타내며소수의항생제만이치료에유용하므로임상분리 Staphylococcus aureus 중에서 methicillin
2 내성여부의신속한검출과동정이필요하다. 그러나 methicillin 내성의발현은배지의온도, 염농도같은성장조건에영향을많이받으므로보통의항생제감수성검사로는판정이부정확한경우가많아문제점으로지적되고있다 (Hanssen et al., 2004; Ko et al., 2005). MRSA 균의 beta-lactam제에대한내성기전은 beta-lactam 계열항생제에대한친화성이낮은 penicillin-binding protein 2' (PBP2') 의유도생산에의한것으로써이단백질을 code하고있는것이 meca 유전자로밝혀졌다 (Hanssen et al., 2004). 한편 pbp-2a의발현을조절하는기능을나타내는조절유전자인 meci과 mecri 유전자가 meca 유전자의상부에존재하는것이밝혀졌으며이들조절유전자는각각 meca 발현억제단백을합성하는유전정보를지니고있다. 한편 mecri 유전자는세포내신호전달에관여하는 5' 말단부위와 penicillin 결함에관여하는 3' 말단부위로구성되어있음이밝혀졌다 (Coombs et al., 2004). 본연구에서는국내대학병원과국내에주둔하고있는미8군소속 121병원에서분리된 MRSA를대상으로항균제감수성양상에의한표현형및내성관련유전자인 meca에대한 PCR 반응으로유전형을비교분석하였다. 이러한연구를통해국내병원과미국인대상병원에서분리된 MRSA의항생제내성유형과분자생물학적인특성을분석비교함으로써유전형의분포와다양성을알아보고 1999년도강원도원주기독병원에서분리되었던 MRSA 38주를대상으로연도별항생제내성유형과이에따른분자생물학적인특성을비교하여포도상구균의항생제내성의변화형태를알아보고자하였다. 재료및방법 1. 임상검체로부터황색포도상구균 (S. aureus) 의분리 2004년 1월부터 2004년 3월까지서울에주둔하고있는미육군병원 121 st General Hospital과국내의서울과부산지역병원진단의학과 (Korean Healthcare Facility) 의가검물에서분리한 MRSA 임상분리균주각각 30주와 42주 ( 서울 17주, 부산 25주 ) 및 1999년강원도원주시에소재한원주기독병원에서분리된 MRSA 38주를사용하였다. 본실험에사용한 MRSA 균주가분리된가검물의내용은 Table 1과같다. 임상분리균주는 5% 면양혈액이포함된혈액배지에배양하고균주의동정은고전적인방법과 VITEK (Vitek System, Hazelwood Inc., U.S.A) GPI를사용하였다. 본실험에사용한 MRSA 균주는모두 catalase 검사및 coagulase 검사에서 (BD, BBL, Staphyloslide Latex Test) 양성결과를나타내었으며, 이들공시균주를 mannitol salt agar (MSA) 에도말후배양하였다. 2. 감수성실험항생제내성유형을파악하기위한항생제감수성실험은 VITEK System에의한최소억제농도 (minimum inhibitory concentration; MIC) 를이용하였다. 실험방법으로는실험균주를혈액배지에서 37, 18시간배양한후단일집락을백금이로취하여멸균된 0.45% 생리식염수 1.8 ml에부유한후, VITEK colorimeter에서최종탁도를 0.5 McFarland barium sulfate turbidity standard에맞추고교반기로 2~3초동안교반한다음이부유액을취하여 VITEK GPS card와 susceptibility card에접종하였다. 그리고 VITEK system에서요구하는방법및기준에따라 MIC를측정하였다. MIC에측정은 ampicillin, ampicillin/sulbactam, cefazolin, ciprofloxacin, erythromycin, gentamicin, nitrofrantoin, oxacillin, penicillin-g, clindamycin, tetracycline, vancomycin, trimethoprim/sulfamethoxazole 등의항균물질을사용하였다. 항균제감수성검사를위한표준균주로는 S. aureus ATCC 43300, S. aureus ATCC 및 Escherichia coli ATCC 25922를사용하였다. 한편 Oxacillin과 cephalothin strip (AB Biodisk, Solna, Sweden) 을이용하여 CLSI (Clinical laboratory standard institute) guideline에따라 Muller-Hinton agar에공시균주를고루도말하여배지양쪽에 oxacillin과 cephalothin strip를올려놓고 37 에서 18시간배양한후형성된증식억제대에해당하는 MIC를판정하였다. 감수성검사를위한표준균주는 VITEK system에서사용된표준균주와동일한균주들을사용하였다. 3. DNA 추출및정제세균의 genomic DNA를얻기위해서세균을 brain heart infusion (Difco, MI, U.S.A.) broth 4 ml에접종하여호기성상태로 37 에서 24시간배양하였다. 배양액을 Eppendorf tube 에 1.5 ml씩분주하고 12,000 rpm으로 10분간원침시킨후침전된 bacterial pellet을 DNA isolation kit (QIAamp DNA Mini Kit, QIAGEN Inc., Chatsworth, U.S.A.) 를사용하여 genomic DNA를추출, 정제하였다. 정제한 DNA의농도는 260/ 280 nm에서흡광도를측정하여계산하였다. 4. meca 유전자의중합효소연쇄반응 VITEK system을통하여확인된 MRSA 균주의 meca gene 에특이적인 oligonucleotide를고안하였다. NCBI (National Center for Biotechnology Information) web site ( nlm.nih.gov/) 를통해서 meca의 sequence를수집하고, 이를대상으로 meca sequence에대하여 multiple sequence alignment를시행하였다. 이결과를바탕으로 Primer 3 program ( 을이용하여 meca-f, meca-r의 PCR primer를고안하고주문제작 (Bionee Co. Daejeon, Korea) 하
3 Antimicrobial agents Table 1. Antimicrobial resistance patterns of MRSA clinical isolates by VITEK system Healthcare facility 121 st KHF Wonju Number of isolates AMP, AMS, CZ, OX, PEN AMP, AMS, CZ, OX, PEN, ERY AMP, AMS, CZ, OX, PEN, ERY, CC 3 3 AMP, AMS, CZ, OX, PEN, CIP 2 2 AMP, AMS, CZ, OX, PEN, ERY, CIP 1 1 AMP, AMS, CZ, OX, PEN, TET 1 1 AMP, AMS, CZ, OX, PEN, TET, ERY, GEN, CIP 2 2 AMP, AMS, CZ, OX, PEN, TET, ERY, GEN, CIP, CC AMP, AMS, CZ, OX, PEN, TET, ERY, GEN, CIP, CC, SXT AMP, AMS, CZ, OX, PEN, TET, GEN, CIP, CC, SXT 4 4 AMP, AMS, CZ, OX, PEN, TET, GEN, CIP, SXT 1 1 AMP, AMS, CZ, OX, PEN, TET, CIP, SXT 1 1 AMP, AMS, CZ, OX, PEN, GEN, TET 2 2 AMP, AMS, CZ, OX, PEN, GEN, TET, ERY 1 1 AMP, AMS, CZ, OX, PEN, GEN, TET, CC 3 3 AMP, AMS, CZ, OX, PEN, GEN, TET, ERY, CC, CIP AMP, AMS, CZ, OX, PEN, GEN, TET, ERY, CIP 2 2 AMP, AMS, CZ, OX, PEN, TET, ERY, CIP 5 5 Total Abbreviations. AMP; ampicillin, AMS; ampicillin/sulbactam, CC; clindamycin, CIP; ciprofloxacilin, CZ; cefazolin, ERY; erythromycin, GEN; gentamicin, OX; oxacillin, PEN; penicillin, SXT; trimethoprim/sulfamethoxazole, TET; tetracycline 여본실험에사용하였다. 본실험에서고안한 primer와 Oliveira et al. (2005) 이고안한 primer (Table 4) 에대한민감도시험을시행하였다. 중합효소연쇄반응은 AccuPower PCR PreMix (Bioneer. Co. Daejeon, Korea) 를사용하여주형 DNA 농도를최초 30 ng으로시작하여 10 배씩순차적으로최종농도가 0.3 pg이되도록희석하여각각의주형 DNA 2 µl를첨가하고각각의 primer set를 20 pmole/µl를최종농도가 2 pmol이되도록넣은후멸균증류수로최종반응양이 20 µl이되도록하여 thermal cycler (GeneAmp PCR System 2700, Perkin-Elmer Cetus, Boston, MA, U.S.A.) 를사용하여 DNA의증폭을시도하였다. MECA-F, R primer는 47 에서 annealing 을실시하였다 (Oliveira et al., 2005). 반응이종료된후 0.5 µg/ml의 ethidium bromide를첨가한 1.5% agarose gel에전기영동하여 ultraviolet trans-illuminator (Vilber Louramat, Mame La Valle, France) 로각각의증폭산물들을비교관찰하였다. meca gene을검출하기위한중합효소연쇄반응은 meca-f, meca-r의 PCR primer를사용하여민감도시험과같은방법으로시행하였다. 결과 1. 황색포도상구균 (S. aureus) 의분리본실험에사용한모든균주는 catalase 검사와 coagulase 검사에서모두양성을나타냈으며, Mannitol salt agar (MSA) 에서배양한결과 mannitol을분해하여산을생성하는과정에서 ph indicator인 phenol red에의해노란색집락을나타내었다. 2. 항생제감수성검사결과비교분석 Vitek 자동분석기를사용한각각의항생제에대한 MIC를측정한결과모든임상분리균주들이 ampicillin, penicillin, ampicillin/sulbactam 그리고 oxacillin에대해내성을나타냈으며, nitrofurantoin과 vancomycin 에는모두감수성을나타내었다 (Table 1). 121 st General Hospital에서분리된 30주의 MRSA 균주들은 tetracycline, gentamicin, rifampin, trimethoprim/sulfamethoxazole 에감수성을나타내었으며, ciprofloxacin, clindamycin, erythromycin에각각 13%, 10%, 그리고 55% 의내성을나타내었다. 서울지역병원에서분리된 MRSA 균주들은 tetracycline, gen
4 Table 2. MIC of MRSA clinical isolates by E-test Healthcare facilities Antibiotics MIC (Minimum inhibitory concentration) >4 >8 >16 >32 >64 >128 >256 oxacillin st cephalothin Number of isolates 30 KHF Wonju oxacillin cephalothin oxacillin cephalothin Total 83 Table 3. Oligonucleotide sequences used for amplification in this study Oligonucleotide Sequence (5' to 3') Tm ( ) Expected size (bp) of PCR product meca-f GGTGAAGTAGAAATGACTGA meca-r CTCATATGCTGTTCCTGTAT MECA-F* TCCAGATTACAACTTCACCAGG MECA-R* CCACTTCATATCTTGTAACGCG *Oliveira et al. (2005) tamicin, ciprofloxacin, clindamicin에모든균주들이내성률을나타냈으며, erythromycin에서는 94% (16균주), rifampin에서 17% (3균주), trimethoprim/sulfamethoxazole에서는 58% (10균주 ) 의균주가내성을나타내었다. 또한같은기간부산지역병원에서분리된 MRSA 균주들의내성률은 tetracycline에서 64% (16균주), gentamicin에서 60% (15균주), rifampin에서 4% (1균주), trimethoprim/sulfamethoxazole에서 20% (5균주), erythromycin에서 72% (18균주), clindamycin에서 56% (14균주 ), ciprofloxacin에서 68% (17균주) 의내성을보였다. 한편 1999년원주에서분리된 MRSA 균주들은 tetracycline에대부분 (98%) 감수성을나타내었으며 trimethoprim/sulfamethoxazole에서는모두감수성을나타내었다. 또한 gentamicin, ciprofloxacin, clindamycin, erythromycin, rifampin에서는각각 75%, 93%, 90%, 95%, 그리고 5% 의내성률을나타내었다 (Table 2). 121 st General Hospital에서분리된 30주와한국병원에서분리된 17주, 그리고원주기독병원에서분리된 36주를 oxacillin과 cephalothin strip를사용하여 MRSA 분리주들에대한 MIC를비교하였다. 121 st General Hospital에서분리된 MRSA 균주에서는대부분의균주가 oxacillin에대한 MIC가 8 µg/ ml 이하인반면, 한국병원과원주기독병원에서분리된균주에서는모든균주들이 256 µg/ml 이상의강한내성을보였다. 또한 cephalothin에서는 121 st General Hospital 분리균주 30균주중 27개의분리균주가 4 µg/ml 이하의내성을나타낸반면한국병원에서분리된균주들은대부분 64 µg/ml 이하의내성을나타냈다. 이로서 121병원과국내병원에서분리 된균주간에는내성도의현저한차이를볼수있었다. 반면 1999년원주기독병원과 2004년도에한국병원에서분리된 MRSA 균들의내성도는 oxacillin 약제에서는모두가 256 µg/ ml 이상의강한내성을보였고 cephalothin에서는 64 µg/ml 이상의내성을보였다. 1999년과 2004년도에분리된균주들의내성률을비교하여본결과 oxacillin에서는모두 256 µg/ ml 이상의강한내성을보여주었으나, cephalothin에서는 2005년도에분리주중약 80% 의균주가 128 µg/ml 이상의내성을나타내었으며, 1999년도에는 58% 가 128 µg/ml에내성을나타내었다 (Table 2). 3. 중합효소연쇄반응에사용된 PCR primer 의민감도시험 MRSA의 meca gene을검출하기위해고안된 PCR primer 와 Oliveira et al. (2005) 이사용한 PCR primer들을 (Table 3) 비교해본결과이번실험에서새롭게고안한 primer는 3 pg DNA에서도양성반응을나타내었으나기존에사용되었던 primer는 30 pg DNA에서양성으로나타났다. 따라서본실험에서고안한 meca primer set가기존의 Oliveira et al. (2005) 이사용한 primer에비하여 10배이상 meca 유전자검출에민감한것으로나타났다 (Fig. 1). 4. 중합효소반응을이용한 meca 유전자검출이번실험에서고안한 primer를사용하여중합효소연쇄반응을시행한결과양성대조군으로사용된 S. aureus ATCC 43300과 108균주의임상분리균주에서 meca gene primer를
5 Fig. 1. Sensitivity test for PCR amplification of meca gene. Left; primer designed for this study (meca-f, R), right; primer used in reference (MECA-F, R) lane M; 100 bp DNA ladder (Takara), lane N; negative control, lane 1; template DNA (S. aureus ATCC 43300; 30 ng), lane 2~6; ten-fold serial dilution of template DNA. Fig. 2. PCR amplification of meca gene for MRSA clinical isolates. Lane M; 100 bp DNA ladder (Takara Bio Inc, Japan), lane P; positive control (S. aureus ATCC 43300), lane 1~14; MRSA clinical isolates, lane N; netative control. 사용한 PCR에서예상하였던 339 bp의 PCR 산물이검출되었다 (Fig. 2). 고 1959년 methicillin이 penicillin resistant Staphylococcus auresus 감염증에사용된이래 1961년에영국에서 MRSA가임상검체에서처음으로발견된이래유럽을비롯하여전세계적으로 MRSA는중요한병원감염의중요한원인균이되고있다. 본연구에서는국내에주둔하고있는미군들의임상가검물에서분리된 MRSA 균주와국내병원환자들의가검물에서분리된 MRSA 임상분리균주들간의항생물질에대한내성을비교분석하였으며 MRSA를유발하는 meca gene의검출을시도하였다. 2005년 1월부터 4월까지서울에소재한미8군소속 121 st General Hospital laboratory에서분리한 30주의 MRSA 임상분리균주와국내병원 (Korean health facility, KHF) 에서분리한 42주의 MRSA 임상분리균주, 그리고 1999년강원도원주시소재의원주기독병원에서분리한 36주의 MRSA 임상분리균주를대상으로하였다. 연구결과 2005년 121 st General Hospital에서분리한 MRSA 임상분리균주들이 tetracycline, gentamicin, trimethoprim/sulfamethoxazole에모두감수성을나타내었으며서울지역에서분리한모든 MRSA 임상분리균주들은모두내성을나타낸것은 MRSA 임상분리균주들간의내성도의차이가확연하게 찰 다른것으로나타났다. 그리고 clindamycin과 ciprofloxacin의경우 121 st General Hospital에서분리한 MRSA 임상분리균주들은약 10% 이하의내성률을나타내고있으나서울지역병원에서분리한 MRSA 임상분리균주들은 100% 의내성을나타내고있다. 또한서울지역병원에서분리된 MRSA 임상분리균주들이같은시기부산에서분리된 MRSA 임상분리균주들에비해항균제에대한내성도가약 10~40% 정도로강한내성도를나타내고있다. 1999년도원주에서분리된 MRSA 임상분리균주들이 2005년도부산지역에서분리된 MRSA 임상분리균주들에비해 5~20% 정도의강한내성을나타낸반면 trimethoprim/sulfamethoxazole와 tetracycline에서는모두감수성, 그리고 2% 의내성률을나타내었다. 본연구의결과로시기에따른항생제의내성도와지역적인차이에따라부산과서울그리고국내에거주하는외국인에서분리한 MRSA 임상분리균주들에대하여항생제에따라내성도의차이를알수있었다. 이러한 MRSA 임상분리균주의항생제에대한내성도의지역별차이는국내에서의항균물질남용의결과항생제에대한내성률이심각한상황에이르고있음을의미한다고할수있다. 미국의경우병원내에서 200만명의환자들이감염되고있으며이감염의 60% 는내성세균에의한감염으로그중 40% 는 MRSA에의한것으로알려져있다. MRSA 감염은 1998년에 12% 이던것이 2003년에는 43% 로증가되었으며 Ko et al. (2005) 에의하면 MRSA 임상분리균주는 ciprofloxacin에 14%, clindamycin에 3%, tetracycline에 3%, 그리고 trimethoprim/sulfamethoxazol에 1% 의내성률을나타내었으며 vancomycin, gentamicin, nitrofurantoin, 그리고 rifampin에는전부감수성임을보고한바있다. 그리고미국내의군인지역병원의외래환자에서분리된 MRSA 임상분리균주들중 91% 는 erythromycin에내성임을보고한바있으나본연구에서는 55% 의내성률을나타낸것은병원입원환자와외래환자의모든검체를대상으로차이를보인것으로사료되며, ciprofloxacin, tetracycline, gentamicin, rifampin, 그리고 clindamycin 내성률은약간의미세한차이를보일뿐이다. E-test를이용한 MIC 측정에서는 121 st General Hospital에
6 서분리한 MRSA 임상분리균주에서는대부분의균주가 oxacillin의경우 MIC가 8 µg/ml 이하인반면, 국내병원들과원주기독병원에서분리한 MRSA 임상분리균주에서는모두 256 µg/ml 이상에서강한내성을나타내었으므로집단간의 MRSA 임상분리균주들의내성도의차이를알아볼수있었다. 그리고 cephalothin의경우는 121 st General Hospital 31주중 27주의 MRSA 임상분리균주의 MIC가 4 µg/ml 이하의내성을나타낸반면국내병원들에서는대부분의 MRSA 임상분리균주의 MIC가 64 µg/ml의내성을보여주었다. 이결과로서 121 st General Hospital과국내병원들에서분리한 MRSA 임상분리균주들간에는 oxacillin에대한내성도의차이를볼수있었다. 연도별국내병원들간의 MRSA 분리균주의경우 2005년도에분리한균주들과 1999년원주에서분리한 MRSA 임상분리균주들의내성도의변화는 oxacillin의경우모두가 MIC가 256 µg/ml 이상의강한내성을보이므로여전히강한내성률을나타내고있었으며, cephalothin에경우 1999년도에원주지역에서분리한 MRSA 임상분리균주에비해 2005년도에분리한 MRSA 임상분리균주에서내성률이높아진것으로나타났다. 분자생물학적검출방법인중합효소연쇄반응을시행하여총 108주의 MRSA 임상분리균주에서모든임상분리균주들이 meca 유전자가검출되어 MRSA 임상분리균주가 meca gene을가지는것으로사료된다. 결론적으로보아 3개의집단에서분류된 MRSA 임상분리균주를대상으로 VITEK system과 E-test를통하여시행한항생제에대한 MIC 결과는 121 st General Hospital에서분리한 MRSA 임상분리균주들과국내병원들에서분리한 MRSA 임상분리균주들과의항생제들간의내성률의큰차이점을발견함으로국내에서분리한 MRSA 임상분리균주는항생제에대한내성률이매우높은것으로나타났다. REFERENCES Campbell KM, Vaughn AF, Russell KL, Smith B, Jimenez DL, Barrozo CP, Minarcik JR, Crum NF, Ryan MA. Risk Factors for Community-Associated Methicillin-Resistant Staphylococcus aureus Infections in an Outbreak of Disease among Military Trainees in San Digo, California, in J Clin Microbiol : Chong YS, Lee KW, Shin JW, Shin HB, Lim JB. Active of Arbekacin Against Methicillin-resistant Staphylococcus aureus and Pseudomonas aeruginosa. J Infect Chemother : Coombs GW, Nimmo GR, Bell JM, Huygens F, O'Brien FG, Malkowski MJ. Pearson JC, Stephens AJ, Giffard PM. Genetic diversity among Community Methicillin-Resistant Staphylococcus aureus Strains Causing Outpatient Infections in Australia. J Clin Microbiol : Felten A, Grandry B, Lagrange PH, Casin I. Evaluation of Three Techniques for Detection of Low-Level Methicillin-Resistant Staphylococcus aureus (MRSA): a Disk diffusion Method with Cefoxitin and Moxalactam, the Vitek 2 System, and the MRSA-Screen Latex Agglution Test, J Clin Microbiol : Hanssen AM, Fossum A, Mikalsen J, Halvorsen DS, Bukholm G, Sollid JUE. Zissemination of Community-Acquired Methicillin-Resistant Staphylococcus aureus Clones in Northern Norway: Sequence Type 8 and 80 Predominate. J Clin Microbiol : Hanssen AM, Kjeldsen G, Sollid JUE. Local Variants of Staphylococcal Cassette Chromosome mec in Sporadic Methicillin- Resistant Staphylococcus aureus and Methicillin-Resistant Coagulase-Negative Staphylococci: Evidence of Horizontal Gene Transfer?. Antimicrob Agents Chemother : Kim SM, Lee H, Peck KR, Song JH, Yang JW, Jin JH, Pai HJ, Oh MD, Choe KW. Genetic relatedness of Methicillin-Resistant Staphylococcus aureus Isolates Recovered from 3 differnt Hospitals in Korea. Infection : Ko KS, Lee JY, Suh JY, Oh WS, Peck KR, Lee NY, Song JH. Distribution of Major genotypes among Methicillin-Resistant Staphylococcus aureus Clones in Asian Countries. J Clin Microbiol : Lee HK, Pahk JY, Han KJ, Kim BK, Kang MW, Shim SI. Comparison of PCR Detection of meca with Standard Susceptibility Testing Methods to Determine Mechicillin Resistance in Clinical Strains of Staphylococci. Infection : Lee JS, Park O, Woo HJ, Jung HJ, Kim WJ, Kim MJ, Park SC. A Longitudinal Molecular Epidermiologic Study of Methicillin- Resistant Staphylococcus aureus (MRSA) isolates from a University Hospital. Infection : Lu PL, Chin LC, Peng CF, Chiang YH, Chen TP, Ma L, Siu LK. Risk Factors and Molecular Analysis of community Methicillin-resistant Staphylococcus aureus Carriage. J Clin Microbiol : Matsumura LLSO, Choi E, Louie M, Simor AE. Evaluation of Three rapid Methods for Detection of Methicillin Resistance in Staphylococcus aureus. J Clin Microbiol :
7 Nathalie van der Mee-Marquet, Domelier AS, Girard N, Quentin Roland, and the Bloodstream Infection Study Group of the Relais d'hygiène du Centre. Epidemiology and Typing of Staphylococcus aureus Strains Isolated from bloodstream Infections. J Clin Microbial : Oliveira DC, Lencastre H. Multiplex PCR Strategy for Rapid Identification of Structural Types and variants of the mec Element in Methicillin-Resistant Staphylococcus aureus. Antimicrob Agents Chemother : Robinson DA, Enright MC. Evolutionary Models of the Emergence of Methicillin-Resistant Staphylococcus aureus. Antimicrob Agents Chemother : Sakoulas G, Gold HS, Venkataraman L, DeGirolami PC, Elio- poulos GM, Qian Qinfang. Methicillin-Resistant Staphylococcus aureus: Comparison of Susceptibility Testing Methods and Analysis of meca-positive Susceptible Strains. J Clin Microbiol : Shukla SK, Stemper ME, Ramaswamy SV, Conradt JM, Reich R, Graviss EA, Reed KD. Molecular Characteristics of Nosocomial and Native American Community-Associated Methicillin- Resistant Staphylococcus aureus Clones from Rural Wisconsin. J Clin Microbio : Woo HY, Lee NY, Maeng SH, Han SH, Ihn KS, Lim SW, Seong SY, Kim IS, Choi MS. Molecular Epidermiological Study and Analysis of Genomic Diversity of mec Regulator Genes in meca Positive Methicillin-Resistant Staphylococci. J Infect Chemother :
Microsoft PowerPoint - PDFCoTemp.PPT
주요유방염세균의검출및 항생제감수성검사 임숙경 1. 검사시료 1. 시료채취 유방염우유 2. 체세포수측정 3. 대상세균 - Staphylococcus aureus - Coagulase negative staphylococci -Escherichia coli 3. 균분리방법 E. coli CHEC Agar 직접도말 (37 18-24h) 보라색집락 EMB Agar
More informationhwp
국내병원과국내주둔미군병원에서분리한 Methicilin 저항성 Staphylococcusaureus 의항생물질내성형과 meca 유전자의검출 연세대학교보건환경대학원 의생명과학과 신진수 국내병원과국내주둔미군병원에서분리한 Methicilin 저항성 Staphylococcusaureus 의항생물질내성형과 meca 유전자의검출 지도김종배교수 이논문을석사학위논문으로제출함
More information( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
More informationMicrosoft Word - 2-황수명.doc
Journal of Bacteriology and Virology 2009. Vol. 39, No. 2 p.71 78 DOI 10.4167/jbv.2009.39.2.71 Correlation Between Staphylococcal Cassette Chromosome mec Type and Coagulase Serotype of Methicillin-Resistant
More information< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770>
대한임상검사학회지 : 40권제2호, 75-79, 2008 ISSN 1738-3544 대구지역병원에서분리된 Acinetobacter baumannii와 Pseudomonas aeruginosa의항생제내성현황 대구보건대학임상병리과 1, 세명대학교임상병리학과 2 김수정 1 이재식 2 Antibiotic Resistance Patterns of Acinetobacter
More informationuntitled
ORIGINAL ARTICLE Korean J Clin Lab Sci. Vol. 45, No. 1, Mar. 2013 21 Korean J Clin Lab Sci. 2013, 45(1):21-25 ISSN 1738-3544 Errors of Antibiotic Susceptibility Testing from Automated and Manual Systems
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More informationORIGINAL ARTICLE Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist
ORIGINAL ARTICLE http://dx.doi.org/10.15263/jlmqa.2015.37.4.209 Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resistance: MicroScan versus Etest Goeun Kang, Hyun Soo Kim,
More information<3037C1D6BCBCC0CD2E687770>
대한임상검사학회지 : 38 권제 1 호, 38-44, 2006 포도구균의 Erythromycin 유도성 Clindamycin 내성검출을위한간편한디스크확산법의유용성 서울대학교병원진단검사의학과 1, 서울대학교의과대학검사의학교실 2 주세익 1 이현 1 임규상 1 김의종 1, 2 An Easy Method of Disk Diffusion Antibiotic Susceptibility
More information2 - ceftazidime-clavulanate 디스크를이용하여 ESBL 생성균주를확인하였다. 또한 2009년도에수집된균주인 P. aeruginosa(386주 ), A. baumannii(349주 ) 를대상으로 imipenem에대한감수성을확인하였고 imipenem-h
1 - 국내종합병원을대상으로한항균제내성모니터링 Monitoring of antimicrobial resistance on general hospitals in Korea 질병관리본부국립보건연구원감염병센터약제내성과 연세대학교의과대학진단검사의학교실, 세균내성연구소 Ⅰ. 들어가는말 항균제내성세균의출현과확산으로인하여세균감염증치료는점점어려워지고있다 [1-4]. 항균제내성률은흔히국가간,
More informationuntitled
Korean J Clin Microbiol Vol. 14, No. 1, March, 2011 DOI: 10.5145/KJCM.2011.14.1.18 Prevalence and Clinical Characteristics of Mupirocin-Resistant Staphylococcus aureus A-jin Lee, Hun-Suk Suh, Chang-Ho
More information1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
More information주간건강과질병 제 12 권제 16 호 연구단신, Brief report 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : s
연구단신, Brief report 2 2013 2017 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : sea2sky@korea.kr, 043-719-7580 Results of healthcare-associated infection
More information< B3E2BAB8B0C7BFF8BAB828BAB8B0C72CC3E0BBEA29312E687770>
부산광역시보건환경연구원보제 14 권 (I), 15~27, 2004 Rep. Busan Inst. Health & Environ, Vol.14, 15~27, 2004 미생물과 이주현 Study on the Antimicrobial Susceptbility of Vibrio spp. Isolated from Environmental source and Patients
More informationuntitled
대한내과학회지 : 제 72 권제 1 호 27 Streptococcus pneumoniae와 Haemophilus influenzae 임상분리주에대한 Cefditoren의시험관내항균력 인제대학교의과대학일산백병원감염내과, 울산대학교의과대학서울아산병원감염내과 2, 울산대학교항균제내성ㆍ미생물유전학연구센터 3 곽이경 추은주 2, 3 박수진 3 이정은 3 정진용 2,
More informationMicrosoft Word - 03-황수명.doc
Journal of Bacteriology and Virology 2011. Vol. 41, No. 3 p.157 164 http://dx.doi.org/10.4167/jbv.2011.41.3.157 Original Article Correlation Between the Prevalence of Superantigenic Toxin Genes and Coagulase
More informationuntitled
理 葉 CNFH-88-04 行 87 年 9 1 88 年 6 30 類 葉 Staphylococcus aureus Staphylococcus epidermidis Streptococcus mutans Streptococcus sanguis Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa Candida
More informationKorean J Lab Med 2010;30: DOI /kjlm Original Article Clinical Microbiology Evaluation of the Performance of the MicroScan P
Korean J Lab Med 200;0:67-46 DOI 0.4/kjlm.200.0.6.67 Original Article Clinical Microbiology Evaluation of the Performance of the MicroScan Pos Breakpoint Combo Panel Type 28 for Susceptibility Testing
More informationKJFP Jeongsook Yoon. Bacterial Strains and Antimicrobial Resistance in Burn Patients 심부화상인경우 Clostridium, Bacteroides 등을감별하기위해무산소성배양을시행해야한다고권장하고있다. 6)
KJFP Original Article http://dx.doi.org/10.21215/kjfp.2016.6.3.179 pissn 2233-9019 eissn 2233-9116 화상창 감염의 균종 및 항균제 감수성률 윤정숙* 서울베스티안병원 진단검사의학과 Bacterial Strains and Antimicrobial Resistance of Wound Infection
More information(2005\263\342\271\351\274\255_final.hwp)
제 2 절 식 의약품 종합정보서비스 243 제1장 평 가 분 야 제1절 식품규격평가 분야 제2절 식품안전평가 분야 제3절 의약품평가 분야 제4절 생약평가 분야 제5절 생물의약품평가 분야 제6절 의료기기평가 분야 제 1 절 식품규격평가 분야 245 제1장 평가분야 제1절 식품규격평가 분야 제1 항 식품의 기준 규격 1. 식품공전 식품의 기준 규격은 식품위생법
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More informationEvaluation of Phoenix for AST of S. pneumoniae 213 mento, CA, USA) 이사용되고있다. 2000년에 Becton Dickinson에서포도알균, 장알균과그람음성세균의동정과항균제감수성검사를위한 Phoenix Automated
대한진단검사의학회지제 29 권제 3 호 2009 Korean J Lab Med 2009;29:212-7 DOI 10.3343/kjlm.2009.29.3.212 Original Article Clinical Microbiology 폐렴알균의항균제감수성검사를위한 Phoenix System 의평가 이교관 1 류남희 2 김성태 1 채석래 1 허희진 1 동국대학교일산병원진단검사의학과
More information03(12-65)p fm
한국임상약학회지제 23 권제 1 호 Kor. J. Clin. Pharm., Vol. 23, No. 1. 2013 화상감염소아환자에서분리된주요균종에대한항생제의내성률 강주연 신혜순 * 덕성여자대학교약학대학 (2012 년 12 월 28 일접수 2013 년 3 월 2 일수정 2013 년 3 월 4 일승인 ) Antimicrobial Resistance of Clinically
More informationuntitled
Ann Clin Microbiol Vol. 19, No. 2, June, 2016 http://dx.doi.org/10.5145/acm.2016.19.2.48 pissn 2288-0585 eissn 2288-6850 Distribution and Antimicrobial Resistance of Streptococcus pneumoniae at Four University
More information한수지 49(5), , 2016 Original Article Korean J Fish Aquat Sci 49(5), ,2016 창선해역의지중해담치 (Mytilus galloprovincialis) 양식장및육상오염원에서분리한대장균 (Escheri
한수지 49(5), 564-572, 2016 Original Article Korean J Fish Aquat Sci 49(5),564-572,2016 창선해역의지중해담치 (Mytilus galloprovincialis) 양식장및육상오염원에서분리한대장균 (Escherichia coli) 의항생제내성 권순재 이가정 * 정연중 박상기 고경리 양지혜 목종수 국립수산과학원남동해수산연구소
More information목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i
11-1480523-000748-01 배경지역 ( 백령도 ) 에서의 대기오염물질특성연구 (Ⅲ) 기후대기연구부대기환경연구과,,,,,,, Ⅲ 2010 목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i 목차 Ⅳ ii 목차 iii 목차 iv 목차 μg m3 μg m3 v 목차 vi Ⅰ. 서론 Ⅰ μm μg m3 1 Ⅰ. 서론 μg m3 μg m3 μg m3 μm 2
More informationMicrosoft Word - 04-정재근.doc
Journal of Bacteriology and Virology 2013. Vol. 43, No. 2 p.99 110 http://dx.doi.org/10.4167/jbv.2013.43.2.99 Original Article Characterization of Community-Associated Methicillin-Resistant Staphylococcus
More information(59-69)Kjcm13.hwp
Korean J Clin Microbiol Vol. 10, No. 1, April, 2007 Antimicrobial Resistance of Clinically Important Bacteria Isolated from 12 Hospitals in Korea in 2005 and 2006 Hyukmin Lee 1, Chang Ki Kim 2, Jongwook
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information<B8F1C2F72E687770>
제1장 제17장 성홍열 및 사슬알균 감염증 사슬알균 (Streptococci)은 증식 중의 특징적으로 쌍 또는 사슬모양의 그람양성 알균 으로 catalase 음성, 통성혐기성균이며, 보통 한천배지에서는 발육이 어렵고 혈액이나 혈청 등을 첨가한 배지에서 잘 발육한다. 포도당이나 다른 탄수화물을 분해하나 포도당 을 분해하여 가스를 생성하지 않는다. 이들은 최소
More informationuntitled
Korean J Clin Microbiol Vol. 13, No. 1, March, 2010 DOI: 10.5145/KJCM.2010.13.1.1 Microbiological Characteristics of Methicillin-resistant Staphylococcus aureus Jongyoun Yi 1, *, Eui-Chong Kim 1,2 1 Department
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information..........5-45..
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More information한수지 49(5), , 2016 Original Article Korean J Fish Aquat Sci 49(5), ,2016 곰소만해역해수에서분리한장염비브리오 (Vibrio parahaemolyticus) 의항균제내성및최소발육억제농도의구명 김
한수지 49(5), 582-588, 206 Original Article Korean J Fish Aquat Sci 49(5),582-588,206 곰소만해역해수에서분리한장염비브리오 (Vibrio parahaemolyticus) 의항균제내성및최소발육억제농도의구명 김태옥 엄인선 김희대 박권삼 * 군산대학교식품생명공학과, 충북도립대학바이오생명의약과 Antimicrobial
More information12(2) fm
Journal of Dental Hygiene Science Vol. 12, No. 2, pp. 109~113 (2012) 임상에서분리한 Streptococcus pneumoniae 에서 Levofloxacin 내성유전자의비교연구 최재민 1 박선희 1 윤지아 1 한양금 2 이인수 1 1 한남대학교생명공학과, 2 대전보건대학교치위생 ( 학 ) 과 Comparative
More information16(1)-3(국문)(p.40-45).fm
w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University
More informationuntitled
210 Ji Youn Sung. PMQR Genes among CTX-M-14 Producing E. coli ORIGINAL ARTICLE Korean J Clin Lab Sci. 2016, 48(3):210-216 http://dx.doi.org/10.15324/kjcls.2016.48.3.210 pissn 1738-3544 eissn 2288-1662
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information<5BC0FAC0DABCF6C1A430355D434D30362D313320BEE7BAB4BCB12D E687770>
대한임상검사학회지 : 38 권제 3 호, 173-178, 2006 Multiplex Polymerase Chain Reaction 을이용한 Extended-Spectrum β-lactamase 생성 Klebsiella pneumoniae 균주의검출 진주보건대학임상병리과 양병선 Detection of Extended-Spectrum β-lactamase Producing
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More information( ) 이남용.hwp
임상검사와정도관리 : 제 32 권제 12 호 2010 J Lab Med Qual Assur 2010; 32:11-24 11 임상미생물학검사신빙도조사결과보고 (2009) 이남용 ( 집필대표 ) 김명숙 김미나 김민중 김선주 김성일 김의종 김재석 용동은 윤남섭 이장호 주세익 대한임상검사정도관리협회임상미생물학분과위원회 Annual Report on External
More information04_HM hwp
The Korean Journal of Microbiology (2010) Vol. 46, No. 4, pp. 334-340 Copyright c 2010, The Microbiological Society of Korea 흡연자와비흡연자간의구강내세균분포및항균제감수성 정현자 1 김수정 2 * 1 대구보건대학치위생과, 2 대구보건대학임상병리과 Distribution
More informationAnalysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
More informationDV690-N_KOR_110216.indd
P/NO : MFL63266772 3 1 4 1 5 7 1 2 3 4 5 6 7 6 1 7 7 r t y u i - - - -, 7 1, 8 1 1 3 6 8 10 11 13? 12 14 15 16 17 18 a 1 b B c d e f c/v g C/V h M i Z j z k l 2 4 5 7 9 m w/s/a/d n b o p x q [ ] } r?
More information04김호걸(39~50)ok
Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*
More information05.fm
pissn 1229-1153 J. Fd Hyg. Safety Vol. 29, No. 1, pp. 26~30 (2014) http://dx.doi.org/10.13103/jfhs.2014.29.1.026 Journal of Food Hygiene and Safety Available online at http://www.foodhygiene.or.kr 식품에서분리된리스테리아모노사이토젠스의분포및항생제내성
More informationÇмúº¸°í6ÇÏÇý¹Î
병원약사회지 (27), 제 34 권제 4 호 J. Kor. Soc. Health-syst. Pharm., Vol. 34, No. 4, 433 ~ 442 (27) Original Article 국내지역사회획득폐렴원인균의경험적항균제에대한내성현황 하혜민 a, 김윤숙 b, 안정미 c, 천부순 a, 인제대학교약학대학 a, 인제대학교해운대백병원약제부 b, 인제대학교상계백병원약제부
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information<B0E6B3B2C1F6BFAA20C1F6BFAABBE7C8B8C8B9B5E620B8DEC6BCBDC7B8B0B3BBBCBA20C8B2BBF6C6F7B5B5BECBB1D5C0C720B9DFBBFDBEE7BBF320B9D720C6AFBCBAC1B6BBE72E687770>
제출문 질병관리본부장 귀하 이보고서를 경남지역지역사회획득메티실린내성황색포도알균의발생양상및특성조 사 ( 경북대학교 / 이제철 ) 과제의연구결과보고서로제출합니다. 2006. 4. 5 주관연구기관명 : 경북대학교 주관연구책임자 : 이제철 - 1 - 연구결과보고서요약문 연구과제명 중심단어 경남지역지역사회획득메티실린내성황색포도알균의발생양상및특성조사 지역사회감염, SCCmec,
More informationViridans Streptococci 균혈증 247 나이며, 이는류마티스성열, 승모판탈출, 선천성결손, 인공판막등으로인한심장판막손상이나결손이있는사람에서주로발생한다 [4]. 최근에는혈액종양이나고형암또는골수이식등의치료에사용된항암제에따른심각한호중구감소증, 구강점막의궤양등과
대한진단검사의학회지 : 제 23 권제 4 호 2003 Korean J Lab Med 2003; 23: 246-50 임상미생물학 Viridans Streptococci 균혈증의임상적의의 조은해 이남용 성균관대학교의과대학삼성서울병원진단검사의학교실 Clinical Significance of Viridans Streptococcal Bacteremia Eun Hae
More information< D34312D303628BEE7BAB4BCB12CC0B0B1D9B5B9292E687770>
대한임상검사학회지 : 41권제4호, 153-157, 2009 ISSN 1738-3544 SHV ESBL 생성 Klebsiella pneumoniae 균주의실시간중합효소반응분석 진주보건대학임상병리과 1, 대전보건대학임상병리과 2 양병선 1 육근돌 2 Real-Time PCR Analysis of SHV Extended-Spectrum beta-lactamases
More information<303120C6AFC1FD20B9E8C7F6C1D62E687770>
대한내과학회지: 제 81 권 제 6 호 2011 특 집(Special Review) - 흔한 감염질환에서의 항생제 내성 및 최신 치료 지역사회 단순 요로감염에서의 항생제 내성 및 최신 치료 한양대학교병원 감염내과 배 현 주 Treatment of Community-Acquired Uncomplicated Urinary Tract Infection Hyunjoo
More informationuntitled
병원감염관리 : 제19권제1호 2014 Korean J Nosocomial Infect Control 2014;19(1):29-36 http://dx.doi.org/10.14192/kjnic.2014.19.1.29 원저 국내중환자실환자에서분리된세균의항균제내성 이양순 1 ㆍ김영아 2 ㆍ송원근 3 ㆍ이혁민 4 ㆍ이혜수 5 ㆍ장숙진 6 ㆍ정석훈 1 ㆍ홍성근 7 용동은
More information노인정신의학회보14-1호
제14권 1호 통권 제23호 www.kagp.or.kr 발행인 : 정인과 / 편집인 : 이동우 / 발행처 : 정인과 (152-703) 서울특별시 구로구 구로동 80번지 고려대학교 구로병원 정신과 / TEL : 02-818-6608 / FAX : 02-852-1937 발행일 : 2008년 4월 30일 / 제 작 : (주)엠엘커뮤니케이션 140-846 서울특별시
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information< C8B2BFEB2DBFE4B7CEB0A8BFB0C0C720C1D6BFE420BFF8C0CEB1D5B0FA2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 18, No. 3 pp. 85-93, 2017 https://doi.org/10.5762/kais.2017.18.3.85 ISSN 1975-4701 / eissn 2288-4688 하태욱 1, 황용 1, 박승철 2, 이재환 2* 1 원광대학교의과대학응급의학교실,
More information보도자료 년 5 월 16 일 ( 목 ) 조간부터보도하여주시기바랍니다. 문의 : 에너지환경표준과최철우과장, 류지영연구사 ( ) 화장품에도국제표준이...? - 화장품도이젠표준선점으로세계시장선도를 - [ 붙임 1
보도자료 http://www.motie.go.kr 2013 년 5 월 16 일 ( 목 ) 조간부터보도하여주시기바랍니다. 문의 : 에너지환경표준과최철우과장, 류지영연구사 (509-7272) 화장품에도국제표준이...? - 화장품도이젠표준선점으로세계시장선도를 - [ 붙임 1 참조 ] [ 붙임 2 참조 ] [ 붙임 3, 4 참조 ] 이보도자료와관련하여보다자세한내용이나취재를원하시면산업통상자원부기술표준원에너지환경표준과류지영연구사
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More informationContents I. 항생제내성 / 감수성기준및용어설명 II. III. 호흡기질병 5 종항생제내성검사결과 소화기질병 3 종항생제내성검사결과
2017 년양돈질병세균 항생제내성검사결과 I Seul Oh ACE of Optipharm ois@optipharm.co.kr 043-249-7532 Contents I. 항생제내성 / 감수성기준및용어설명 II. III. 호흡기질병 5 종항생제내성검사결과 소화기질병 3 종항생제내성검사결과 2018-01-30 2 1. 항생제감수성 / 내성기준 2018-01-30
More information목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적
用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure
More informationKang CI 문제가되고있는주요병원균으로는소위 ESKAPE 균주들 이있는데, 이는 Enterococci, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aerugino
DOI: 10.5124/jkma.2011.54.3.325 pissn: 1975-8456 eissn: 2093-5951 http://jkma.org Pharmacotherapeutics 다제내성그람음성균감염의치료전략 강철인 * 성균관대학교의과대학삼성서울병원감염내과 Therapeutic strategy for the management of multidrug-resistant
More information< BFEBBFAAB0E1B0FABAB8B0EDBCAD2DBCF6C1A42028BCADBFEFB4EB292E687770>
제출문 질병관리본부장 귀하 이보고서를 균혈증과요로감염원인균의내성실태및내성기전연구 ( 서울대학교의과대 학 / 김의종 ) 과제의연구결과보고서로제출합니다. 2006. 1. 25 주관연구기관명 : 서울대학교의과대학 주관연구책임자 : 김의종 제 1세부과제명 : 균혈증및요로감염을일으키는주요원인균의내성실태 ( 제1세부연구기관 / 세부과제책임자 ): 서울대학교의과대학 /
More information296 Korean J Lab Med 2010;30: S. maltophila 감염증치료에는낮은항균제내성률을보이는 trimethoprim/sulfamethoxazole (TMP/SMX) 이일차치료제로사용되고있으며, quinolone, moxalactam,
Korean J Lab Med 2010;30:295-300 DOI 10.3343/kjlm.2010.30.3.295 Original Article Clinical Microbiology Analysis of Acquired Resistance Genes in Stenotrophomonas maltophilia Jeong Hoon Song, M.D. 1, Ji
More information프로그램 목차 들어가는 말 9 문전성시 문화시장 프로그램 99선 지역 공동체 10 시장 공동체 44 내발적 문화 74 예술의 역할 106 지역활성화 축제 150 여행지로 변신 182 문화중심 216 문화복지 258 문화예술학교 296 새로운 시장 개척 332 마치는 말
프로그램 목차 들어가는 말 9 문전성시 문화시장 프로그램 99선 지역 공동체 10 시장 공동체 44 내발적 문화 74 예술의 역할 106 지역활성화 축제 150 여행지로 변신 182 문화중심 216 문화복지 258 문화예술학교 296 새로운 시장 개척 332 마치는 말 358 참여인력 360 프로그램 목차 연번 카테고리 시장 프로그램명 살펴보기 연번 카테고리
More information[00]_목차.hwp
Korean J. Plant Res. 28(1):009-015(2015) http://dx.doi.org/10.7732/kjpr.2015.28.1.009 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 차정단 1, 최미래 1, 고은실 1, 황승미 1, 강제란 1, 오좌섭 2, 박영진
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More information12_HM hwp
The Korean Journal of Microbiology (2010) Vol. 46, No. 3, pp. 303-307 Copyright c 2010, The Microbiological Society of Korea 단보 국내에서분리된 Acinetobacter baumannii 의 Integron 과연관된다제내성분석 김성환 최지혜 박은진 서인원 손승렬
More informationDrug-Resistant Bacteria: Tertiary Hospitals versus Smaller Medical Institutions resistant Pseudomonas aeruginosa (CRPA), carbapenem resistant Acinetob
Original Article Ewha Med J 2013;36(2):126-131 http://dx.doi.org/10.12771/emj.2013.36.2.126 pissn 2234-3180 eissn 2234-2591 전원온환자의의료기관별호흡기검체에서의균종류비교 김태형, 조경표, 이재성, 우용문, 성지석, 노창석 1 서울적십자병원내과, 1 서울특별시서남병원호흡기내과
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More informationMicrosoft Word - 09-김영권.doc
J. Exp. Biomed. Sci. 2012, 18(2): 152~159 pissn : 1738-3226 Original Article Prevalence and Antimicrobial Susceptibility of Erythromycin-Resistant Campylobacter jejuni and Campylobacter coli Isolated from
More information< D34312D303328C0CCC7F62CC0CCB4F6C8F12CC1D6BCBCC0CD2CB1E8C0C7C1BE292E687770>
대한임상검사학회지 : 41권제2호, 52-56, 2009 ISSN 1738-3544 당뇨병환자의연조직염에서분리된 Arcanobacterium haemolyticum 1 예 서울대학교병원진단검사의학과 이현 1 이덕희 1 주세익 1 김의종 1,2 A Case Report of Arcanobacterium haemolyticum Isolated from Diabetic
More information±èÇ¥³â
533 Fig. 1. Dead zone. Nine echoes are positioned 2-10 mm below the scan surface with 1 mm distance. All nine echoes are clearly visualized. 534 Fig. 2. Vertical and horizontal measurement. 10 cm distance
More information( ).fm
Korean J. Food Sci. An. Vol. 33, No. 1, pp. 133~138(2013) DOI http://dx.doi.org/10.5851/kosfa.2013.33.1.133 ARTICLE 시판축산물및수산물에서 Enterococcus faecalis 와 Enterococcus faecium 분포및항생제감수성에관한연구 성창현 천정환 곽효선 1
More information27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
More information- 2 -
- 1 - - 2 - - 3 - - 4 - - 5 - [ 그림 1] 산수유 [ 그림 2] 더덕 - 6 - - 7 - sample [ 그림 3] 균분리를위한접종 - 8 - PCA PCA with inoculum Slide glass [ 그림 4] Slide culture 모식도 - 9 - - 10 - Nutrient Medium Paperdisk with Antibiotics
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More informationDBPIA-NURIMEDIA
27(2), 2007, 96-121 S ij k i POP j a i SEXR j i AGER j i BEDDAT j ij i j S ij S ij POP j SEXR j AGER j BEDDAT j k i a i i i L ij = S ij - S ij ---------- S ij S ij = k i POP j a i SEXR j i AGER j i BEDDAT
More informationfm
pissn 1229-1153 J. Fd Hyg. Safety Vol. 29, No. 3, pp. 228~233 (2014) http://dx.doi.org/10.13103/jfhs.2014.29.3.228 Journal of Food Hygiene and Safety Available online at http://www.foodhygiene.or.kr 축산물과수산물에서분리된장구균의항생제감수성및유전형분석
More information패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer
READY-TO-WEAR Fashionbiz 2010.1 패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 1 2 3 4 5 6 7 8 9 9 2010.1 Fashionbiz
More informationTable 1. Allelic profiles of 194 C. jejuni analyzed in this study Gene locus Fragment length (bp) No. of alleles No. of polymorphic sites (%) Ave. p d
연구논문, Research article 국내설사환자분리캄필로박터제주니의유전형분석 질병관리본부감염병분석센터세균분석과정수미, 강병학, 홍사현, 김재옥 * * 교신저자 : kimjo70@korea.kr, 043-719-8110 Genetic analysis of Campylobacter jejuni isolates from diarrheal patients in
More informationK O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More informationuntitled
Ann Clin Microbiol Vol. 16, No. 1, March, 1 http://dx.doi.org/1.5145/acm.1.16.1.45 ISSN 88-585 Trends in Isolation and Antimicrobial Susceptibility of Enteropathogenic Bacteria in 1-1 at a Korean Tertiary
More informationMicrosoft Word - 10-Application of Loop-Mediated Isothermal Amplification (LAMP) Assay to Rapid Detection of Methicillin-Resist
Biomedical Science Letters 2019, 25(1): 75~82 https://doi.org/10.15616/bsl.2019.25.1.75 eissn : 2288-7415 Original Article Application of Loop-Mediated Isothermal Amplification (LAMP) Assay to Rapid Detection
More information<37375FB1E8C0E7C1DF2DC7F7BED7B9E8BEE7BFA1BCAD20BAD0B8AEB5C820C0D3BBF3C0FB2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 17, No. 5 pp. 653-659, 2016 http://dx.doi.org/10.5762/kais.2016.17.5.653 ISSN 1975-4701 / eissn 2288-4688 혈액배양에서분리된임상적주요균주의항균제사용량에따른내성률변화
More informationt
t t 4 Community Chest of Korea 5 6 Community Chest of Korea 7 Community Chest of Korea w w w. c h e s t. o r. k r 8 Community Chest of Korea * 9 * 1 0 Community Chest of Korea * 1 1 * 1 2 Community Chest
More information674 권순재ㆍ정연중ㆍ윤현진ㆍ목종수ㆍ권지영,.., (Watts et al., 2017)., 70% (Kummerer, 2009). (Witte, 2000)., (Souli et al., 2008)., % ,113 (NIFS, 2017
한수지 51(6), 673-681, 2018 Original Article Korean J Fish Aquat Sci 51(6),673-681,2018 용남광도해역의굴 (Crassostrea gigas) 및육상오염원에서분리한대장균 (Escherichia coli) 의항생제내성 권순재 정연중 윤현진 목종수 1 권지영 * 국립수산과학원남동해수산연구소, 1 국립수산과학원식품위생가공과
More informationDBPIA-NURIMEDIA
JFM SE, 29(3), pp. 834~846, 2017. www.ksfme.or.kr 수산해양교육연구, 제29권제3 호, 통권87 호, 2017. http://dx.doi.org/10.13000/jfmse.2017.29.3.834 2016 년도제주지역양식넙치(Paralichthys olivaceus ) 에서분리된어병세균의 tetracycline 내성유전자분포
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More informationÇмúº¸°í5¿À´ÙÇö
병원약사회지 (28), 제 35 권제 호 J. Kor. Soc. Health-syst. Pharm., Vol. 35, No., 48 ~ 58 (28) Original Article 국내병원획득폐렴원인균의경험적항균제에대한내성현황 오다현 a, 김윤숙 a, 천부순 b, 인제대학교해운대백병원약제부 a, 인제대학교약학대학 b The Status of Resistance
More informationYonsei_436
YONSEI Newsletter 436 2 YONSEI Newsletter 436 3 YONSEI Newsletter 436 4 5 YONSEI Newsletter 436 6 7 YONSEI Newsletter 436 8 9 YONSEI MEDICAL CENTER 10 YONSEI WONJU CAMPUS 11 12 YONSEI Newsletter 436 13
More informationAbstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
More information