Microsoft Word - 2-황수명.doc

Size: px
Start display at page:

Download "Microsoft Word - 2-황수명.doc"

Transcription

1 Journal of Bacteriology and Virology Vol. 39, No. 2 p DOI /jbv Correlation Between Staphylococcal Cassette Chromosome mec Type and Coagulase Serotype of Methicillin-Resistant Staphylococcus aureus Eui Kyung Cha, Kyung Soo Chang and Soo Myung Hwang * Department of Clinical Laboratory Science, Catholic University of Pusan, Busan, Korea Staphylococcal cassette chromosome mec (SCCmec) type and coagulase serotype are important epidemiologic factors in methicillin-resistant Staphylococcus aureus (MRSA). To investigate correlation between SCCmec type and coagulase serotype of MRSA, we analyzed SCCmec types of MRSA strains isolated from clinical sources and compared the results to coagulase serotypes and antimicrobial susceptibility patterns. A total of 108 MRSA isolates were classified into four SCCmec types: II (55.6%), IV (21.3%) III (13.0%) and IIIA (8.3%), and five coagulase serotypes: II (54.6%), IV (21.3%), V (18.5%) and VII (2.8%). All of coagulase type II, IV and V strains belonged to SCCmec type II, III/IIIA and IV, respectively. SCCmec types II, III and IIIA were multidrug resistant, whereas SCCmec type IV strains were non-multidrug resistant except beta-lactams and erythromycin. The data provide that there is a significant correlation between SCCmec types and phenotypic characteristic of coagulase serotypes. Key Words: Staphylococcal cassette chromosome mec type, Methicillin-resistant Staphylococcus aureus, Coagulase serotype 서론 Staphylococcus aureus (S. aureus) 는화농성감염증의주원인균으로서인체에광범위한질환을일으키는병원성세균이다. 1961년영국병원에서처음으로 S. aureus 감염의치료제로광범위하게사용하던 penicillinase-resistant 항생제인 methicillin에내성을가지는 methicillin-resistant S. aureus (MRSA) 균주가출현하였으며, 1970년대이르러서는병원내감염을일으키는중요한세균이되었고, 현재는다약제내성 MRSA의증가로전세계적으로심각한문제로인식되고있다 (1, 2). 우리나라에서도최근에 Received: March 25, 2009/ Revised: April 15, 2009 Accepted: April 20, 2009 * Corresponding author: Soo Myung Hwang. Department of Clinical Laboratory Science, College of Health Sciences, Catholic University of Pusan, Busan , Korea. Phone: , Fax: smhwang@cup.ac.kr ** This works was supported by research fund from Catholic University of Pusan in MRSA 분리율이 70% 이상에이르고있음이보고되었다 (3, 4). 일반적으로 MRSA 감염은병원입원환자에서주로발생하였으나, 최근에는지역사회의집단생활환경에서쉽게전파되어지고있어, 지역사회관련 MRSA (community associated, CA-MRSA) 감염에따른유행성균주출현에대한역학적연구가활발히이루어지고있다 (5~7). MRSA의내성기전은 beta-lactam 계열항생제에대한친화성이낮은 penicillin-binding protein 2a (PBP2a) 의유도생산에의한것으로서 S. aureus 유전체중 staphylococcal cassette chromosome mec (SCCmec) 이라는이동성유전자에위치한 meca 유전자에의하여결정된다. SCCmec 유전자복합체는약 20~67 kb 사이의다양한크기로구성되어있으며, meca 유전자복합체와 chromosomal cassette recombinase (ccr) 유전자복합체를포함한여러인자의조합에따라 5가지 SCCmec형 (I-V) 과여러가지아형으로분류하고있다 (8~10). 또한 SCCmec형의특성에따라병원감염 MRSA와지역사회관련 MRSA 균주의연관성이알려져있어, 이균주의역학적연구에 SCCmec 71

2 72 EK Cha, et al. 유형분석이많이이용되고있다 (11, 12). S. aureus는세포외분비단백질성분으로, coagulase, Panton-Valentine leukocidin (PVL), staphylococcal enterotoxin (SE), toxic shock syndrome toxin-1 (TSST-1) 등과같은여러종류의병독성인자를생성한다 (6, 13, 14). Coagulase 는사람이나동물의 prothrombin을활성화하여섬유소원을섬유소로변환시켜혈장응고에관여하는효소로서 S. aureus의분리동정에결정적인요인으로잘알려져있다. 이단백질의구조적차이에따라항원성이다른 8종 (I-VIII) 의혈청형 (serotype) 이알려져있으며 (15), 최근에는동물에서분리된 S. aureus에서의새로운혈청형 2 종 (IX, X) 이추가되어 10종의혈청형이보고되었다 (16). Coagulase의혈청형과유전자형분석은 S. aureus의역학적연구에유용한자료로이용되고있으며, 다약제내성균주, 분리검체에따라 coagulase의형별특성을나타내고있다 (17). 환경오염, 항생제남용등에의한생태계의변화는다약제내성인자의획득를비롯한병독성인자의변형으로이어져새로운환경에적응할수있는변이균주의출현을가져올것이며, 변이균종에의한감염은치료에어려움은물론치명적인결과를가져올수있으리라생각된다. MRSA 유행균주에대한역학적연구방법이다양하게보고되고있으며, 내성인자획득에의한변이균주의생물유전적특성을규명하기위하여많은연구가이루어지고있다. 본연구에서는 S. aureus의주요효소인 coagulase 항원성의차이에따른약제내성율의변화를확인하고, methicillin 내성유전자가포함된 SCCmec형의특성을분석하여 coagulase형별특성과항생제감수성과의상관성을비교하여 coagulase형별이 SCCmec 유전자획득과 methicillin 및다약제내성에어떠한연계성이있는지연구하고자하였다. 재료및방법실험균주 2005년부산시소재 3개종합병원의임상검체에서분리동정된 MRSA 108주를수집하여실험균주로사용하였다. MRSA 균이분리된검체의종류는농 (n=36), 귀분비물 (n=25), 객담 (n=18), 혈액 (n=7), 피부 (n=6) 뇨 (n=3) 등을포함한 12부위였으며, 화농성검체가대부분을차지하였다. DNA 분리및 methicillin 내성유전자 (meca) 확인균주의 genomic DNA 분리는 AccuPrep Genomic DNA Extraction Kit (Bioneer Co. Ltd., Seoul, Korea) 를이용하여추출하였다. Methicillin 내성유전자인 meca 유전자의검출은 Murakami 등 (18) 의방법을응용하여 PCR법으로실시하였다. PCR 반응혼합액은 AccuPower PCR Premix Kit (Bioneer Co. Ltd.) 를사용하여, DNA 시료 (25 ng) 0.5 μl, primer (10 pmol) 를각각 1 μl 넣고증류수로총 20 μl 로최종부피를맞추었다. PCR 반응조건은 94 에서 5 분간초기반응, 94 30초, 55 30초, 72 30분의과정으로 25회반복하였고, 마지막으로 72 에서 7분연장으로 PCR을종결하였다. 증폭된 DNA 시료는 1.5% agarose gel을통하여전기영동을실시하였고, 증폭산물의크기를확인하여 meca 유전자를확인하였다. SCCmec 유전자형분석 SCCmec 유전자형분석은 Oliveira 등의방법 (10) 에따라 8 locus (A-H) 의 primer를사용하였고 (Table 1), 3조합 (AB, CD 및 E-H) 으로나누어 3번의 multiplex-pcr을실시하였다. PCR 반응혼합액은 AccuPower PCR Premix Kit 를사용하여, DNA 시료 (25 ng) 0.5 μl, 각조합별 primer (10 pmol) 를각각 1 μl 넣고증류수로총 20 μl로최종부피를맞추었다. PCR 조건은 94 에서 4분간초기반응, 94 30초, 53 30초, 72 1분의과정으로 30회반복하였고, 마지막으로 72 에서 4분연장으로 PCR을종결하였다. 증폭된 DNA 시료는 1.5% agarose gel을통하여전기영동을실시하였고, 각증폭산물의크기를확인하여 SCCmec형을결정하였다. Coagulase 혈청형시험 S. aureus의 coagulase 혈청형분석은 8종 (Type I-VIII) 의항혈청 (Denka Seiken Co, Tokyo, Japan) 을사용하여 Hwang 등 (19) 의방법으로분석하였다. Nutrient agar 배지에자란한집락을 5 ml brain heart infusion broth (BHI) 에접종하여 37 shaking incubator에서하룻밤배양한후, 0.1 ml의균배양액을새로운 5 ml BHI broth에접종하여 4~5시간배양하여균의농도가 10 8 CFU/ml 되게조정하고, rpm에서 20분동안원심분리하여그상층액을분석시료로사용하였다. Coagulase 기질용액으로는 polyethylene-aminocarpronic acid-fibrinogen (PAF) 를사용하

3 Correlation between SCCmec Type and Coagulase Serotype in MRSA 73 Table 1. Primers and predicted sizes of PCR products for SCCmec typing Locus Primer names Primer sequence Amplicon sizes (bp) SCCmec type CIF2 F2 A CIF2 R2 KDP F1 B KDP R1 MECI P2 C MECI P3 DCS F2 D DCS R1 RIF4 F3 E RIF4 R9 RIF5 F10 F RIF5 R13 IS431 P4 G pub110 R1 IS431 P4 H pt181 R1 Reference, Oliveria et al. (10) TTCGAGTTGCTGATGAAGAAGG ATTTACCACAAGGACTACCAGC AATCATCTGCCATTGGTGATGC CGAATGAAGTGAAAGAAAGTGG ATCAAGACTTGCATTCAGGC GCGGTTTCAATTCACTTGTC CATCCTATGATAGCTTGGTC CTAAATCATAGCCATGACCG GTGATTGTTCGAGATATGTGG CGCTTTATCTGTATCTATCGC TTCTTAAGTACACGCTGAATCG GTCACAGTAATTCCATCAATGC CAGGTCTCTTCAGATCTACG GAGCCATAAACACCAATAGCC CAGGTCTCTTCAGATCTACG GAAGAATGGGGAAAGCTTCAC 495 I 284 II 209 II, III 342 I, II, IV 243 III 414 III 381 IA 303 IIIA 였다. U-microplate 각 well에항혈청 8종을각각 10 μl 집어넣고, 시료 10 μl를각항혈청이들어있는 well에가하여가볍게혼합한다음실온에서 5분방치하였다. 그다음으로 PAF 기질용액을각 well에 20 μl 넣은후 37 incubator에서 2시간이후부터 30분간격으로형특이 coagulase와항혈청간의중화반응에의한응고억제반응여부를관찰하였다. 항생제감수성시험항생제감수성시험은디스크확산법으로 Clinical and Laboratory Standard Institute (CLSI) 기준에따라실시하였다 (20). 항생제의종류는 penicillin, oxacillin, clindamycin, ciprofloxacin, erythromycin, gentamicin, tetracycline, teicoplanin, trimethoprim-sulfamethoxazole (SXT), vancomycin을사용하였다. 결과 Methicillin 내성균주로부터 meca 유전자확인환자의가검물에서분리된 S. aureus 중항생제감수성 Figure 1. Detection of meca genes from MRSA isolates by PCR. Lane 1: S. aureus (ATCC25923), Lanes 2 to 3: MRSA isolates, Lanes 4 to 5: MSSA isolates, M, molecular markers, 100 bp DNA ladder (Bioneer). 시험결과에서 oxacillin 내성균주로확인된총 108 MRSA 균주를대상으로 meca 유전자에대한특이 primer를이용하여 PCR을실시한결과, 모든 MRSA 균주에서 533 bp 크기의 meca 유전자가검출되었다 (Fig. 1). SCCmec 유전자형 Methicillin 내성유전자가확인된 MRSA의 SCCmec 유전자형을 8종의 primer를조합하여 multiplex-pcr을이용하여분석한결과, 4종류의형이확인되었다 (Fig. 2).

4 74 EK Cha, et al. Figure 2. SCCmec types identified by multiplex PCR. Lanes 1, 4, 7, 10 (loci A and B primers ): lanes 2, 5, 8, 11 (loci C and D): lanes 3, 6, 9, 12 (loci E to H): SCCmec type II, lanes 1 to 3 (284 bp, 209 bp, 342 bp): type III, lanes 4 to 6 (209 bp, 243 bp, 414 bp): type IIIA, lanes 7 to 9 (209 bp, 243 bp, 303 bp, 414 bp): type IV, lanes 10 to 12 (342 bp). M, molecular markers, 100 bp DNA ladder (Bioneer). Table 2. SCCmec types of MRSA strains isolated from clinical sources SCCmec type Source No. of strains I II III IIIA IV ND Pus Ear discharge Sputum Blood Skin Pleural fluid Ascitic fluid Urine Catheter tips Nasal discharge Throat Stool Total 108 (100) 0 60 (55.6) 14 (13.0) 9 (8.3) 23 (21.3) 2 (1.9) ND, Not Determined SCCmec II형은 loci B (284 bp), C (209 bp), D (342 bp) primer 에의하여결정되었으며, III형은 loci C (209 bp), E (243 bp), F (414 bp) 로, IIIA형은 C (209 bp), E (243 bp), F (414 bp), H (303 bp), IV형은 locus D (342 bp) 의결과로확인되었다. SCCmec I형은검출되지않았다. 가장분리율이높은 SCCmec형은 II형으로 60주 (55.6%) 이었으며, III/IIIA 형이각각 14주 (13%) 와 9주 (8.3%), IV형이 23주 (21.3%) 이었으며, SCCmec형이결정되지않은균주는 2주 (1.9%) 이었다 (Table 2). 임상검체별로 SCCmec 유형을살펴보면, II형은피부검체를제외한모든검체에서높은빈도로분리되었으며, III/IIIA형은주로농과귀분비물에서, IV형은농과귀분비물및피부검체에서분리되었다. 호흡기계통의객담과인후검체에서는 II형이주로분리됨으로서, 검체의종류에따라 SCCmec 유형의특성을나타내었다. Coagulase 혈청형 MRSA 균주의 coagulase 혈청형을분석한결과, I형, VI 형, VIII형을제외한 5종의 coagulase형이분리되었으며, 이중에서 coagulase II형이 59주 (54.6%) 로가장분리율이높았으며, IV형 : 23주 (21.3%), V형 : 20주 (18.5%), VII형 : 3 주 (2.8%), III형 : 1주 (0.9%) 의순이었으며, 혈청형이결정되지않은형 (ND) 이 2주 (1.9%) 이었다. 임상검체별로 coagulase형을살펴보면, II형은피부검체를제외한모든검체에서높은빈도로분리되었고, IV형은주로농과귀분비물에서, V형은농과귀분비물및피부등의표재성화농검체에서분리되는것으로확인하였다. 호흡기계통의객담과인후검체에서는주로 II형이분리됨으로서검체의종류에따라 coagulase형도 SCCmec형과동일한양상을나타내었다 (Table 3).

5 Correlation between SCCmec Type and Coagulase Serotype in MRSA 75 Source No. of strains (%) Table 3. Distribution of coagulase serotypes of MRSA strains Coagulase serotype I II III IV V VI VII VIII ND Pus Ear discharge Sputum Blood Skin Pleural fluid Ascitic fluid Urine Catheter tips Nasal discharge Throat Stool Total 108 (100) 0 (0) 59 (54.6) 1 (0.9) 23 (21.3) 20 (18.5) 0 (0) 3 (2.8) 0 (0) 2 (1.9) ND, Not Determined Table 4. Correlation between SCCmec type and coagulase serotype of MRSA SCCmec type No. of strains Coagulase serotype II III IV V VII ND II III IIIA IV ND Total ND, Not Determined SCCmec 형과 coagulase 형의상관성 SCCmec형과 coagulase형과특성을비교한결과는 Table 4와같다. 59주의 coagulase II형은모두 SCCmec II형에속하였고, 23주의 coagulase IV형은 SCCmec III/IIIA형, 20 주의 coagulase V형은모두 SCCmec IV형으로일치를나타내었고, coagulase VII형 3주는 SCCmec IV형 1주와 ND 2주로분류되어, 검체별특성과함께 SCCmec형과 coagulase형두유형간의연계성이있음을확인하였다. Table 5. Antimicrobial susceptibility profile of MRSA strains according to SCCmec Antimicrobial agent SCCmec 형과항생제감수성 No. (%) of susceptible isolates Type II Type III Type IIIA Type IV Penicillin 0 (0) 0 (0) 0 (0) 0 (0) Oxacillin 0 (0) 0 (0) 0 (0) 0 (0) Clindamycin 7 (11.7) 1 (7.1) 1 (11.1) 22 (95.6) Ciprofloxacin 2 (3.3) 0 (0) 0 (0) 23 (100) Erythromycin 1 (1.7) 0 (0) 0 (0) 5 (21.7) Gentamycin 0 (0) 0 (0) 0 (0) 20 (86.9) Tetracycline 0 (0) 0 (0) 0 (0) 22 (96.8) Teicoplanin 57 (95.0) 14 (100) 9 (100) 23 (100) Trimethoprim- 56 (93.3) Sulfamethoxazole 11 (78.6) 2 (22.2) 23 (100) Vancomycin 60 (100) 14 (100) 9 (100) 23 (100) Total 60 (100) 14 (100) 9 (100) 23 (100) SCCmec형에따른 MRSA 균주의항생제감수성결과는 Table 5와같다. SCCmec II형과 III/IIIA형은 vancomycin, teicoplanin 및 trimethoprim-sulfamethoxazole (SXT) 를제외한 penicillin, oxacillin, clindamycin, ciprofloxacin, erythro-

6 76 EK Cha, et al. mycin, gentamicin, tetracycline 항생제에대하여내성을나타내어거의동일한다약제내성을보였고, IV형의경우 penicillin, oxacillin과 erythromycin을제외한나머지항생제에대하여감수성을나타내었다. SCCmec II형에서일부 teicoplanin에내성을나타내었으며, SCCmec IIIA형은 SXT에대한내성율이 SCCmec II형과 III형보다높은결과로 SCCmec 유형에따라항생제감수성차이가있음을확인하였다. 고찰 SCCmec 유형분석은 MRSA의역학과클론상관성을연구하는데매우중요한지표로서많은연구가이루어지고있다 (11, 21). SCCmec 유전자는 meca 유전자와 cassette chromosome recombinase (ccr) 를갖고있는유일한이동성유전인자로서 ccr에의하여 chromosome에통합되어존재하며, mec 유전자복합체 (IS431-mecA, IS1272- meca, meci-mecri) 와 ccr 유전자복합체 (ccra, ccrb, ccrc) 의차이에의하여 I형에서 V형으로나누어진다 (8, 9, 17). 특히다약제내성인병원감염의 MRSA인경우 SCCmec I형, II형및 III형의분리율이높으며, 상대적으로유전자크기가작은 SCCmec IV형의경우지역사회관련 MRSA 균주로알려져있다 (7, 22). 본실험결과에서 SCCmec II형 (55.6%) 이가장많이분리되었으며, 그다음으로 IV 형 (21.3%), III형 (13%), IIIA형 (8.3%) 순으로분리되었다. 이와같은결과는우리나라와일본에서 (23~25) SCCmec II형의분리율이높은결과와일치하였다. Kilic 등 (7) 은테네시주지역 1315주 MRSA의 SCCmec형분석에서 II 형 34.1%, IV형 64.4% 로보고하였고, Liu 등 (12) 은타이완에서분리된 187주 MRSA에서 III형 71.7%, IV형 24.1% 로분리되어, SCCmec형의지역간의차이가있음을확인하였다. 임상검체에따른 SCCmec형을살펴보면, 농과귀분비물검체에서 II형을포함하여 III/IIIA형, IV형이모두분리되었으며, 피부검체에서는 IV형이분리되었다. 객담과인후검체에서는 II형이분리되어, 임상검체에따라 SCCme형의차이를나타내었다. SCCmec IV형 MRSA는병력이나다른소인이없는집단인지역사회감염균으로 (CA-MRSA) 로알려지면서독소생성능과항생제감수성등의특성에따라병원내감염 MRSA와구별된다 (26). 본실험에서 SCCmec IV형 MRSA 균주는주로표재성화농검체에서분리되었으며, 환자병력과함께역학조사를 실시함으로써유행균주의특성을확인할수있으리라기대한다. S. aureus가생성하는 coagulase는그구조적차이에의하여항원성이다른 10종의혈청형이알려져있으며, 일본을중심으로많은연구가이루어지고있다. 다약제내성 MRSA의 coagulase는 II형이대부분을차지하고있는것으로알려져있으나, 일본과우리나라에서의보고된연구결과를비교하여보면, II형을제외한나머지형에서각지역에따라혈청형의차이가있음이보고되었다. Ishino 등 (17) 은 MRSA 472균주의 coagulase형을분석한결과, II형 : 82.4%, IV형 : 7.8%, VII형 : 3.8%, III형 : 2.3%, I형 : 0.9% 로보고하였고, Ryu 등 (27) 은 MRSA 86균주에서 II 형 : 50%, IV형 : 12.5%, III형 : 6.8%, V형을제외한나머지 I, VI, VII, VIII형이각각 4.5% 임을보고한바있다. Hwang 등 (28) 은 1994년에서 2005년분리된 MRSA 408주의 coagulase 혈청형분석한결과에서 II형 (54.4%) 과 IV형 (24.8%) 이대부분을차지하였으나, 시대의변화에따라 III형은감소, V형은새로이출현, 증가됨을확인하여, coagulase 항원성변화를보고하였다. 최근에다약제내성 S. aureus 증가는이균주의생물학적특성변화는물론내성인자획득을위한환경적적응력을갖게하는유전자변이도함께이루어질수있다고생각된다. Coagulase 항원성에변화에따른혈청형의특성과 methicillin 내성유전자복합체인 SCCmec 유전자형의특성을비교한결과상당히흥미로운결과를얻었다. Coagulase II형균주는모두 SCCmec II형에속하였고, coagulase IV형은 SCCmec III/IIIA형, coagulase V형은 SCCmec IV형, 그리고 coagulase VII형은 SCCmec IV과 ND에속함으로써, MRSA 내성균주의진화과정에서 coagulase 관련유전자와 SCCmec 유전자사이에분자생물학적연관성이있을것으로생각된다. 다약제내성병원감염 MRSA와지역사회관련 MRSA 의증가로인하여 S. aureus의내성획득기전과전파경로, 진화에관한많은연구가이루어지고있다 (1, 8, 29). 본연구결과에서 SCCmec II형과 III/IIIA형은 teicoplanin, SXT, vancomycin을제외한약제에내성을나타내었으며, SCCmec IV형은 beta-lactam계와 erythromycin을제외한약제에감수성을나타내었다. SCCmec II형에서만 glycopeptide 계열인 teicoplanin 약제에일부내성을가지고있어 vancomycin resistant S. aureus (VRSA) 로될가능성은 II 형이높은것으로생각된다. 그리고 SCCmec III과 IIIA형

7 Correlation between SCCmec Type and Coagulase Serotype in MRSA 77 에서 SXT 항생제에대한감수성의차이를보임으로써 SCCmec III형의 subtype에서생물학적차이가있음을확인하였다. VRSA을포함한새로이진화된 MRSA 균주의출현은전세계적으로심각한문제로다루어지고있다. 우리나라에서도병원감염 MRSA 뿐아니라지역사회관련 MRSA에관한관심과역학적인연구가점차증가하고있다. 다양하고첨단적인분석기법을통하여새로이출현된변이균주의유전적특성과그기작을연구하고있으나, 보다쉽게분석가능한 S. aureus의 coagulase형과항생제감수성시험의지속적인분석결과는 SCCmec형분석과함께 MRSA 변이균주의출현과그특성을확인할수있으며, 또한 coagulase형과 SCCmec형의연관성에관한본실험결과는 MRSA 균주의내성유전자를비롯한분자역학적인연구에기초자료로활용될수있으리라기대한다. 참고문헌 1) Chamber HF. The changing epidemiology of Staphylococcus aureus? Emerg Infect Dis 2001;7: ) Eady EA, Cove JH. Staphylococcal resistance revisited: community-acquired methicillin resistant Staphylococcus aureus-an emerging problem for the management of skin and soft tissue infections. Curr Opin Infect Dis 2003;16: ) Lee YS, Kim HB, Yoo JI, Yang SJ, Sa CM, Choi YH, Kim BS. Molecular epidemiology of methicillin resistant Staphylococcus aureus in Korea. The Report of National Institute of Health 1999;36: ) Kim JS, Kim HS, Song WK, Cho HC, Lee KM, Kim EC. Molecular epidemiology of methicillin-resistant Staphylococcus aureus isolates with toxic shock syndrome toxin and staphylococcal enterotoxin C genes. Korean J Lab Med 2007; 27: ) Daum RS, Ito T, Hiramatsu K, Hussain F, Mongkolrattanothai K, Jamklang M, Boyle-Vavra S. A novel methicillin-resistance cassette in community-acquired methicillin-resistant Staphylococcus aureus isolates of diverse genetic backgrounds. J Infect Dis 2002;186: ) Diep BA, Carleton HA, Chang RF, Sensabaugh GF, Perdreau- Remington F. Roles of 34 virulence genes in the evolution of hospital-and community-associated strains of methicillinresistant Staphylococcus aureus. J Infect Dis 2006;193: ) Kilic A, Li H, Stratton CW, Tang YW. Antimicrobial susceptibility patterns and staphylococcal cassette chromosome mec types of as well as Panton-Valentine leukocidin occurrence among, methicillin-resistant Staphylococcus aureus isolates from children and adults in middle Tennessee. J Clin Microbiol 2006;44: ) Boyle-Vavra S, Ereshefsky B, Wang CC, Daum RS. Successful multiresistant community-associated methicillin-resistant Staphylococcus aureus lineage from Taipei, Taiwan, that carries either the novel Staphylococcal chromosome cassette mec (SCCmec) type VT or SCCmec type IV. J Clin Microbiol 2005;43: ) Ito T, Ma XX, Takeuchi F, Okuma K, Yuzawa H, Hiramatsu K. Novel type V staphylococcal cassette chromosome mec driven by a novel cassette chromosome recombinase, ccrc. Antimicrob Agents Chemother 2004;48: ) Oliveira DC, de Lencastre H. Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother 2002;46: ) Hisata K, Kuwahara-Arai K, Yamanoto M, Ito T, Nakatomi Y, Cui L, Baba T, Terasawa M, Sotozono C, Kinoshita S, Yamashiro Y, Hiramatsu K. Dissemination of methicillinresistant staphylococci among healthy Japanese children. J Clin Microbiol 2005;43: ) Liu Y, Wang H, Du N, Shen E, Chen H, Niu J, Ye H, Chen M. Molecular evidence for spread of two major methicillinresistant Staphylococcus aureus clones with a unique geographic distribution in Chinese hospitals. Antimicrob Agents Chemother 2009;53: ) Durand G, Bes M, Meugnier H, Enright MC, Forey F, Liassine N, Wenger A, Kikuchi K, Lina G, Vandenesch F, Etienne J. Detection of new methicillin-resistant Staphylococcus aureus clones containing the toxic shock syndrome toxin 1 gene responsible for hospital- and community-acquired infections in France. J Clin Microbiol 2006;44: ) Johnson WM, Tyler SD, Ewan EP, Ashton FE, Pollard DR, Rozee KR. Detection of genes for enterotoxins, exfoliative toxins, and toxic shock syndrome toxin 1 in Staphylococcus aureus by the polymerase chain reaction. J Clin Microbiol 1991;29: ) Kanemitsu K, Yamamoto H, Takemura H, Kaku M, Shimada J. Relatedness between the coagulase gene 3'-end region and

8 78 EK Cha, et al. coagulase serotypes among Staphylococcus aureus strains. Microbiol Immunol 2001;45: ) Watanabe S, Ito T, Takeuchi F, Endo M, Okuno E, Hiramatsu K. Structural comparison of ten serotypes of staphylocoagulases in Staphylococcus aureus. J Bacteriol 2005;187: ) Ishino K, Tsuchizaki N, Ishikawa J, Hotta K. Usefulness of PCR-restriction fragment length polymorphism typing of the coagulase gene to discriminate arbekacin-resistant methicillinresistant Staphylococcus aureus strains. J Clin Microbiol 2007; 45: ) Murakami K, Minamide W, Wada K, Nakamura E, Teraoka H, Watanabe S. Identification of methicillin-resistant strains of staphylococci by polymerase chain reaction. J Clin Microbiol 1991;29: ) Hwang SM, Seki K, Sakurada J, Ogasawara M, Murai M, Ohmayu S, Kurosaka K, Masuda S. Improved methods for detection and serotyping of coagulase from Staphylococcus aureus. Microbiol Immunol 1989;33: ) Clinical and Laboratory Standards Institute (CLSI). Performance standard for antimicrobial susceptibility testing; 15th informational supplement. M100-S15. Clinical and Laboratory Standards Institute, Wayne, PA ) Hanssen AM, Fossum A, Mikalsen J, Halvorsen DS, Bukholm G, Sollid J. Dissemination of Community-acquired methicillinresistant Staphylococcus aureus clones in Northern Norway: sequence type 8 and 80 predominate. J Clin Microbiol 2005; 43: ) Ko KS, Lee JY, Suh JY, Oh WS, Peck KR, Lee NY, Song JH. Distribution of major genotypes among methicillin-resistant Staphylococcus aureus clones in Asian countries. J Clin Microbiol 2005;43: ) Kim JS, Song W, Kim HS, Cho HC, Lee KM, Choi MS, Kim EC. Association between the methicillin resistance of clinical isolates of Staphylococcus aureus, their staphylococcal cassette chromosome mec (SCCmec) subtype classification, and their toxin gene profiles. Diagn Microbiol Infect Dis 2006;56: ) Ma XX, Ito T, Chongtrakool P, Hiramatsu K. Predominance of clones carrying Panton-Valentine Leukocidin genes among methicillin-resistant Staphylococcus aureus strains isolated in Japanese hospitals from 1979 to J Clin Microbiol 2006; 44: ) Zaraket H, Otsuka T, Saito K, Dohmae S, Takano T, Higuchi W, Ohkubo T, Ozaki K, Takano M, Reva I, Baranovich T, Yamamoto T. Molecular characterization of methicillinresistant Staphylococcus aureus in hospitals in Niigata, Japan: Divergence and transmission. Microbiol Immunol 2007;51: ) File TM Jr. Impact of community-acquired methicillin-resistant Staphylococcus aureus in the hospital setting. Cleve Clin J Med 74, suppl 2007;4:S ) Ryu JH, Lee HK. Coagulase typing and antibiotic resistance of methicillin resistant Staphylococcus aureus (MRSA) isolated from patients in Pusan. Kor J Microbiol 2000;36: ) Hwang SM, Kim TU. Changes in coagulase serotype of Staphylococcus aureus isolates in Busan, Korean J Microbiol 2007;43: ) Enright MC, Robinson DA, Randle G, Feil EJ, Grundmann H, Spratt BG. The evolutionary history of methicillin-resistant Staphylococcus aureus (MRSA). Proc Natl Acad Sci USA 2002;99:

Microsoft Word - 03-황수명.doc

Microsoft Word - 03-황수명.doc Journal of Bacteriology and Virology 2011. Vol. 41, No. 3 p.157 164 http://dx.doi.org/10.4167/jbv.2011.41.3.157 Original Article Correlation Between the Prevalence of Superantigenic Toxin Genes and Coagulase

More information

Microsoft Word - 05-김종배.doc

Microsoft Word - 05-김종배.doc J. Exp. Biomed. Sci. 11 (2005) 447 453 Patterns of Antimicrobial Resistance and Detection of meca Gene from Methicillin Resistant Staphylococcus aureus Isolated from Healthcare Facilities and U.S. Military

More information

( )Kju225.hwp

( )Kju225.hwp 비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin

More information

< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770>

< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770> 대한임상검사학회지 : 40권제2호, 75-79, 2008 ISSN 1738-3544 대구지역병원에서분리된 Acinetobacter baumannii와 Pseudomonas aeruginosa의항생제내성현황 대구보건대학임상병리과 1, 세명대학교임상병리학과 2 김수정 1 이재식 2 Antibiotic Resistance Patterns of Acinetobacter

More information

Microsoft PowerPoint - PDFCoTemp.PPT

Microsoft PowerPoint - PDFCoTemp.PPT 주요유방염세균의검출및 항생제감수성검사 임숙경 1. 검사시료 1. 시료채취 유방염우유 2. 체세포수측정 3. 대상세균 - Staphylococcus aureus - Coagulase negative staphylococci -Escherichia coli 3. 균분리방법 E. coli CHEC Agar 직접도말 (37 18-24h) 보라색집락 EMB Agar

More information

2107

2107 대한진단검사의학회지제 28 권제 4 호 2008 Korean J Lab Med 2008;28:286-92 DOI 10.3343/kjlm.2008.28.4.286 원저 임상미생물학 혈액에서분리된 Staphylococcus aureus 의 Coagulase 유전자의다형성과독소유전자에의한유전형분석 김용균 김재석 김한성 송원근 조현찬 이규만 한림대학교의과대학진단검사의학교실

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

세계 비지니스 정보

세계 비지니스 정보 - i - ii - iii - iv - v - vi - vii - viii - ix - 1 - 2 - 3 - - - - - - - - - - 4 - - - - - - 5 - - - - - - - - - - - 6 - - - - - - - - - 7 - - - - 8 - 9 - 10 - - - - - - - - - - - - 11 - - - 12 - 13 -

More information

untitled

untitled Korean J Clin Microbiol Vol. 13, No. 1, March, 2010 DOI: 10.5145/KJCM.2010.13.1.1 Microbiological Characteristics of Methicillin-resistant Staphylococcus aureus Jongyoun Yi 1, *, Eui-Chong Kim 1,2 1 Department

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770> 대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

- i - - ii - - i - - ii - - i - - ii - - iii - - iv - - v - - vi - - vii - - viii - - ix - - x - - xi - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 -

More information

CONTENTS.HWP

CONTENTS.HWP i ii iii iv v vi vii viii ix x xi - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 -

More information

INDUS-8.HWP

INDUS-8.HWP i iii iv v vi vii viii ix x xi 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64

More information

Microsoft Word - 04-정재근.doc

Microsoft Word - 04-정재근.doc Journal of Bacteriology and Virology 2013. Vol. 43, No. 2 p.99 110 http://dx.doi.org/10.4167/jbv.2013.43.2.99 Original Article Characterization of Community-Associated Methicillin-Resistant Staphylococcus

More information

Contents I. 항생제내성 / 감수성기준및용어설명 II. III. 호흡기질병 5 종항생제내성검사결과 소화기질병 3 종항생제내성검사결과

Contents I. 항생제내성 / 감수성기준및용어설명 II. III. 호흡기질병 5 종항생제내성검사결과 소화기질병 3 종항생제내성검사결과 2017 년양돈질병세균 항생제내성검사결과 I Seul Oh ACE of Optipharm ois@optipharm.co.kr 043-249-7532 Contents I. 항생제내성 / 감수성기준및용어설명 II. III. 호흡기질병 5 종항생제내성검사결과 소화기질병 3 종항생제내성검사결과 2018-01-30 2 1. 항생제감수성 / 내성기준 2018-01-30

More information

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*

More information

14.531~539(08-037).fm

14.531~539(08-037).fm G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked

More information

CONTENTS C U B A I C U B A 8 Part I Part II Part III Part IV Part V Part VI Part VII Part VIII Part IX 9 C U B A 10 Part I Part II Part III Part IV Part V Part VI Part VII Part VIII Part IX 11 C U B

More information

A 617

A 617 Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R

More information

00-1표지

00-1표지 summary _I II_ summary _III 1 1 2 2 5 5 5 8 10 12 13 14 18 24 28 29 29 33 41 45 45 45 45 47 IV_ contents 48 48 48 49 50 51 52 55 60 60 61 62 63 63 64 64 65 65 65 69 69 69 74 76 76 77 78 _V 78 79 79 81

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

ORIGINAL ARTICLE Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist

ORIGINAL ARTICLE   Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist ORIGINAL ARTICLE http://dx.doi.org/10.15263/jlmqa.2015.37.4.209 Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resistance: MicroScan versus Etest Goeun Kang, Hyun Soo Kim,

More information

경제통상 내지.PS

경제통상 내지.PS CONTENTS I 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 II 38 39 40 41 42 43 III 46 47 48 49 50 51 52 53 54 55 56 57 58 59 IV 62 63 64 65 66 67 68 69 V

More information

°æÁ¦Åë»ó³»Áö.PDF

°æÁ¦Åë»ó³»Áö.PDF CONTENTS I 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 II 38 39 40 41 42 43 III 46 47 48 49 50 51 52 53 54 55 56 57 58 59 IV 62 63 64 65 66 67 68 69 V

More information

우루과이 내지-1

우루과이 내지-1 U R U G U A Y U r u g u a y 1. 2 Part I Part II Part III Part IV Part V Part VI Part VII Part VIII 3 U r u g u a y 2. 4 Part I Part II Part III Part IV Part V Part VI Part VII Part VIII 5 U r u g u a

More information

( )Kju269.hwp

( )Kju269.hwp 만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University

More information

untitled

untitled ORIGINAL ARTICLE Korean J Clin Lab Sci. Vol. 45, No. 1, Mar. 2013 21 Korean J Clin Lab Sci. 2013, 45(1):21-25 ISSN 1738-3544 Errors of Antibiotic Susceptibility Testing from Automated and Manual Systems

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타 RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 16 Jul.; 27(7), 64662. http://dx.doi.org/./kjkiees.16.27.7.646 ISSN 1226-3133 (Print)ISSN 2288-226 (Online) 2D Microwave Image

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

<B0E6B3B2C1F6BFAA20C1F6BFAABBE7C8B8C8B9B5E620B8DEC6BCBDC7B8B0B3BBBCBA20C8B2BBF6C6F7B5B5BECBB1D5C0C720B9DFBBFDBEE7BBF320B9D720C6AFBCBAC1B6BBE72E687770>

<B0E6B3B2C1F6BFAA20C1F6BFAABBE7C8B8C8B9B5E620B8DEC6BCBDC7B8B0B3BBBCBA20C8B2BBF6C6F7B5B5BECBB1D5C0C720B9DFBBFDBEE7BBF320B9D720C6AFBCBAC1B6BBE72E687770> 제출문 질병관리본부장 귀하 이보고서를 경남지역지역사회획득메티실린내성황색포도알균의발생양상및특성조 사 ( 경북대학교 / 이제철 ) 과제의연구결과보고서로제출합니다. 2006. 4. 5 주관연구기관명 : 경북대학교 주관연구책임자 : 이제철 - 1 - 연구결과보고서요약문 연구과제명 중심단어 경남지역지역사회획득메티실린내성황색포도알균의발생양상및특성조사 지역사회감염, SCCmec,

More information

통신1310_01-도비라및목차1~9

통신1310_01-도비라및목차1~9 ISSN 5-693 13. 1 13. 1 3 1 3 1 i .75 1.5.75 1. 1..9.9 7.5 ) 7.5 ) 3. 1.5 1.5 9. ) 1. ) ii 8 6 8 6 - - 3 1 1 11 1 9 8 7 iii 6 5 6 5 3 3 1 8 1 8 1 1 6 6-1 -1 - - iv . 1.5 1.. 1.5 1..5. -.5.5. -.5

More information

untitled

untitled Korean J Clin Microbiol Vol. 14, No. 1, March, 2011 DOI: 10.5145/KJCM.2011.14.1.18 Prevalence and Clinical Characteristics of Mupirocin-Resistant Staphylococcus aureus A-jin Lee, Hun-Suk Suh, Chang-Ho

More information

- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol

More information

[96_RE11]LMOs(......).HWP

[96_RE11]LMOs(......).HWP - i - - ii - - iii - - iv - - v - - vi - - vii - 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54

More information

책임연구기관

책임연구기관 2009. 2. 책임연구기관 - i - - ii - - iii - - iv - 6.3.1 Sample Collection and Analysis 161 6.3.1.1 Sample Collection 161 6.3.1.2 Sample Analysis 161 6.3.2 Results 162 6.3.2.1 Dalian 162 6.3.2.2 Xiamen 163 6.3.3

More information

2.대상 및 범위(계속) 하천 하천 등급 하천명 연장 (km) 연장 (km) 시점 금회수립현황 종점 지방 하천 함안천 8.40 9.06 경남 함안군 여항면 내곡리 경남 함안군 함안면 함안천(국가)기점 검단천 7.00 3.34 경남 함안군 칠북면 검단리 칠원천 6.70

2.대상 및 범위(계속) 하천 하천 등급 하천명 연장 (km) 연장 (km) 시점 금회수립현황 종점 지방 하천 함안천 8.40 9.06 경남 함안군 여항면 내곡리 경남 함안군 함안면 함안천(국가)기점 검단천 7.00 3.34 경남 함안군 칠북면 검단리 칠원천 6.70 경상남도 고시 제2010-46호 하천기본계획 고시 하천법 제25조 및 같은 법 시행령 제24조의 규정에 따라 수립한 하천 기본계획을 같은 법 시행규칙 제13조에 따라 고시합니다. 2010. 1. 29 경 상 남 도 지 사 1.수립 또는 변경 목적 하천의 효율적인 이용과 계획적이고 체계적인 하천사업추진 및 원활한 유지관리와 하천의 일관된 개발계획을 위하여 하천법

More information

영암군 관광종합개발계획 제6장 관광(단)지 개발계획 제7장 관광브랜드 강화사업 1. 월출산 기( 氣 )체험촌 조성사업 167 (바둑테마파크 기본 계획 변경) 2. 성기동 관광지 명소화 사업 201 3. 마한문화공원 명소화 사업 219 4. 기찬랜드 명소화 사업 240

영암군 관광종합개발계획 제6장 관광(단)지 개발계획 제7장 관광브랜드 강화사업 1. 월출산 기( 氣 )체험촌 조성사업 167 (바둑테마파크 기본 계획 변경) 2. 성기동 관광지 명소화 사업 201 3. 마한문화공원 명소화 사업 219 4. 기찬랜드 명소화 사업 240 목 차 제1장 과업의 개요 1. 과업의 배경 및 목적 3 2. 과업의 성격 5 3. 과업의 범위 6 4. 과업수행체계 7 제2장 지역현황분석 1. 지역 일반현황 분석 11 2. 관광환경 분석 25 3. 이미지조사 분석 45 4. 이해관계자 의견조사 분석 54 제3장 사업환경분석 1. 국내 외 관광여건분석 69 2. 관련계획 및 법규 검토 78 3. 국내 외

More information

공학박사학위 논문 운영 중 터널확대 굴착시 지반거동 특성분석 및 프로텍터 설계 Ground Behavior Analysis and Protector Design during the Enlargement of a Tunnel in Operation 2011년 2월 인하대

공학박사학위 논문 운영 중 터널확대 굴착시 지반거동 특성분석 및 프로텍터 설계 Ground Behavior Analysis and Protector Design during the Enlargement of a Tunnel in Operation 2011년 2월 인하대 저작자표시-비영리-동일조건변경허락 2.0 대한민국 이용자는 아래의 조건을 따르는 경우에 한하여 자유롭게 이 저작물을 복제, 배포, 전송, 전시, 공연 및 방송할 수 있습니다. 이차적 저작물을 작성할 수 있습니다. 다음과 같은 조건을 따라야 합니다: 저작자표시. 귀하는 원저작자를 표시하여야 합니다. 비영리. 귀하는 이 저작물을 영리 목적으로 이용할 수 없습니다.

More information

주간건강과질병 제 12 권제 16 호 연구단신, Brief report 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : s

주간건강과질병 제 12 권제 16 호 연구단신, Brief report 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : s 연구단신, Brief report 2 2013 2017 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : sea2sky@korea.kr, 043-719-7580 Results of healthcare-associated infection

More information

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing

More information

1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus

More information

04_이근원_21~27.hwp

04_이근원_21~27.hwp 1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

433대지05박창용

433대지05박창용 Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This

More information

< B3E2BAB8B0C7BFF8BAB828BAB8B0C72CC3E0BBEA29312E687770>

< B3E2BAB8B0C7BFF8BAB828BAB8B0C72CC3E0BBEA29312E687770> 부산광역시보건환경연구원보제 14 권 (I), 15~27, 2004 Rep. Busan Inst. Health & Environ, Vol.14, 15~27, 2004 미생물과 이주현 Study on the Antimicrobial Susceptbility of Vibrio spp. Isolated from Environmental source and Patients

More information

7.ƯÁýb71ÎÀ¯È« š

7.ƯÁýb71ÎÀ¯È« š J KMA Special Issue Myelodysplastic Syndrome June Won Cheong, MD Yoo Hong Min, MD Department of Internal Medicine, Yonsei University College of Medicine E mail : jwcheong70@yumc.yonsei.ac.kr minbrmmd@yumc.yonsei.ac.kr

More information

National Food & Nutrition Statistics 2011: based on 2008~2011 Korea National Health and Nutrition Examination Survey (Ⅱ) i ii iii iv v vi vii viii ix (N=33,745, 단위 : g) (N=33,745, 단위 : g) (N=33,745,

More information

- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α

More information

israel-내지-1-4

israel-내지-1-4 israel-내지-1-4 1904.1.1 12:49 AM 페이지1 mac2 2015. 11 Contents S T A T E O F I S R A E L 8 Part I Part II Part III Part IV Part V Part VI Part VII Part VIII 9 S T A T E O F I S R A E L 10 Part I Part

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4) THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method

More information

9(3)-4(p ).fm

9(3)-4(p ).fm w wz J. Kor. Soc. Cloth. Ind. 9«3y, 2007 Vol. 9, No. 3, pp.319-326(2007) w xk x p w q w Analysis of Foot Characteristics According to the Classification of Foot Types of Junior High School Girls Ji-Young

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

<3037C1D6BCBCC0CD2E687770>

<3037C1D6BCBCC0CD2E687770> 대한임상검사학회지 : 38 권제 1 호, 38-44, 2006 포도구균의 Erythromycin 유도성 Clindamycin 내성검출을위한간편한디스크확산법의유용성 서울대학교병원진단검사의학과 1, 서울대학교의과대학검사의학교실 2 주세익 1 이현 1 임규상 1 김의종 1, 2 An Easy Method of Disk Diffusion Antibiotic Susceptibility

More information

i ii iii iv v vi vii viii 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 XXXXXXXX 22 24 25 26 27 28 29 30 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61

More information

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling

More information

1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.

More information

12(2) fm

12(2) fm Journal of Dental Hygiene Science Vol. 12, No. 2, pp. 109~113 (2012) 임상에서분리한 Streptococcus pneumoniae 에서 Levofloxacin 내성유전자의비교연구 최재민 1 박선희 1 윤지아 1 한양금 2 이인수 1 1 한남대학교생명공학과, 2 대전보건대학교치위생 ( 학 ) 과 Comparative

More information

Original Article Infect Chemother 2012;44(4): pissn eissn Infection & Chemothera

Original Article   Infect Chemother 2012;44(4): pissn eissn Infection & Chemothera Original Article http://dx.doi.org/10.3947/ic.2012.44.4.289 Infect Chemother 2012;44(4):289-298 pissn 2093-2340 eissn 2092-6448 Infection & Chemotherapy 다중시설을이용한시민의손에서분리된황색포도알균의항생제내성및메티실린내성황색포도알균의분자역학적특성

More information

Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI: 3 * Effects of 9th

Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI:   3 * Effects of 9th Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp.357-378 DOI: http://dx.doi.org/10.21024/pnuedi.29.2.201906.357 3 * Effects of 9th Grade Students Participation in Career Curriculum Cluster

More information

1..

1.. Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :

More information

Table 1. Allelic profiles of 194 C. jejuni analyzed in this study Gene locus Fragment length (bp) No. of alleles No. of polymorphic sites (%) Ave. p d

Table 1. Allelic profiles of 194 C. jejuni analyzed in this study Gene locus Fragment length (bp) No. of alleles No. of polymorphic sites (%) Ave. p d 연구논문, Research article 국내설사환자분리캄필로박터제주니의유전형분석 질병관리본부감염병분석센터세균분석과정수미, 강병학, 홍사현, 김재옥 * * 교신저자 : kimjo70@korea.kr, 043-719-8110 Genetic analysis of Campylobacter jejuni isolates from diarrheal patients in

More information

Æ÷Àå½Ã¼³94š

Æ÷Àå½Ã¼³94š Cho, Mun Jin (E-mail: mjcho@ex.co.kr) ABSTRACT PURPOSES : The performance of tack coat, commonly used for layer interface bonding, is affected by application rate and curing time. In this study, bonding

More information

<C8ADB7C220C5E4C3EBC0E52E687770>

<C8ADB7C220C5E4C3EBC0E52E687770> 하동 화력 7 8호기 건설부지 문화재 지표조사 결과보고서 2005. 01. ( 재) 우리문화재연구원 하동 화력 7 8호기 건설부지 문화재지표조사 결과보고서 Ⅰ. 조사개요 1. 조 사 명 : 하동 화력 78 호기 건설부지 문화재지표조사 2. 조사지역 : 경남 하동군 금성면 가덕리 1336답 일원 3. 조사 면적 : 134,204m2 4. 조사 목적 한국남부발전(

More information

005송영일

005송영일 Received : 2015. 12. 09 Reviewed : 2015. 12. 16 Accepted : 2015. 12. 16 Sternal Fracture occurred after Thai Massage : A Case Report Young-Il Song, K.M.D. 1, Dong-Eun Kim, K.M.D. 1 1 Department of Rehabilitation

More information

..........5-45..

..........5-45.. K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals

More information

석사논문.PDF

석사논문.PDF ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh

More information

- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -

More information

Microsoft Word - 05-황수명.doc

Microsoft Word - 05-황수명.doc Journal of Bacteriology and Virology 2013. Vol. 43, No. 2 p.111 119 http://dx.doi.org/10.4167/jbv.2013.43.2.111 Original Article Molecular Typing of Cryptococcus neoformans Isolated from Korean Patients

More information

jaeryomading review.pdf

jaeryomading review.pdf 4 5 6 7 8 9 10 11 12 13 1. S. Kim, H. Y. Jeong, S. K. Kim, S. Y. Choi and K. J. Lee, Nano Lett. 11, 5438 (2011). 2. E. Menard, K. J. Lee, D. Y. Khang, R. G. Nuzzo and J. A. Rogers, Appl. Phys. Lett. 84,

More information

09-감마선(dh)

09-감마선(dh) Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected

More information

À̶õ°³È²³»Áö.PDF

À̶õ°³È²³»Áö.PDF Islamic Republic of Iran I I S L A M I C R E P U B L I C O F I R A N 10 Part I 11 I S L A M I C R E P U B L I C O F I R A N 12 Part I 13 I S L A M I C R E P U B L I C O F I R A N 14 II I S L A M I C R

More information

???? 1

???? 1 The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial

More information

10 이지훈KICS2015-03-068.hwp

10 이지훈KICS2015-03-068.hwp 논문 15-40-05-10 The Journal of Korean Institute of Communications and Information Sciences '15-05 Vol.40 No.05 http://dx.doi.org/10.7840/kics.2015.40.5.851 가로등 인프라를 활용한 안전한 스마트 방범 시스템 차 정 화, 이 주 용 *, 이

More information

16(2)-7(p ).fm

16(2)-7(p ).fm w wz 16«2y Kor. J. Clin. Pharm., Vol. 16, No. 2. 2006 ü t xy y w tœ ½ BÁ x BC B y w w w C y w w w Current Status and Expectations of Orphan Drugs in Korea -In point of supplying medicines for the rare

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words

More information

untitled

untitled Ann Clin Microbiol Vol. 19, No. 2, June, 2016 http://dx.doi.org/10.5145/acm.2016.19.2.48 pissn 2288-0585 eissn 2288-6850 Distribution and Antimicrobial Resistance of Streptococcus pneumoniae at Four University

More information

목 차 Ⅰ. 조사개요 1 Ⅱ. 용어해설 13 Ⅲ. 조사결과 17 1. 과학기술인력 양성 및 활용에 관한 거시통계 분석 결과 9 1 가. 과학기술인의 양성 현황 19 나. 과학기술인의 취업 현황 24 다. 과학기술인의 경제활동 현황 27 라. 과학기술인의 고용 현황 28

목 차 Ⅰ. 조사개요 1 Ⅱ. 용어해설 13 Ⅲ. 조사결과 17 1. 과학기술인력 양성 및 활용에 관한 거시통계 분석 결과 9 1 가. 과학기술인의 양성 현황 19 나. 과학기술인의 취업 현황 24 다. 과학기술인의 경제활동 현황 27 라. 과학기술인의 고용 현황 28 목 차 Ⅰ. 조사개요 1 Ⅱ. 용어해설 13 Ⅲ. 조사결과 17 1. 과학기술인력 양성 및 활용에 관한 거시통계 분석 결과 9 1 가. 과학기술인의 양성 현황 19 나. 과학기술인의 취업 현황 24 다. 과학기술인의 경제활동 현황 27 라. 과학기술인의 고용 현황 28 2. 과학기술인력 활용 실태조사 분석 결과 23 가. 과학기술인의 고용 및 채용 현황 3

More information

歯1.PDF

歯1.PDF 200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)

More information

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법

More information

2 - ceftazidime-clavulanate 디스크를이용하여 ESBL 생성균주를확인하였다. 또한 2009년도에수집된균주인 P. aeruginosa(386주 ), A. baumannii(349주 ) 를대상으로 imipenem에대한감수성을확인하였고 imipenem-h

2 - ceftazidime-clavulanate 디스크를이용하여 ESBL 생성균주를확인하였다. 또한 2009년도에수집된균주인 P. aeruginosa(386주 ), A. baumannii(349주 ) 를대상으로 imipenem에대한감수성을확인하였고 imipenem-h 1 - 국내종합병원을대상으로한항균제내성모니터링 Monitoring of antimicrobial resistance on general hospitals in Korea 질병관리본부국립보건연구원감염병센터약제내성과 연세대학교의과대학진단검사의학교실, 세균내성연구소 Ⅰ. 들어가는말 항균제내성세균의출현과확산으로인하여세균감염증치료는점점어려워지고있다 [1-4]. 항균제내성률은흔히국가간,

More information

03(12-65)p fm

03(12-65)p fm 한국임상약학회지제 23 권제 1 호 Kor. J. Clin. Pharm., Vol. 23, No. 1. 2013 화상감염소아환자에서분리된주요균종에대한항생제의내성률 강주연 신혜순 * 덕성여자대학교약학대학 (2012 년 12 월 28 일접수 2013 년 3 월 2 일수정 2013 년 3 월 4 일승인 ) Antimicrobial Resistance of Clinically

More information

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu 한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social

More information

10(3)-10.fm

10(3)-10.fm w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction

More information

Microsoft Word - 10-Application of Loop-Mediated Isothermal Amplification (LAMP) Assay to Rapid Detection of Methicillin-Resist

Microsoft Word - 10-Application of Loop-Mediated Isothermal Amplification (LAMP) Assay to Rapid Detection of Methicillin-Resist Biomedical Science Letters 2019, 25(1): 75~82 https://doi.org/10.15616/bsl.2019.25.1.75 eissn : 2288-7415 Original Article Application of Loop-Mediated Isothermal Amplification (LAMP) Assay to Rapid Detection

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap

Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI:   * Strenghening the Cap Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education

More information

서론 34 2

서론 34 2 34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of

More information

(Establishment and Management of Proteomics Core Facility)

(Establishment and Management of Proteomics Core Facility) (Establishment and Management of Proteomics Core Facility) 1 sample running on SDS-PAGE Gel (10well) 163570 10 16357 1D size marker 225500 100 2255 Buffer(20X, 500ml) 119900 20 5995 Staining

More information

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있 대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준

More information

16(1)-3(국문)(p.40-45).fm

16(1)-3(국문)(p.40-45).fm w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University

More information

전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II)

전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) 전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) 전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) - i - - ii - - iii - - iv - - v - - vi - - vii - - viii - - ix - -

More information

12이문규

12이문규 Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental

More information

<30382EC0C7C7D0B0ADC1C22E687770>

<30382EC0C7C7D0B0ADC1C22E687770> 대한내과학회지: 제 76 권 제 2 호 2009 의학강좌-개원의를 위한 모범처방(Current Clinical Practice) 간기능검사의 이해와 적용 인제대학교 의과대학 일산백병원 내과학교실 김 경 아 Understanding and application of liver function tests Kyung-Ah Kim, M.D. Department of

More information

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를 Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는

More information