Microsoft Word - 2-황수명.doc

Size: px

Start display at page:

Download "Microsoft Word - 2-황수명.doc"

현경 범
7 years ago
Views:

1 Journal of Bacteriology and Virology Vol. 39, No. 2 p DOI /jbv Correlation Between Staphylococcal Cassette Chromosome mec Type and Coagulase Serotype of Methicillin-Resistant Staphylococcus aureus Eui Kyung Cha, Kyung Soo Chang and Soo Myung Hwang * Department of Clinical Laboratory Science, Catholic University of Pusan, Busan, Korea Staphylococcal cassette chromosome mec (SCCmec) type and coagulase serotype are important epidemiologic factors in methicillin-resistant Staphylococcus aureus (MRSA). To investigate correlation between SCCmec type and coagulase serotype of MRSA, we analyzed SCCmec types of MRSA strains isolated from clinical sources and compared the results to coagulase serotypes and antimicrobial susceptibility patterns. A total of 108 MRSA isolates were classified into four SCCmec types: II (55.6%), IV (21.3%) III (13.0%) and IIIA (8.3%), and five coagulase serotypes: II (54.6%), IV (21.3%), V (18.5%) and VII (2.8%). All of coagulase type II, IV and V strains belonged to SCCmec type II, III/IIIA and IV, respectively. SCCmec types II, III and IIIA were multidrug resistant, whereas SCCmec type IV strains were non-multidrug resistant except beta-lactams and erythromycin. The data provide that there is a significant correlation between SCCmec types and phenotypic characteristic of coagulase serotypes. Key Words: Staphylococcal cassette chromosome mec type, Methicillin-resistant Staphylococcus aureus, Coagulase serotype 서론 Staphylococcus aureus (S. aureus) 는화농성감염증의주원인균으로서인체에광범위한질환을일으키는병원성세균이다. 1961년영국병원에서처음으로 S. aureus 감염의치료제로광범위하게사용하던 penicillinase-resistant 항생제인 methicillin에내성을가지는 methicillin-resistant S. aureus (MRSA) 균주가출현하였으며, 1970년대이르러서는병원내감염을일으키는중요한세균이되었고, 현재는다약제내성 MRSA의증가로전세계적으로심각한문제로인식되고있다 (1, 2). 우리나라에서도최근에 Received: March 25, 2009/ Revised: April 15, 2009 Accepted: April 20, 2009 * Corresponding author: Soo Myung Hwang. Department of Clinical Laboratory Science, College of Health Sciences, Catholic University of Pusan, Busan , Korea. Phone: , Fax: smhwang@cup.ac.kr ** This works was supported by research fund from Catholic University of Pusan in MRSA 분리율이 70% 이상에이르고있음이보고되었다 (3, 4). 일반적으로 MRSA 감염은병원입원환자에서주로발생하였으나, 최근에는지역사회의집단생활환경에서쉽게전파되어지고있어, 지역사회관련 MRSA (community associated, CA-MRSA) 감염에따른유행성균주출현에대한역학적연구가활발히이루어지고있다 (5~7). MRSA의내성기전은 beta-lactam 계열항생제에대한친화성이낮은 penicillin-binding protein 2a (PBP2a) 의유도생산에의한것으로서 S. aureus 유전체중 staphylococcal cassette chromosome mec (SCCmec) 이라는이동성유전자에위치한 meca 유전자에의하여결정된다. SCCmec 유전자복합체는약 20~67 kb 사이의다양한크기로구성되어있으며, meca 유전자복합체와 chromosomal cassette recombinase (ccr) 유전자복합체를포함한여러인자의조합에따라 5가지 SCCmec형 (I-V) 과여러가지아형으로분류하고있다 (8~10). 또한 SCCmec형의특성에따라병원감염 MRSA와지역사회관련 MRSA 균주의연관성이알려져있어, 이균주의역학적연구에 SCCmec 71

2 72 EK Cha, et al. 유형분석이많이이용되고있다 (11, 12). S. aureus는세포외분비단백질성분으로, coagulase, Panton-Valentine leukocidin (PVL), staphylococcal enterotoxin (SE), toxic shock syndrome toxin-1 (TSST-1) 등과같은여러종류의병독성인자를생성한다 (6, 13, 14). Coagulase 는사람이나동물의 prothrombin을활성화하여섬유소원을섬유소로변환시켜혈장응고에관여하는효소로서 S. aureus의분리동정에결정적인요인으로잘알려져있다. 이단백질의구조적차이에따라항원성이다른 8종 (I-VIII) 의혈청형 (serotype) 이알려져있으며 (15), 최근에는동물에서분리된 S. aureus에서의새로운혈청형 2 종 (IX, X) 이추가되어 10종의혈청형이보고되었다 (16). Coagulase의혈청형과유전자형분석은 S. aureus의역학적연구에유용한자료로이용되고있으며, 다약제내성균주, 분리검체에따라 coagulase의형별특성을나타내고있다 (17). 환경오염, 항생제남용등에의한생태계의변화는다약제내성인자의획득를비롯한병독성인자의변형으로이어져새로운환경에적응할수있는변이균주의출현을가져올것이며, 변이균종에의한감염은치료에어려움은물론치명적인결과를가져올수있으리라생각된다. MRSA 유행균주에대한역학적연구방법이다양하게보고되고있으며, 내성인자획득에의한변이균주의생물유전적특성을규명하기위하여많은연구가이루어지고있다. 본연구에서는 S. aureus의주요효소인 coagulase 항원성의차이에따른약제내성율의변화를확인하고, methicillin 내성유전자가포함된 SCCmec형의특성을분석하여 coagulase형별특성과항생제감수성과의상관성을비교하여 coagulase형별이 SCCmec 유전자획득과 methicillin 및다약제내성에어떠한연계성이있는지연구하고자하였다. 재료및방법실험균주 2005년부산시소재 3개종합병원의임상검체에서분리동정된 MRSA 108주를수집하여실험균주로사용하였다. MRSA 균이분리된검체의종류는농 (n=36), 귀분비물 (n=25), 객담 (n=18), 혈액 (n=7), 피부 (n=6) 뇨 (n=3) 등을포함한 12부위였으며, 화농성검체가대부분을차지하였다. DNA 분리및 methicillin 내성유전자 (meca) 확인균주의 genomic DNA 분리는 AccuPrep Genomic DNA Extraction Kit (Bioneer Co. Ltd., Seoul, Korea) 를이용하여추출하였다. Methicillin 내성유전자인 meca 유전자의검출은 Murakami 등 (18) 의방법을응용하여 PCR법으로실시하였다. PCR 반응혼합액은 AccuPower PCR Premix Kit (Bioneer Co. Ltd.) 를사용하여, DNA 시료 (25 ng) 0.5 μl, primer (10 pmol) 를각각 1 μl 넣고증류수로총 20 μl 로최종부피를맞추었다. PCR 반응조건은 94 에서 5 분간초기반응, 94 30초, 55 30초, 72 30분의과정으로 25회반복하였고, 마지막으로 72 에서 7분연장으로 PCR을종결하였다. 증폭된 DNA 시료는 1.5% agarose gel을통하여전기영동을실시하였고, 증폭산물의크기를확인하여 meca 유전자를확인하였다. SCCmec 유전자형분석 SCCmec 유전자형분석은 Oliveira 등의방법 (10) 에따라 8 locus (A-H) 의 primer를사용하였고 (Table 1), 3조합 (AB, CD 및 E-H) 으로나누어 3번의 multiplex-pcr을실시하였다. PCR 반응혼합액은 AccuPower PCR Premix Kit 를사용하여, DNA 시료 (25 ng) 0.5 μl, 각조합별 primer (10 pmol) 를각각 1 μl 넣고증류수로총 20 μl로최종부피를맞추었다. PCR 조건은 94 에서 4분간초기반응, 94 30초, 53 30초, 72 1분의과정으로 30회반복하였고, 마지막으로 72 에서 4분연장으로 PCR을종결하였다. 증폭된 DNA 시료는 1.5% agarose gel을통하여전기영동을실시하였고, 각증폭산물의크기를확인하여 SCCmec형을결정하였다. Coagulase 혈청형시험 S. aureus의 coagulase 혈청형분석은 8종 (Type I-VIII) 의항혈청 (Denka Seiken Co, Tokyo, Japan) 을사용하여 Hwang 등 (19) 의방법으로분석하였다. Nutrient agar 배지에자란한집락을 5 ml brain heart infusion broth (BHI) 에접종하여 37 shaking incubator에서하룻밤배양한후, 0.1 ml의균배양액을새로운 5 ml BHI broth에접종하여 4~5시간배양하여균의농도가 10 8 CFU/ml 되게조정하고, rpm에서 20분동안원심분리하여그상층액을분석시료로사용하였다. Coagulase 기질용액으로는 polyethylene-aminocarpronic acid-fibrinogen (PAF) 를사용하

3 Correlation between SCCmec Type and Coagulase Serotype in MRSA 73 Table 1. Primers and predicted sizes of PCR products for SCCmec typing Locus Primer names Primer sequence Amplicon sizes (bp) SCCmec type CIF2 F2 A CIF2 R2 KDP F1 B KDP R1 MECI P2 C MECI P3 DCS F2 D DCS R1 RIF4 F3 E RIF4 R9 RIF5 F10 F RIF5 R13 IS431 P4 G pub110 R1 IS431 P4 H pt181 R1 Reference, Oliveria et al. (10) TTCGAGTTGCTGATGAAGAAGG ATTTACCACAAGGACTACCAGC AATCATCTGCCATTGGTGATGC CGAATGAAGTGAAAGAAAGTGG ATCAAGACTTGCATTCAGGC GCGGTTTCAATTCACTTGTC CATCCTATGATAGCTTGGTC CTAAATCATAGCCATGACCG GTGATTGTTCGAGATATGTGG CGCTTTATCTGTATCTATCGC TTCTTAAGTACACGCTGAATCG GTCACAGTAATTCCATCAATGC CAGGTCTCTTCAGATCTACG GAGCCATAAACACCAATAGCC CAGGTCTCTTCAGATCTACG GAAGAATGGGGAAAGCTTCAC 495 I 284 II 209 II, III 342 I, II, IV 243 III 414 III 381 IA 303 IIIA 였다. U-microplate 각 well에항혈청 8종을각각 10 μl 집어넣고, 시료 10 μl를각항혈청이들어있는 well에가하여가볍게혼합한다음실온에서 5분방치하였다. 그다음으로 PAF 기질용액을각 well에 20 μl 넣은후 37 incubator에서 2시간이후부터 30분간격으로형특이 coagulase와항혈청간의중화반응에의한응고억제반응여부를관찰하였다. 항생제감수성시험항생제감수성시험은디스크확산법으로 Clinical and Laboratory Standard Institute (CLSI) 기준에따라실시하였다 (20). 항생제의종류는 penicillin, oxacillin, clindamycin, ciprofloxacin, erythromycin, gentamicin, tetracycline, teicoplanin, trimethoprim-sulfamethoxazole (SXT), vancomycin을사용하였다. 결과 Methicillin 내성균주로부터 meca 유전자확인환자의가검물에서분리된 S. aureus 중항생제감수성 Figure 1. Detection of meca genes from MRSA isolates by PCR. Lane 1: S. aureus (ATCC25923), Lanes 2 to 3: MRSA isolates, Lanes 4 to 5: MSSA isolates, M, molecular markers, 100 bp DNA ladder (Bioneer). 시험결과에서 oxacillin 내성균주로확인된총 108 MRSA 균주를대상으로 meca 유전자에대한특이 primer를이용하여 PCR을실시한결과, 모든 MRSA 균주에서 533 bp 크기의 meca 유전자가검출되었다 (Fig. 1). SCCmec 유전자형 Methicillin 내성유전자가확인된 MRSA의 SCCmec 유전자형을 8종의 primer를조합하여 multiplex-pcr을이용하여분석한결과, 4종류의형이확인되었다 (Fig. 2).

4 74 EK Cha, et al. Figure 2. SCCmec types identified by multiplex PCR. Lanes 1, 4, 7, 10 (loci A and B primers ): lanes 2, 5, 8, 11 (loci C and D): lanes 3, 6, 9, 12 (loci E to H): SCCmec type II, lanes 1 to 3 (284 bp, 209 bp, 342 bp): type III, lanes 4 to 6 (209 bp, 243 bp, 414 bp): type IIIA, lanes 7 to 9 (209 bp, 243 bp, 303 bp, 414 bp): type IV, lanes 10 to 12 (342 bp). M, molecular markers, 100 bp DNA ladder (Bioneer). Table 2. SCCmec types of MRSA strains isolated from clinical sources SCCmec type Source No. of strains I II III IIIA IV ND Pus Ear discharge Sputum Blood Skin Pleural fluid Ascitic fluid Urine Catheter tips Nasal discharge Throat Stool Total 108 (100) 0 60 (55.6) 14 (13.0) 9 (8.3) 23 (21.3) 2 (1.9) ND, Not Determined SCCmec II형은 loci B (284 bp), C (209 bp), D (342 bp) primer 에의하여결정되었으며, III형은 loci C (209 bp), E (243 bp), F (414 bp) 로, IIIA형은 C (209 bp), E (243 bp), F (414 bp), H (303 bp), IV형은 locus D (342 bp) 의결과로확인되었다. SCCmec I형은검출되지않았다. 가장분리율이높은 SCCmec형은 II형으로 60주 (55.6%) 이었으며, III/IIIA 형이각각 14주 (13%) 와 9주 (8.3%), IV형이 23주 (21.3%) 이었으며, SCCmec형이결정되지않은균주는 2주 (1.9%) 이었다 (Table 2). 임상검체별로 SCCmec 유형을살펴보면, II형은피부검체를제외한모든검체에서높은빈도로분리되었으며, III/IIIA형은주로농과귀분비물에서, IV형은농과귀분비물및피부검체에서분리되었다. 호흡기계통의객담과인후검체에서는 II형이주로분리됨으로서, 검체의종류에따라 SCCmec 유형의특성을나타내었다. Coagulase 혈청형 MRSA 균주의 coagulase 혈청형을분석한결과, I형, VI 형, VIII형을제외한 5종의 coagulase형이분리되었으며, 이중에서 coagulase II형이 59주 (54.6%) 로가장분리율이높았으며, IV형 : 23주 (21.3%), V형 : 20주 (18.5%), VII형 : 3 주 (2.8%), III형 : 1주 (0.9%) 의순이었으며, 혈청형이결정되지않은형 (ND) 이 2주 (1.9%) 이었다. 임상검체별로 coagulase형을살펴보면, II형은피부검체를제외한모든검체에서높은빈도로분리되었고, IV형은주로농과귀분비물에서, V형은농과귀분비물및피부등의표재성화농검체에서분리되는것으로확인하였다. 호흡기계통의객담과인후검체에서는주로 II형이분리됨으로서검체의종류에따라 coagulase형도 SCCmec형과동일한양상을나타내었다 (Table 3).

5 Correlation between SCCmec Type and Coagulase Serotype in MRSA 75 Source No. of strains (%) Table 3. Distribution of coagulase serotypes of MRSA strains Coagulase serotype I II III IV V VI VII VIII ND Pus Ear discharge Sputum Blood Skin Pleural fluid Ascitic fluid Urine Catheter tips Nasal discharge Throat Stool Total 108 (100) 0 (0) 59 (54.6) 1 (0.9) 23 (21.3) 20 (18.5) 0 (0) 3 (2.8) 0 (0) 2 (1.9) ND, Not Determined Table 4. Correlation between SCCmec type and coagulase serotype of MRSA SCCmec type No. of strains Coagulase serotype II III IV V VII ND II III IIIA IV ND Total ND, Not Determined SCCmec 형과 coagulase 형의상관성 SCCmec형과 coagulase형과특성을비교한결과는 Table 4와같다. 59주의 coagulase II형은모두 SCCmec II형에속하였고, 23주의 coagulase IV형은 SCCmec III/IIIA형, 20 주의 coagulase V형은모두 SCCmec IV형으로일치를나타내었고, coagulase VII형 3주는 SCCmec IV형 1주와 ND 2주로분류되어, 검체별특성과함께 SCCmec형과 coagulase형두유형간의연계성이있음을확인하였다. Table 5. Antimicrobial susceptibility profile of MRSA strains according to SCCmec Antimicrobial agent SCCmec 형과항생제감수성 No. (%) of susceptible isolates Type II Type III Type IIIA Type IV Penicillin 0 (0) 0 (0) 0 (0) 0 (0) Oxacillin 0 (0) 0 (0) 0 (0) 0 (0) Clindamycin 7 (11.7) 1 (7.1) 1 (11.1) 22 (95.6) Ciprofloxacin 2 (3.3) 0 (0) 0 (0) 23 (100) Erythromycin 1 (1.7) 0 (0) 0 (0) 5 (21.7) Gentamycin 0 (0) 0 (0) 0 (0) 20 (86.9) Tetracycline 0 (0) 0 (0) 0 (0) 22 (96.8) Teicoplanin 57 (95.0) 14 (100) 9 (100) 23 (100) Trimethoprim- 56 (93.3) Sulfamethoxazole 11 (78.6) 2 (22.2) 23 (100) Vancomycin 60 (100) 14 (100) 9 (100) 23 (100) Total 60 (100) 14 (100) 9 (100) 23 (100) SCCmec형에따른 MRSA 균주의항생제감수성결과는 Table 5와같다. SCCmec II형과 III/IIIA형은 vancomycin, teicoplanin 및 trimethoprim-sulfamethoxazole (SXT) 를제외한 penicillin, oxacillin, clindamycin, ciprofloxacin, erythro-

6 76 EK Cha, et al. mycin, gentamicin, tetracycline 항생제에대하여내성을나타내어거의동일한다약제내성을보였고, IV형의경우 penicillin, oxacillin과 erythromycin을제외한나머지항생제에대하여감수성을나타내었다. SCCmec II형에서일부 teicoplanin에내성을나타내었으며, SCCmec IIIA형은 SXT에대한내성율이 SCCmec II형과 III형보다높은결과로 SCCmec 유형에따라항생제감수성차이가있음을확인하였다. 고찰 SCCmec 유형분석은 MRSA의역학과클론상관성을연구하는데매우중요한지표로서많은연구가이루어지고있다 (11, 21). SCCmec 유전자는 meca 유전자와 cassette chromosome recombinase (ccr) 를갖고있는유일한이동성유전인자로서 ccr에의하여 chromosome에통합되어존재하며, mec 유전자복합체 (IS431-mecA, IS1272- meca, meci-mecri) 와 ccr 유전자복합체 (ccra, ccrb, ccrc) 의차이에의하여 I형에서 V형으로나누어진다 (8, 9, 17). 특히다약제내성인병원감염의 MRSA인경우 SCCmec I형, II형및 III형의분리율이높으며, 상대적으로유전자크기가작은 SCCmec IV형의경우지역사회관련 MRSA 균주로알려져있다 (7, 22). 본실험결과에서 SCCmec II형 (55.6%) 이가장많이분리되었으며, 그다음으로 IV 형 (21.3%), III형 (13%), IIIA형 (8.3%) 순으로분리되었다. 이와같은결과는우리나라와일본에서 (23~25) SCCmec II형의분리율이높은결과와일치하였다. Kilic 등 (7) 은테네시주지역 1315주 MRSA의 SCCmec형분석에서 II 형 34.1%, IV형 64.4% 로보고하였고, Liu 등 (12) 은타이완에서분리된 187주 MRSA에서 III형 71.7%, IV형 24.1% 로분리되어, SCCmec형의지역간의차이가있음을확인하였다. 임상검체에따른 SCCmec형을살펴보면, 농과귀분비물검체에서 II형을포함하여 III/IIIA형, IV형이모두분리되었으며, 피부검체에서는 IV형이분리되었다. 객담과인후검체에서는 II형이분리되어, 임상검체에따라 SCCme형의차이를나타내었다. SCCmec IV형 MRSA는병력이나다른소인이없는집단인지역사회감염균으로 (CA-MRSA) 로알려지면서독소생성능과항생제감수성등의특성에따라병원내감염 MRSA와구별된다 (26). 본실험에서 SCCmec IV형 MRSA 균주는주로표재성화농검체에서분리되었으며, 환자병력과함께역학조사를 실시함으로써유행균주의특성을확인할수있으리라기대한다. S. aureus가생성하는 coagulase는그구조적차이에의하여항원성이다른 10종의혈청형이알려져있으며, 일본을중심으로많은연구가이루어지고있다. 다약제내성 MRSA의 coagulase는 II형이대부분을차지하고있는것으로알려져있으나, 일본과우리나라에서의보고된연구결과를비교하여보면, II형을제외한나머지형에서각지역에따라혈청형의차이가있음이보고되었다. Ishino 등 (17) 은 MRSA 472균주의 coagulase형을분석한결과, II형 : 82.4%, IV형 : 7.8%, VII형 : 3.8%, III형 : 2.3%, I형 : 0.9% 로보고하였고, Ryu 등 (27) 은 MRSA 86균주에서 II 형 : 50%, IV형 : 12.5%, III형 : 6.8%, V형을제외한나머지 I, VI, VII, VIII형이각각 4.5% 임을보고한바있다. Hwang 등 (28) 은 1994년에서 2005년분리된 MRSA 408주의 coagulase 혈청형분석한결과에서 II형 (54.4%) 과 IV형 (24.8%) 이대부분을차지하였으나, 시대의변화에따라 III형은감소, V형은새로이출현, 증가됨을확인하여, coagulase 항원성변화를보고하였다. 최근에다약제내성 S. aureus 증가는이균주의생물학적특성변화는물론내성인자획득을위한환경적적응력을갖게하는유전자변이도함께이루어질수있다고생각된다. Coagulase 항원성에변화에따른혈청형의특성과 methicillin 내성유전자복합체인 SCCmec 유전자형의특성을비교한결과상당히흥미로운결과를얻었다. Coagulase II형균주는모두 SCCmec II형에속하였고, coagulase IV형은 SCCmec III/IIIA형, coagulase V형은 SCCmec IV형, 그리고 coagulase VII형은 SCCmec IV과 ND에속함으로써, MRSA 내성균주의진화과정에서 coagulase 관련유전자와 SCCmec 유전자사이에분자생물학적연관성이있을것으로생각된다. 다약제내성병원감염 MRSA와지역사회관련 MRSA 의증가로인하여 S. aureus의내성획득기전과전파경로, 진화에관한많은연구가이루어지고있다 (1, 8, 29). 본연구결과에서 SCCmec II형과 III/IIIA형은 teicoplanin, SXT, vancomycin을제외한약제에내성을나타내었으며, SCCmec IV형은 beta-lactam계와 erythromycin을제외한약제에감수성을나타내었다. SCCmec II형에서만 glycopeptide 계열인 teicoplanin 약제에일부내성을가지고있어 vancomycin resistant S. aureus (VRSA) 로될가능성은 II 형이높은것으로생각된다. 그리고 SCCmec III과 IIIA형

7 Correlation between SCCmec Type and Coagulase Serotype in MRSA 77 에서 SXT 항생제에대한감수성의차이를보임으로써 SCCmec III형의 subtype에서생물학적차이가있음을확인하였다. VRSA을포함한새로이진화된 MRSA 균주의출현은전세계적으로심각한문제로다루어지고있다. 우리나라에서도병원감염 MRSA 뿐아니라지역사회관련 MRSA에관한관심과역학적인연구가점차증가하고있다. 다양하고첨단적인분석기법을통하여새로이출현된변이균주의유전적특성과그기작을연구하고있으나, 보다쉽게분석가능한 S. aureus의 coagulase형과항생제감수성시험의지속적인분석결과는 SCCmec형분석과함께 MRSA 변이균주의출현과그특성을확인할수있으며, 또한 coagulase형과 SCCmec형의연관성에관한본실험결과는 MRSA 균주의내성유전자를비롯한분자역학적인연구에기초자료로활용될수있으리라기대한다. 참고문헌 1) Chamber HF. The changing epidemiology of Staphylococcus aureus? Emerg Infect Dis 2001;7: ) Eady EA, Cove JH. Staphylococcal resistance revisited: community-acquired methicillin resistant Staphylococcus aureus-an emerging problem for the management of skin and soft tissue infections. Curr Opin Infect Dis 2003;16: ) Lee YS, Kim HB, Yoo JI, Yang SJ, Sa CM, Choi YH, Kim BS. Molecular epidemiology of methicillin resistant Staphylococcus aureus in Korea. The Report of National Institute of Health 1999;36: ) Kim JS, Kim HS, Song WK, Cho HC, Lee KM, Kim EC. Molecular epidemiology of methicillin-resistant Staphylococcus aureus isolates with toxic shock syndrome toxin and staphylococcal enterotoxin C genes. Korean J Lab Med 2007; 27: ) Daum RS, Ito T, Hiramatsu K, Hussain F, Mongkolrattanothai K, Jamklang M, Boyle-Vavra S. A novel methicillin-resistance cassette in community-acquired methicillin-resistant Staphylococcus aureus isolates of diverse genetic backgrounds. J Infect Dis 2002;186: ) Diep BA, Carleton HA, Chang RF, Sensabaugh GF, Perdreau- Remington F. Roles of 34 virulence genes in the evolution of hospital-and community-associated strains of methicillinresistant Staphylococcus aureus. J Infect Dis 2006;193: ) Kilic A, Li H, Stratton CW, Tang YW. Antimicrobial susceptibility patterns and staphylococcal cassette chromosome mec types of as well as Panton-Valentine leukocidin occurrence among, methicillin-resistant Staphylococcus aureus isolates from children and adults in middle Tennessee. J Clin Microbiol 2006;44: ) Boyle-Vavra S, Ereshefsky B, Wang CC, Daum RS. Successful multiresistant community-associated methicillin-resistant Staphylococcus aureus lineage from Taipei, Taiwan, that carries either the novel Staphylococcal chromosome cassette mec (SCCmec) type VT or SCCmec type IV. J Clin Microbiol 2005;43: ) Ito T, Ma XX, Takeuchi F, Okuma K, Yuzawa H, Hiramatsu K. Novel type V staphylococcal cassette chromosome mec driven by a novel cassette chromosome recombinase, ccrc. Antimicrob Agents Chemother 2004;48: ) Oliveira DC, de Lencastre H. Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother 2002;46: ) Hisata K, Kuwahara-Arai K, Yamanoto M, Ito T, Nakatomi Y, Cui L, Baba T, Terasawa M, Sotozono C, Kinoshita S, Yamashiro Y, Hiramatsu K. Dissemination of methicillinresistant staphylococci among healthy Japanese children. J Clin Microbiol 2005;43: ) Liu Y, Wang H, Du N, Shen E, Chen H, Niu J, Ye H, Chen M. Molecular evidence for spread of two major methicillinresistant Staphylococcus aureus clones with a unique geographic distribution in Chinese hospitals. Antimicrob Agents Chemother 2009;53: ) Durand G, Bes M, Meugnier H, Enright MC, Forey F, Liassine N, Wenger A, Kikuchi K, Lina G, Vandenesch F, Etienne J. Detection of new methicillin-resistant Staphylococcus aureus clones containing the toxic shock syndrome toxin 1 gene responsible for hospital- and community-acquired infections in France. J Clin Microbiol 2006;44: ) Johnson WM, Tyler SD, Ewan EP, Ashton FE, Pollard DR, Rozee KR. Detection of genes for enterotoxins, exfoliative toxins, and toxic shock syndrome toxin 1 in Staphylococcus aureus by the polymerase chain reaction. J Clin Microbiol 1991;29: ) Kanemitsu K, Yamamoto H, Takemura H, Kaku M, Shimada J. Relatedness between the coagulase gene 3'-end region and

8 78 EK Cha, et al. coagulase serotypes among Staphylococcus aureus strains. Microbiol Immunol 2001;45: ) Watanabe S, Ito T, Takeuchi F, Endo M, Okuno E, Hiramatsu K. Structural comparison of ten serotypes of staphylocoagulases in Staphylococcus aureus. J Bacteriol 2005;187: ) Ishino K, Tsuchizaki N, Ishikawa J, Hotta K. Usefulness of PCR-restriction fragment length polymorphism typing of the coagulase gene to discriminate arbekacin-resistant methicillinresistant Staphylococcus aureus strains. J Clin Microbiol 2007; 45: ) Murakami K, Minamide W, Wada K, Nakamura E, Teraoka H, Watanabe S. Identification of methicillin-resistant strains of staphylococci by polymerase chain reaction. J Clin Microbiol 1991;29: ) Hwang SM, Seki K, Sakurada J, Ogasawara M, Murai M, Ohmayu S, Kurosaka K, Masuda S. Improved methods for detection and serotyping of coagulase from Staphylococcus aureus. Microbiol Immunol 1989;33: ) Clinical and Laboratory Standards Institute (CLSI). Performance standard for antimicrobial susceptibility testing; 15th informational supplement. M100-S15. Clinical and Laboratory Standards Institute, Wayne, PA ) Hanssen AM, Fossum A, Mikalsen J, Halvorsen DS, Bukholm G, Sollid J. Dissemination of Community-acquired methicillinresistant Staphylococcus aureus clones in Northern Norway: sequence type 8 and 80 predominate. J Clin Microbiol 2005; 43: ) Ko KS, Lee JY, Suh JY, Oh WS, Peck KR, Lee NY, Song JH. Distribution of major genotypes among methicillin-resistant Staphylococcus aureus clones in Asian countries. J Clin Microbiol 2005;43: ) Kim JS, Song W, Kim HS, Cho HC, Lee KM, Choi MS, Kim EC. Association between the methicillin resistance of clinical isolates of Staphylococcus aureus, their staphylococcal cassette chromosome mec (SCCmec) subtype classification, and their toxin gene profiles. Diagn Microbiol Infect Dis 2006;56: ) Ma XX, Ito T, Chongtrakool P, Hiramatsu K. Predominance of clones carrying Panton-Valentine Leukocidin genes among methicillin-resistant Staphylococcus aureus strains isolated in Japanese hospitals from 1979 to J Clin Microbiol 2006; 44: ) Zaraket H, Otsuka T, Saito K, Dohmae S, Takano T, Higuchi W, Ohkubo T, Ozaki K, Takano M, Reva I, Baranovich T, Yamamoto T. Molecular characterization of methicillinresistant Staphylococcus aureus in hospitals in Niigata, Japan: Divergence and transmission. Microbiol Immunol 2007;51: ) File TM Jr. Impact of community-acquired methicillin-resistant Staphylococcus aureus in the hospital setting. Cleve Clin J Med 74, suppl 2007;4:S ) Ryu JH, Lee HK. Coagulase typing and antibiotic resistance of methicillin resistant Staphylococcus aureus (MRSA) isolated from patients in Pusan. Kor J Microbiol 2000;36: ) Hwang SM, Kim TU. Changes in coagulase serotype of Staphylococcus aureus isolates in Busan, Korean J Microbiol 2007;43: ) Enright MC, Robinson DA, Randle G, Feil EJ, Grundmann H, Spratt BG. The evolutionary history of methicillin-resistant Staphylococcus aureus (MRSA). Proc Natl Acad Sci USA 2002;99:

Microsoft Word - 03-황수명.doc

Microsoft Word - 03-황수명.doc Journal of Bacteriology and Virology 2011. Vol. 41, No. 3 p.157 164 http://dx.doi.org/10.4167/jbv.2011.41.3.157 Original Article Correlation Between the Prevalence of Superantigenic Toxin Genes and Coagulase