Microsoft Word - 04-정재근.doc

Save this PDF as:
 WORD  PNG  TXT  JPG
Size: px
Start display at page:

Download "Microsoft Word - 04-정재근.doc"

Transcription

1 Journal of Bacteriology and Virology Vol. 43, No. 2 p Original Article Characterization of Community-Associated Methicillin-Resistant Staphylococcus aureus in Gwangju, Korea Hye-Young Kee, Min Ji Kim, Sun Hee Kim, Se Mi Lee, Sun Kyoung Kim, Dong-Ryong Ha, Eun Sun Kim and Jae Keun Chung * Health Research Department, Health and Environment Institute of Gwangju, Gwangju, Korea Methicillin-resistant Staphylococcus aureus (MRSA) is one of the most important nosocomial pathogens worldwide. This study was performed to investigate the characterization of MRSA isolated from healthy persons in Gwangju area. A total of 404 nasal swab samples was collected during October 2011 and May 2012 in Gwangu, Korea. A survey on MRSA was conducted with meat distributors (n=230), pre-school children (n=108), officers (n=66), respectively. To confirm the MRSA, polymerase chain reaction (PCR) for the S. aureus specific gene and meca gene was performed. A total of 34 (8.4%) MRSA isolates was isolated from 404 nasal swab samples: 6.1% (14/230) from meat distributors, 16.7% (18/108) from pre-school children, and 3.0% (2/66) from officers samples, respectively. The most prevalent antimicrobial resistance observed in the MRSA isolates was to ampicillin 100% (34/34), followed by penicillin 97.1% (33/34), oxacillin 94.1% (32/34) and erythromycin 52.9% (18/34). All MRSA isolates were then characterized by panton-valentine leukocidin (pvl) gene detected by PCR, staphylococcal cassette chromosome mec (SCCmec) typing, and pulsed-field gel electrophoresis (PFGE) with Sma I digestion. 34 MRSA isolates from nasal carriage were pvl gene negative, SCCmec type IV; 73.5% (25/34), type II; 17.6% (6/34), type III; 2.9% (1/34), and untypable; 5.9% (2/34), respectively. 34 MRSA isolates showed 16 PFGE patterns. These results indicated that isolation rates of communityassociated methicillin-resistant S. aureus (CA-MRSA) from healthy persons were low (8.4%), but continuous surveillance and monitoring should be performed to prevent the spread of MRSA in the community. Key Words: Community-associated methicillin-resistant S. aureus, meca gene, Staphylococcal cassette chromosome mec type, Pulsed-field gel electrophoresis 서론황색포도알균 (Staphylococcus aureus) 은그람양성알균으로병원성이강하고조직침습성이높아사람과동물에화농성질환, 패혈증, 뇌수막염및식중독등을일으키는것으로알려져있다 (1). 황색포도알균의치료를위해 1960년에메티실린이개발되어이용되었으나, 항생제의빈번한사용으로 1961년영국에서 methicillin-resistant S. aureus (MRSA) 가처음보고된후세계여러나라에서보고되었다 (2). 우리나라에서도 1960년대이전에는 MRSA 가분리되었다는보고가없었으나, 1980년대부터시작해현재국내 3차의료기관에서분리되는황색포도알균중 MRSA의비율이 70~80% 를넘는다고보고되었다 (3, 4). MRSA는항생제를많이사용하는병원환경이나기구를통해얻게되는대표적인병원내감염으로 (healthcareassociated MRSA, HA-MRSA), 지역사회에서는보균율이낮고감염을잘일으키지않는것으로알려져있다 (5). Received: March 19, 2013/ Revised: May 21, 2013/ Accepted: May 24, 2013 * Corresponding author: Jae Keun Chung. Health & Environment Institute of Gwangju, 898 Hwajung-dong, Seo-gu, Gwangju , Korea. Phone: , Fax: , jkchung@korea.kr ** This research was supported by Health & Environment Institute of Gwangju Metropolitan City. CC This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( 99

2 100 H-Y Kee, et al. 그러나, 최근외국에서는 MRSA 감염의위험인자가없는사람에서 MRSA 감염이지속적으로증가하는것으로보고되고있다 (6). 이중폐렴이나패혈증등감염의중등도가심각한사례도발생하는것으로나타나 (7), 지역사회관련메티실린내성황색포도알균 (communityassociated MRSA, CA-MRSA) 의역학적변화에대한관심이점차커져가고있는실정이다. MRSA는 β-lactamase에안정하도록개발된항생제인메티실린에내성을보일뿐아니라세파계항생제등 β-lactam을기본구조로하는대다수의 β-lactam계항생제및 aminoglycoside, macrolide, quinolone 등거의모든종류의항생제에대해광범위한내성을나타내는경우가많아보건및건강분야에서중요한문제로대두되고있다 (8). 또한, MRSA에감염되면사용할수있는항생제가극히제한되므로치료에어려움을겪을수있으며심한경우생명이위태로울수도있어사회적문제를야기할수있다. MRSA의내성기전은 β-lactam 계열항생제에대한친화성이낮은 penicillin-binding protein 2a (PBP 2a) 의유도생산에의한것으로황색포도알균유전체중 Staphylococcal cassette chromosome mec (SCCmec) 이라는이동성유전자에위치한 meca 유전자에의해결정된다 (9). SCCmec 유전자복합체는 meca 유전자복합체와 chromosomal cassette recombinase (ccr) 유전자복합체를포함한여러인자의조합에따라 5가지 SCCmec type (I~V) 과여러가지아형으로분류한다 (10~12). 또한 HA- MRSA와 CA-MRSA에따라 SCCmec type간에차이가있어 MRSA 균주의역학관계를파악하는데많이이용되고있다 (13, 14). 최근국내에서는다양한황색포도알균감염사례들이보고되고있으며, 황색포도알균감염증의후향적연구등을통해의료기관과관련한위험인자가없는 CA-MRSA 발생에관한연구가활발히진행되고있으며 (15, 16), HA-MRSA와 CA-MRSA간의연관관계를규명하고자하는연구들이수행되고있다. 따라서, 본연구에서는광주지역에거주하는건강인의비강에존재하는황색포도알균을분리하여 MRSA 분포양상과항생제내성및특성을조사함으로써, 주변에상재되어있을것으로예상되는 CA-MRSA 감염증에대한체계적인연구와 MRSA균관리를위한기초자료로활용하고자하였다. 재료및방법검체채취및전처리 2011년 11월부터 2012년 5월까지광주지역축산업종사자 230명, 취학전아동 108명, 사무직종사자 66명등 404명을대상으로연구참여협조를요청하였고, 참여의사를밝힌사람을대상으로연령, 성별등의자료를작성하였다. 검체채취는비강양쪽에서 Amies transport medium (Yuhan Lab tech, Korea) 을이용하여비강분비물을충분히묻힌후채취하였으며, 채취한검체는가능한 2시간이내에냉장상태를유지하여운반한후즉시실험하였다. MRSA균분리동정균분리동정면봉을이용하여채취한검체를 NaCl (6.5%) 이함유된 muller hinton broth (MHB, Oxoid, England) 에접종하여 37, 16~20시간동안 1차배양하였다. 배양된균액은 cefoxitin (3.5 mg/l) 이함유된 9 ml의 tryptic soy broth (TSB, Oxoid, England) 에 1 ml을접종하여 37, 16~20시간동안 2차증균배양하였다. 2차배양균액을백금이로 chromogenic MRSA agar (Oxoid, Hampshire, UK) 에도말배양후형태, 색깔등이의심되는 colony를시료당 4개이상을선택하여 tryptic soy agar (TSA, Oxoid, England) 에 37, 16~20시간동안순수배양하였다. 배양된균주에대하여황색포도알균균종확인검사를하였고, 특이 primer를이용한 PCR법 (17) 을이용하여최종확인하였다. 유전자확인시험순수분리된 MRSA 균주의단독 colony를각각 tryptic soy agar (TSA, Oxoid, England) 에 37, 24시간동안계대배양한다음, 일정량의특이집락을멸균증류수 1 ml에현탁시키고 14,000 rpm에서 5분간원심분리한후상층액을버리고 0.5 ml의멸균증류수를첨가하여완전히현탁시켰다. 이를끓는물에서 10분간중탕하여세포를완전히파쇄하였고, 14,000 rpm에서 10분간원심분리한후그상층액을 template DNA로사용하였다. meca 내성유전자의검출은 Mason 등 (17) 의방법에따라실험하였으며, polymerase chain reaction (PCR) 반응후, 최종산물의확인은반응액 5 μl를취하여 2% agarose gel에전기영동한후 ethidium bromide (EtBr) 로염색하여

3 Characterization of CA-MRSA in Gwangju 101 Table 1. Primers used in the multiplex polymerase chain reaction (PCR) Name SCCmec a primer Sequence (5' 3') Target Length SCCmec a type B ATTGCCTTGATAATAGCCYTCT ccras-b 937 bp II, IV a3 TAAAGGCATCAATGCACAAACACT ccrc 518 bp III, V IS bp I, IV meca/is bp V Name PVL b toxin primer Sequence (5' 3') Length 433 bp a Staphylococcal cassette chromosome mec, b panton-valentine leukocidin ccrcf 1272F1 5RmecA luk-pv-1 CGTCTATTACAAGATGTTAAGGATAAT GCCACTCATAACATATGGAA TATACCAAACCCGACAACTAC ATCATTAGGTAAAATGTCTGGACATGATCCA ccrcr 1272R1 5R431 luk-pv-2 CCTTTATAGACTGGATTATTCAAAATAT CATCCGAGTGAAACCCAAA CGGCTACAGTGATAACATCC GCATCAASTGTATTGGATAGCAAAAGC ultra violet (UV) 하에서확인하였다. 항생제감수성검사확인된 MRSA 균주의항생제감수성시험은 Kirby- Bauer의 Disc diffusion method (18) 로실험하였다. 먼저 tryptic soy agar (TSA, Oxoid, England) 에서균이순수분리되었음을확인한후탁도계를이용하여균액을 McFarland 0.5로조정하여보정된균액을 muller hinton agar (MHA, Oxoid, England) 에면봉으로골고루도말한후, 디스펜서를이용하여항생제디스크를접종하고 37 에서 18~24시간동안배양하였다. 판독은 Clinical and Laboratory Standards Institute M100-S20 (CLSI, 2008) 기준에따라균억제대를측정하여감수성여부를확인하였다. 시험에사용한항생제 (BD; Becton Dickinson and Company, Cockeysville, MD) 의종류는다음과같다. ampicillin (AM, 10 μg), cefepime (FEP, 30 μg), cefotetan (CTT, 30 μg), ciprofloxacine (CIP, 5 μg), chloramphenicol (C, 30 μg), clindamycin (CC, 2 μg), erythromycin (E, 15 μg), amikacin (CN, 10 μg), imipenem (IPM, 10 μg), oxacillin (OX, 1 μg), penicillin (P, 10 unit), rifampin (RA, 5 μg), tetracycline (TE, 30 μg), trimethoprim/sulfamethoxazole (SXT, 1.25 μg/23.75 μg), vancomycin (Va, 30 μg), cefoxitin (FOX, 30 μg), ceftriaxone (CRO, 30 μg), telithromycin (TEL, 15 μg), amoxicillin/ clavulanic (AmC, 20 μg/10 μg), linenzolid (LZD, 30 μg), cephalothin (CF, 30 μg) 등 21종을사용하였다. MRSA로 확인된균주에대하여 E-test strips (AB BioDisk, Solona, Sweden) 을사용하여 oxacillin (6 μg/ml, Sigma, USA) 의최소억제농도 (MIC) 를검사하였고, S. aureus ATCC 25923을 positive control로사용하였다 (19). MRSA균유전학적특성조사 Staphylococcal cassette chromosome mec (SCCmec) type 분석 MRSA로확인된균주들에대한 SCCmec type 분석은 multiplex PCR법 (20) 을이용하여 Table 1과같이 I-V형의 type을결정하였다. PCR 기기는 GeneAmp PCR system 9700 (Applied Biosystems, MA, USA) 을이용하여 94 에서 4분간 denaturation 후 94 /30초, 53 /30초, 72 /1분의 cycle을 30회실시하고, 72 에서 4분간반응시켰다. PCR 을수행한후 5 μl의 PCR 산물을 2% agarose gel에전기영동한후 EtBr로염색하여 UV 하에서확인하였다. MRSA 독소유전자검출분리된 MRSA로부터병독소유전자인 Panton-Valentine Leukocidin (PVL) 독소를검출하기위해 Lina 등 (21) 의방법에따라실험하였다 (Table 1). PCR 조건은 95 에서 5분간 denaturation 후, 95 /30초, 50 /30초, 72 /1분의 cycle을 35회실시하고, 72 에서 5분간반응시켰다. PCR 을수행한후 5 μl의 PCR 산물을 2% agarose gel에전기영동한후 EtBr로염색하여 UV 하에서확인하였다.

4 102 H-Y Kee, et al. Pulsed-Field Gel Electrophoresis (PFGE) PulseNet Korea network에서사용되는표준시험법으로미국통제예방센터 (CDC; Centers for Disaease Control and Prevention) 의 PulseNet USA와아시아지역 13개국이참여하는 PulseNet Asia Pacific의표준시험법을근간으로제한효소 Sma I (5,000 U, Roche, Penzberg, Germany) 을사용하였다. Agarose plug의제조순수분리된균을 tryptic soy agar (TSA, Oxoid, England) 에접종하여, 표준균주 (Salmonella Breandrup, BAA-664) 와함께 37 에서 16~18시간동안배양하여실험에사용하였다. 1.2% plug용 agarose solution (Seakem gold agarose, Cambrex, Rockland, ME, USA), plug wash TE buffer를 55 항온수조에보관하고, 균주 1개당 mm 폴리에틸렌튜브 1개, 1.5 ml 용량의 microcentrifuge 튜브각 2개, plug mold (Biorad, Hercules, CA, USA) 2 well 씩준비하였다. 폴리에틸렌튜브에 2 ml의 cell suspension TE buffer 를넣고멸균면봉을사용하여 TSA 평판배지로부터균을묻혀 15~20% 의투명도로부유시켰다. 균현탁액 170 μl, lysostaphin (Sigma, USA) 20 μl, lysozyme (Sigma, USA) 10 μl 를잘혼합하여 37 에서 10분간반응한후, proteinase K (20 mg/ml, Invitrogen, Carlsbad, CA, USA) 를첨가하여 micropipette으로천천히 4회정도섞은후바로 plug mold 에넣었다. 섞는횟수를늘리거나거칠게섞을경우에는선명한결과를얻는데방해되므로주의하면서섞어주었다. Plug mold를 4 에서 5분정도굳히면서 ES buffer 1.5 ml과 proteinase K (20 mg/ml, Invitrogen, Carlsbad, CA, USA) 40 μl를 2 ml microcentrifuge tube에준비하였다. Plug lysis 및세척굳은 plug를 plug mold에서꺼내어미리준비해둔 ES buffer로옮기고 96 well microcentrifuge rack에꽂아뚜껑을덮었다. 55 진탕항온수조에 rack을잘고정시킨후 tube가물속에완전히잠기도록하여 150~175 rpm으로 1~1.5시간방치하였다. Plug 세척을위하여 lysis가끝난 plug를 screen cap (Biorad, Hercules, CA, USA) 에옮기고이것들을연결하여플라스틱밀폐용기에넣고 20분동안 5회반복하여세척하였다. 이때밀폐용기가물속에완전히잠기도록하고 150~175 rpm으로 20분을넘기지않도록하였다. 세척이끝난 plug는 2 ml microcentrifuge tube 에 plug wash TE buffer를 1.5 ml씩넣고 4 에보관하거나다음단계로진행하였다. 제한효소처리세척이끝난 plug를슬라이드글라스위에올려놓고 70% 에탄올로닦은 razor blades를이용하여 1 mm 두께로자른다음, 자른절편 2개를 1.5 ml microcentrifuge tube에옮겨 100 μl의제한효소반응액을넣고 37 항온수조에서 4시간동안반응시켰다. 제한효소반응액의조성은 10 restriction enzyme buffer 10 μl, 100 BSA 1 μl, Sma I 40 unit (Roche, Penzberg, Germany) 에멸균증류수를이용하여최종 100 μl를맞추었다. 반응이끝나면제한효소반응액을제거하고 TE buffer를 200 μl를채워넣었다. 전기영동 0.5 TBE (Bioneer, Daejeon, Korea) 를사용하여 1% agarose solution을 gel 크기에맞추어녹여서 55 항온수조에보관하고, 제한효소처리가끝난 plug 절편을꺼내어 agarose gel 성형용 comb (Biorad) 의끝부위에맞춰올려놓은다음여과지로주변의물기를제거하였다. plug가 comb의 lane 끝에일직선이되도록잘배치하여상온에서 2분정도추가로건조시키고항온수조에보관한 1% agarose solution을꺼내어 gel 성형틀안에부었다. 이때 agarose solution을약 1~2 ml 정도남겨서다시항온수조에보관하였다. Gel 성형틀에 plug 절편이붙어있는 comb을제자리에위치시키고, gel을상온에서 30분정도굳힌후 comb을뽑아냈다. Comb에의해만들어진 well에남아있는소량의 agarose solution을넣어채웠다. 이렇게만들어진 gel을 CHEF-Mapper system (Biorad, USA) 을이용하여 0.5 TBE, 6 V/cm, 14 에서 initial time 5.16 초, final time 40.17초의조건으로 18시간동안전기영동하였다. 전기영동이완료되면 500 ml의 EtBr (0.5 μg/ml) 에 gel을넣어 15~20분염색하고, 증류수를이용하여매회 30분씩 2회탈색하였다. 염색및탈색단계는모두빛이차단된상태에서실시하였다. Dendrogram 작성 PFGE 결과는 Tenover 등 (22) 의방법에따라각각의 DNA 위치가다른절편의수에따라서 group을결정하였고, DNA 절편유형을 software Bionumerics version 5.0으로분석하였다. 또한 Dice coefficient similarity (tolerance, 1.5%) 로 Unweighted Pair Group Method with Arithmetic mean (UPGMA) 법에의하여 dendrogram을작성하여균주간의상관관계를비교분석하였다.

5 Characterization of CA-MRSA in Gwangju 103 Table 2. Prevalence of community-associated methicillin-resistant S. aureus (CA-MRSA) isolates from meat distributors, pre-school children and officers Total Meat distributors Pre-school children Officers No. of positive samples / No. of samples (%) No. of samples No. of positive samples (%) No. of samples No. of positive samples (%) No. of samples No. of positive samples (%) Male 16/210 (7.6) (8.4) 56 6 (10.7) 35 0 (0) Female 18/194 (9.3) (3.6) (23.1) 31 2 (6.5) Total 34/404 (8.4) (6.1) (16.7) 66 2 (3.03) Figure 1. Antimicrobial resistance patterns of community-associated methicillin-resistant S. aureus (CA-MRSA) isolates. S, susceptible; I, intermediate; R, resistant; AM ampicillin; FEP cefepime; CTT cefotetan; CIP ciprofloxacinem; C chloramphenicol; CC clindamycin; E erythromycin; CN amikacin; IPM imipenem; OX oxacillin; P penicillin; RA rifampin; TE tetracycline; SXT trimethoprim/sulfamethoxazole; VA vancomycin; FOX cefoxitin; CRO ceftriaxone; TEL telithromycin; AmC amoxicillin/clavulanic; LZD linenzolid; KF, cephalothin 결과 MRSA균분리광주지역에거주하는 404명의비강도말액을대상으로선택배지를이용하여 MRSA를동정한결과 34주 (8.4%) 가분리되었고, 동정된모든균주에서 MRSA 특이유전자인 clfa와 methicillin 내성에관여하는유전자인 meca 를확인하였다. 이를직업군별로살펴보면축산업종사자 230명중 14주 (6.1%), 취학전아동 108명중 18주 (16.7%), 사무직종사자 66명중 2주 (3.03%) 가분리되었다 (Table 2). 항생제감수성검사 MRSA로동정된 34주에대한항생제감수성검사결 과, ampicillin의내성률이 100%(34주 ) 로가장높게나타났고. 그외 penicillin 97.1%(33주 ), oxacillin 94.1%(32주 ), erythromycin 52.9%(18주 ) 의순으로나타났다 (Fig. 1). Cephalosporin 계열항생제내성은 cefoxitin 94.1%(32 주 ), cefotetan 91.2%(31주 ) 로강한내성을보였으며, ceftriaxone 73.5%(25주 ), cephalothin은 26.5%(9주 ) 의내성을보여내성률분포에뚜렷한차이를보였다. 그러나 chloramphenicol, trimethoprim/sulfamethoxazole, imipenem, rifampin, vancomycin, linenzolid 등 6가지항생제에서는전혀내성이관찰되지않았다. 항생제내성양상으로는항생제 1제내성률 2.9%(1주 ), 4제내성률 2.9%(1주 ), 6제내성률 2.9%(1주 ), 8제내성률 23.5%(8주 ), 9제내성률 41.2%(14주 ), 10제내성률 20.6% (7주), 11제내성률 5.9%(2주 ) 순으로나타났다. 즉, 1개균주를제외한모든균주가항생제 2제이상에내성을

6 104 H-Y Kee, et al. Table 3. Antimicrobial resistance patterns of community-associated methicillin-resistant S. aureus (CA-MRSA) isolates No. of antimicrobials Resistance Patterns No. of isolates (%) 1 AM 1 (2.9) 4 AMP-E-P-AMC 1 (2.9) 6 AMP-CTT-CN-OX-P-FOX 1 (2.9) 8 AMP-FEP-CTT-OX-P-FOX-CRO-AMC 8 (23.5) subtotal 14 (41.2) 9 10 AMP-CIP-DA-E-OX-P-TE-FOX-TEL 1 (2.9) AMP-CTT-DA-E-CN-OX-P-FOX-TEL 2 (5.9) AMP-CTT-DA-E-CN-OX-P-FOX-TEL 1 (2.9) AMP-FEP-CTT-E-OX-P-FOX-CRO-AMC 5 (14.7) AMP-FEP-CTT-OX-P-FOX-CRO-AMC 1 (2.9) AMP-FEP-CTT-OX-P-FOX-CRO-AMC-KF 4 (11.8) subtotal 7 (20.6) AMP-CTT-DA-E-CN-OX-P-FOX-TEL-AMC 2 (5.9) AMP-FEP-CTT-CN-OX-P-FOX-CRO-AMC-KF 1 (2.9) AMP-FEP-CTT-E-CN-OX-P-TE-FOX-CRO 1 (2.9) AMP-FEP-CTT-E-OX-P-FOX-CRO-AMC-KF 3 (8.8) subtotal 2 (5.9) 11 AMP-FEP-CTT-E-CN-OX-P-FOX-CRO-AMC-KF 1 (2.9) AMP-CTT-DA-E-CN-OX-P-FOX-CRO-TEL-AMC 1 (2.9) Total 34 AM, Ampicillin; FEP, Cefepime; CTT, Cefotetan; CIP, Ciprofloxacinem; C, Chloramphenicol; CC, Clindamycin; E, Erythromycin; CN, Amikacin; IPM, Imipenem; OX, Oxacillin; P, Penicillin; RA, Rifampin; TE, Tetracycline; SXT, Trimethoprim/Sulfamethoxazole; VA, Vancomycin; FOX, Cefoxitin; CRO, Ceftriaxone; TEL, Telithromycin; AmC, Amoxicillin/Clavulanic; LZD, Linenzolid; KF, Cephalothin 보이는다제내성균 (97.1%) 으로확인되었으며, 10제이상내성률은 26.5%(9주 ) 를보였다. 특히 9제의항생제에내성률을보이는균주의패턴이 6가지유형으로가장다양한결과를보여주었고 (Table 3), oxacillin (6 μg/ml, Sigma, USA) 에대한최소억제농도측정결과 2주를제외한나머지 32주모두내성 (>4 μg/ml) 을보였다. MRSA균 genotyping SCCmec type MRSA로동정된 34주에대해 SCCmec typing을조사한결과 25주 (73.5%) 에서 SCCmec type IV 양상을보였으며, type II는 6주 (17.6%), type III는 1주 (2.9%) 순으로분류되었으나, 2주 (5.9%) 는분석이불가능하였다 (Table 4). PVL 유전자 MRSA로동정된 34주에서병독소유전자인 pvl 유전자는모두검출되지않았다. PFGE 분석이들균주의역학적연관성을확인하기위해 PFGE 분석을실시한결과 STAS16.010(1주 ), STAS16.011(1주 ), STAS16.012(1주 ), STAS16.013(1주 ), STAS16.014(8주 ), STAS16.015(1주 ), STAS16.016(9주 ), STAS16.017(2주 ), STAS16.018(1주 ), STAS16.019(1주 ), STAS16.020(1주 ), STAS16.021(1주 ), STAS16.022(3주 ), STAS16.023(1주 ), STAS16.024(1주 ), STAS16.025(1주 ) 로총 16개의유형으로분류되었으며, 그중 STAS16.016형이가장우세하였다. 또한각유형간유사도는 94.8~52.2% 범위로나타났다 (Fig. 2).

7 Characterization of CA-MRSA in Gwangju 105 Strain Table 4. Characteristics of community-associated methicillin-resistant S. aureus (CA-MRSA) isolates from nasal swabs Characteristics MIC (µg/ml) OX meca a PVL a SCCmec b PFGE GJ-12-N-21 Meat distributor IV STAS GJ-12-N-22 Meat distributor IV STAS GJ-12-N-50 Meat distributor IV STAS GJ-12-N-53 Meat distributor IV STAS GJ-12-N-96 Meat distributor IV STAS GJ-12-N-121 Meat distributor IV STAS GJ-12-N-142 Meat distributor STAS GJ-12-N-159 Meat distributor IV STAS GJ-12-N-175 Meat distributor IV STAS GJ-12-N-180 Meat distributor IV STAS GJ-12-N-198 Meat distributor IV STAS GJ-12-N-213 Pre-school children IV STAS GJ-12-N-233 Officer STAS GJ-12-N-236 Pre-school children IV STAS GJ-12-N-249 Meat distributor IV STAS GJ-12-N-252 Meat distributor IV STAS GJ-12-N-257 Meat distributor III STAS GJ-12-N-262 Pre-school children IV STAS GJ-12-N-268 Pre-school children IV STAS GJ-12-N-275 Pre-school children IV STAS GJ-12-N-289 Pre-school children II STAS GJ-12-N-300 Pre-school children II STAS GJ-12-N-301 Pre-school children II STAS GJ-12-N-302 Pre-school children II STAS GJ-12-N-305 Pre-school children IV STAS GJ-12-N-314 Pre-school children II STAS GJ-12-N-335 Pre-school children IV STAS GJ-12-N-337 Pre-school children IV STAS GJ-12-N-339 Pre-school children IV STAS GJ-12-N-340 Pre-school children IV STAS GJ-12-N-341 Pre-school children IV STAS GJ-12-N-342 Pre-school children II STAS GJ-12-N-343 Pre-school children IV STAS GJ-12-N-401 Officer IV STAS a +, detected; -, not detected b -, untypable

8 106 H-Y Kee, et al. GJ-12-N-289 STAS GJ-12-N-302 STAS Pre-school childr Pre-school childr GJ-12-N-314 STAS Pre-school childr GJ-12-N-300 STAS Pre-school childr GJ-12-N-339 STAS Pre-school childr GJ-12-N-233 STAS Officer GJ-12-N-301 STAS Pre-school childr GJ-12-N-275 STAS Pre-school childr GJ-12-N-342 STAS Pre-school childr GJ-12-N-142 STAS Meat distributor GJ-12-N-257 STAS Meat distributor GJ-12-N-50 STAS Meat distributor GJ-12-N-53 STAS Meat distributor GJ-12-N-121 STAS Meat distributor GJ-12-N-159 STAS Meat distributor GJ-12-N-175 STAS Meat distributor GJ-12-N-180 STAS Meat distributor GJ-12-N-252 STAS Meat distributor GJ-12-N-268 STAS Pre-school childr GJ-12-N-213 STAS Pre-school childr GJ-12-N-96 STAS Meat distributor GJ-12-N-341 STAS Pre-school childr GJ-12-N-236 STAS Pre-school childr GJ-12-N-249 STAS Meat distributor GJ-12-N-262 STAS Pre-school childr GJ-12-N-305 STAS Pre-school childr GJ-12-N-335 STAS Pre-school childr GJ-12-N-337 STAS Pre-school childr GJ-12-N-340 STAS Pre-school childr GJ-12-N-21 STAS Meat distributor GJ-12-N-22 STAS Meat distributor GJ-12-N-343 STAS Pre-school childr GJ-12-N-198 STAS Meat distributor GJ-12-N-401 STAS Officer Figure 2. Dendrogram of Sma I-digested pulsed-field gel electrophoresis (PFGE) profiles of community-associated methicillin-resistant S. aureus (CA-MRSA) isolates. 직업군별로는축산업종사자 14명중 7명이 STAS 형, 취학전아동 18명중 7명에서 STAS16.016형 이가장많음을알수있었다 (Fig. 3).

9 Characterization of CA-MRSA in Gwangju 107 Figure 3. Pulsed-field gel electrophoresis (PFGE) Sma I-pattern of community-associated methicillin-resistant S. aureus (CA-MRSA) isolates. 고찰 MRSA는병원내감염을일으키는중요한세균으로주로병원감염 MRSA가알려져있으나, 최근들어지역사회일반인에서도보고되고있다 (6). 광주지역에거주하는축산업종사자, 집단생활을하는어린이집소아및사무직종사자 404명을대상으로비강분비물을채취하여 MRSA를분리한결과 34주 (8.4%) 가분리되었다. Kim 등 (23) 은지역사회성인의전비공조사결과전체조사대상자의 33% (227/689) 에서황색포도알균을분리하여그중 2.2% (5/227) 의 CA-MRSA를확인하였고, Cho 등 (24) 도지역사회일반인들로부터 MRSA를조사한결과 2.9% 의분리율을보고하였다. 그러나 Kwon 등 (25) 은지역별로무작위선출된일반인의비강에서 27.5% 의황색포도알균을검출하였으나, MRSA는검출되지않았음을보고하였다. 본연구결과에서는앞선연구결과와비교했을때높은양성률을보였으며, 그이유로는동물에존재하는 MRSA가동물에서사람으로인수공통감염병의전파가능성이있음을고려할때검사대상자중에축산업종사자가포함되어있어 MRSA 양성률을높였을가능성이있을것으로사료된다. 하지만, 국내종합병원입원환자의 MRSA 분리율 ( 약 70%) (26, 27) 과비교했을때지역사회를대상으로한본연구결과에서는상당히낮은 MRSA 분리율을보였다. 직업군별분류결과, 취학전아동 108명중 18명 (16.7%) 이 MRSA로분리된것은, Kim 등 (28) 이서울북 부지역어린이집소아 428명중 38명 (8.8%) 의비강에서 MRSA를분리한것에비해높은분리율을보였다. 이를연령별로 3개군으로구분한결과, 2세미만 1명 (0.9%), 2~5세미만 5명 (4.6%), 6세이상에서 12명 (11.1%) 으로본연구는소아들의입원력과수술력등의조사가보호자및선생님들을통해이루어져객관성이부족하다는점과비강내보균여부를 1회만조사하였기때문에 MRSA 보균기간여부를정확하게파악하지못한것이제한점이라생각되지만, Kim 등 (28) 의결과인생후 12~23개월에서 0명, 생후 24~59개월 21명 (10.1%), 생후 60개월이상 12명 (8.1%) 의결과와유사하였고, 연령이증가함에따라비강내 MRSA 분리율이증가하는추세를보였다. 이와같은결과를종합해볼때소아를대상으로한비강내 CA-MRSA 보균율은국가및지역등여러환경적요인에따라다른것으로추측된다. 외국의경우타이완에서는약 10% 전후 (29, 30), 미국에서는 0.5~24% (31) 로나타났고, 국내의경우 Ko 등 (32) 이외래방문소아를대상으로시행한 MRSA 및 CA-MRSA 보균자를조사한결과 6.1% 와 4.7% 로분리율이다양하게나타남을알수있다. 또한, 축산업종사자에대한 MRSA 분리율조사결과, 230명중 14명 (6.1%) 에서 MRSA가분리되었다. 이는황색포도알균이동물의피부에도존재하는균이므로도축과정중가죽에서오염되었을경우, 도축된식육은가공, 소분등의과정을통해유통되는과정에서식육에오염된황색포도알균이식육과접촉한사람으로전이되어상재균화될수있으며, 이과정에서 MRSA의전이가가능했을거라생각된다. 따라서축산물취급시도축과정에

10 108 H-Y Kee, et al. 서부터판매업자까지황색포도알균등의병원균이오염되지않도록철저한위생관리에노력을기울여야할것으로판단된다. 한편, 축산업종사자의근무기간에따른 MRSA 분리율조사결과 5년미만 10명 (7.1%), 10년미만 2명 (5.6%), 15년미만 2명 (5.1%), 15년이상불검출로나타났고근무기간에따른연관성은없는것으로나타났다. 본연구대상에서조사된 8.4% 의 MRSA는 CA-MRSA 감염증의빈도및중요성이상대적으로낮았던국내상황에서향후 CA-MRSA 감염증에대한인식을새로이하는데중요한정보를제공하고있다고생각된다. Choi 등 (15) 이 2004년 ~2007년까지서울대학교어린이병원에서분리된 CA-MRSA에대한항생제내성률조사결과 ciprofloxacin 31%, clindamycin 28%, erythromycin 66%, gentamycin 31% 의내성률을보고하였는데, 본연구에서도 ampicillin, penicillin 100%, oxacillin 94.1%, cefoxitin 94.1%, erythromycin 52.9%, clindamycin 20.6% 의내성률을보여앞선보고와유사한결과를확인했으나, ciprofloxacin (2.9%) 과 trimethoprim-sulfamethoxazole은각각높은감수성을나타내는것으로확인되었다. SCCmec 유전자형은 MRSA의클론성과연관성이있는것으로알려져있어 MRSA 균주의역학분석에많이이용되고있다 (14). SCCmec은 I-V형으로나누어지며 SCCmec I형, II형및 III형은원내감염인반면, SCCmec IV형은지역사회감염과관련이있는것으로알려져있다 (13, 33). 본연구에서 CA-MRSA 34주에대한 SCCmec 유형을분석한결과 type IV가 25주 (73.5%) 를차지하였고, type II가 6주 (17.6%), type III가 1주 (2.9%), 유형분석이불가능한경우가 2주 (5.9%) 였다. 이는 Lee 등 (34) 이보고한서울지역어린이집소아 428명을대상으로한, 비강에서분리한 40주의 CA-MRSA 연구에서 SCCmec type IV가 32주 (80%), SCCmec type II가 8주 (20%) 의결과와비교했을때비슷한양상을보였다. 또한 Kim 등 (35) 은다중시설을이용한시민의손에서분리한 MRSA 11주에대한유형분석결과, SCCmec type IV가 13주, type I 1주가분리되었음을보고하였다. 본연구에서는조사대상의차이에도불구하고병원유래주로알려진 type II, type III 및지역사회유래주인 type IV가모두분리된것은 CA- MRSA와 HA-MRSA와의전파가능성이있음을보여주는것이라생각되며, 향후 CA-MRSA가토착화되지않도록적절한예방대책과지속적인감시가필요하다고생각 된다. PVL 유전자는피부및연조직감염의병독성에중요한역할을하고, 최근에는높은사망률을보이는지역사회관련폐렴에도관련이있는것으로알려져있다 (21). 이유전자는미국의경우 CA-MRSA 대부분에서발견된다고보고되고 (36) 있으나, 아시아지역에서는낮은양성률을보이고 (37), 국내에는대부분존재하지않는것으로보고되고있다. Kim 등 (38) 은입원환자의혈액에서분리된 305개의 MRSA 균주중 1주가 pvl 유전자양성과 SCCmec type IV였음을보고한바있다. 그러나본연구에서는 pvl 유전자가전혀검출되지않았으며, 이는본연구와동일한지역을대상으로한 Kim 등 (35) 의연구에서손에서분리한 MRSA 균에서 pvl 유전자검사결과 ( 음성 ) 와동일한결과를보여, 분리균주간의유전적차이가있음을알수있었다. MRSA로확인된 34주의역학적연관성을알아보기위해 PFGE를실시한결과 STAS 주를비롯하여총 16개의유형으로구분되었으며, 그중 STAS10.016형이가장우세하였다. 직업군별로는축산업종사자 14명중 7명에서 STAS16.014형이, 취학전아동 18명중 7명에서 STAS16.016형이가장많았고, 직업군별역학적연관성은없는것으로나타났다. 미국 CDC에서는 PFGE를이용하여황색포도알균을 Pulsed-field types (PFTs) 8개로분류하여 ( 예, USA 100 PFT, USA 200 PFT, USA 800 PFT) 전국적인데이터베이스를구축운영하고있다 (39). 그러나아직국내에는전국적인데이터베이스가확립되지않아 CA-MRSA 균주간연관성을비교하기가어려웠으며, 향후 PFGE를이용한비강정착균주간의역학적연관성비교나황색포도알균감염증을일으키는균주간의비교및국내외균주를비교하기위해서는황색포도알균에대한 PFGE pattern을표준화해야할필요가있다. 또한이들자료를근거로손이나비강등을통해감염되는 CA-MRSA간역학적연관성비교및 HA-MRSA와 CA- MRSA간의분자유전학적관계등을정확히파악함으로써 MRSA의효율적관리에기여할수있을것이라생각된다. 참고문헌 1) Timoney JF, Gillespie JH, Scott FW, Barlough JE. Hagan and Bruner's Microbiology and Infectious Disease of Domestic

11 Characterization of CA-MRSA in Gwangju 109 Animals. 8th ed. Ithaca: Comstock Publishing Associates; p ) Diederen BM, Kluytmans JA. The emergence of Infections with community-associated methicillin resistant Staphylococcus aureus. J Infect 2006;52: ) Chong Y, Lee K. Present situation of antimicrobial resistant in Korea. J Infect Chemother 2000;6: ) Kim HB, Jang HC, Nam HJ, Lee YS, Kim BS, Park WB, et al. In vitro activities of 28 antimicrobial agents against Staphylococcus aureus isolates from tertiary-care hospitals in Korea: a nationwide survey. Antimicrob Agents Chemother 2004;48: ) Goetz A, Posey K, Fleming J, Jacobs S, Boody L, Wagener MM, et al. Methicillin-resistant Staphylococcus aureus in the community: a hospital-based study. Infect Control Hosp Epidemiol 1999;20: ) Kallen AJ, Driscoll TJ, Thornton S, Olson PE, Wallace MR. Increase in community-acquired methicillin-resistant Staphylococcus aureus at a Naval Medical Center. Infect Control Hosp Epidemiol 2000;21: ) From the Centers for Disease Control and Prevention. Four pediatric deaths from community-acquired methicillin-resistant Staphylococcus aureus-minnesota and North Dakota, JAMA 1999;282: ) Lee JS, Park O, Woo HJ, Jung HJ, Kim WJ, Kim MJ, et al. A Longitudinal Molecular Epidemiologic Study of Methicillinresistant Staphylococcus aureus (MRSA) Isolates from a University Hospital. Korean J Infect Dis 2001;33: ) Chambers HF. Methicillin resistance in Staphylococci: molecular and biochemical basis and clinical implications. Clin Microbiol Rev 1997;10: ) Boyle-Varva S, Ereshefsky B, Wang CC, Daum RS. Successful multiresistant community-associated methicillin-resistant Staphylococcus aureus lineage from Taipei, Taiwan, that carries either the novel staphylococcal chromosome cassette mec (SCCmec) type VT or SCCmec type IV. J Clin Microbiol 2005; 43: ) Ito T, Ma XX, Takeuchi F, Okuma K, Yuzawa H, Hiramatsu K. Novel type V staphylococcal cassette chromosome mec driven by a novel cassette chromosome recombinase, ccrc. Antimicrob Agents Chemother 2004;48: ) Oliveira DC, de Lencastre H. Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother 2002;46: ) Cha EK, Chang KS, Hwang SM. Correlation between staphylococcal cassette chromosome mec type and coagulase serotype of methicillin-resistant Staphylococcus aureus. J Bacteriol Virol 2009;39: ) Chongtrakool P, Ito T, Ma XX, Kondo Y, Trakulsomboon S, Tiensasitorn C, et al. Staphylococcal cassette chromosome mec (SCCmec) typing of methicillin-resistant Staphylococcus aureus strains isolated in 11 Asian countries: a proposal for a new nomenclature for SCCmec elements. Antimicrob Agents Chemother 2006;50: ) Choe YJ, Lee SY, Sung JY, Yang MA, Lee JH, Oh CE, et al. A review of Staphylococcus aureus infections in children with an emphasis on community-associated methicillin-resistant S. aureus infections. Korean J Pediatr Infect Dis 2009;16: ) Park JY, Kim HO, Jeong YG, Kim S, Bae IG. Clinical characteristics and risk factors of community-acquired methicillinresistant Staphylococcus aureus infections: comparison of community-acquired methicillin-susceptible Staphylococcus aureus infections. Infect Chemother 2006;38: ) Mason WJ, Blevins JS, Beenken K, Wibowo N, Ojha N, Smeltzer MS. Multiplex PCR protocol for the diagnosis of staphylococcal infection. J Clin Microbiol 2001;39: ) Bauer AW, Kirby WM, Sherris JC, Turck M. Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathol 1966;45: ) Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; Eighteenth information supplement, M100-S18. Wayne, PA: CLSI, ) Boye K, Bartels MD, Andersen IS, Møller JA, Westh H. A New multiplex PCR for easy screening of methicillin-reistant Staphylococccus aureus SCCmec types I-V. Clin Microbiol Infect 2007;13: ) Lina G, Piémont Y, Godail-Gamot F, Bes M, Peter MO, Gauduchon V, et al. Involvement of Panton-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clin Infect Dis 1999;29: ) Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 1995;33: ) Kim HB, Shin DH, Park KU, Oh MD, Kim EC, Choe KW. The methicillin-resistance rate of Stapylococccus aureus

12 110 H-Y Kee, et al. isolated from anterior nares of healthy adults in the community. Infect Chemother 1998;30: ) Cho JK, Kim JH, Sung MS, Kim KS. Genetic characterization of methicillin-resistant Staphylococcus aureus from humans and animals within the community. Korean J Vet Res 2011; 51: ) Kwon YI, Kim TW, Kim HY, Chang YH, Kwak HS, Woo GJ, et al. Monitoring of methicillin resistant Staphylococcus aureus from medical environment in Korea. Korean J Microbiol Biotechnol 2007;35: ) Kim JS, Kim HS, Song W, Cho HC, Lee KM, Kim EC. Antimicrobial resistance profiles of Staphylococcus aureus isolated in 13 Korean hospitals. Korean J Lab Med 2004;24: ) Lee HW, Yoon JH, Sohn JH, Lee KH, Yeh BI, Park DW, et al. Detection of meca gene in clinical isolates of Staphylococcus aureus by multiplex-pcr, and antimicrobial susceptibility of MRSA. J Microbiol Biotechnol 2003;13: ) Kim YM, Oh CE, Kim SH, Lee J, Choi EH, Lee HJ. Nasal carriage of Staphylococcus aureus from healthy Children Attending Day Care Center. Korean J Pediatr Infect Dis 2010; 17: ) Lo WT, Lin WJ, Tseng MH, Lu JJ, Lee SY, Chu ML, et al. Nasal carriage of a single clone of community-acquired methicillin-resistant Staphylococcus aureus among kindergarten attendees in northern Taiwan. BMC Infect Dis 2007;7:51. 30) Lu PL, Chin LC, Peng CF, Chiang YH, Chen TP, Ma L, et al. Risk factors and molecular analysis of community methicillinresistant Staphylococcus aureus carriage. J Clin Microbiol 2005;43: ) Alfaro C, Mascher-Denen M, Fergie J, Purcell K. Prevalence of methicillin-resistant Staphylococcus aureus nasal carriage in patients admitted to Driscoll Children's Hospital. Pediatr Infect Dis J 2006;25: ) Ko KS, Lee JY, Baek JY, Peck KR, Rhee JY, Kwon KT, et al. Characterization of Staphylococcus aureus nasal carriage from children attending an outpatient clinic in Seoul, Korea. Microb Drug Resist 2008;14: ) Ko KS, Lee JY, Suh JY, Oh WS, Peck KR, Lee NY, et al. Distribution of major genotypes among methicillin-resistant Staphylococcus aureus clones in Asian countries. J Clin Microbiol 2005;43: ) Lee J, Sung JY, Kim YM, Oh CE, Kim HB, Choi EH, et al. Molecular characterization of methicillin-resistant Staphylococcus aureus obtained from the anterior nares of healthy Korean children attending daycare centers. Int J Infect Dis 2011;15: ) Kim TS, Kim MJ, Kim SH, Kee HY, Seo JJ, Kim ES, et al. Profile of Antimicrobial resistance of Staphylococcus aureus and molecular epidemiologic characterization of methicillinresistant Staphylococcus aureus (MRSA) isolated from hands of people using multitude facilities. Infect Chemother 2012; 44: ) Vandenesch F, Naimi T, Enright MC, Lina G, Nimmo GR, Heffernan H, et al. Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes: worldwide emergence. Emerg Infect Dis 2003;9: ) Song JH, Hsueh PR, Chung DR, Ko KS, Kang CI, Peck KR, et al. Spread of methicillin-resistant Staphylococcus aureus between the community and the hospitals in Asian countries: an ANSORP study. J Antimicrob Chemother 2011;66: ) Kim JS, Park JS, Song W, Kim HS, Cho HC, Lee KM, et al. Panton-Valentine Leukocidin Positive Staphylococcus aureus Isolated from Blood in Korea. Korean J Lab Med 2007;27: ) McDougal LK, Steward CD, Killgore GE, Chaitram JM, McAllister SK, Tenover FC. Pulsed-field gel electrophoresis typing of oxacillin-resistant Staphylococcus aureus isolates from the United States: establishing a national database. J Clin Microbiol 2003;41:

Microsoft PowerPoint - PDFCoTemp.PPT

Microsoft PowerPoint - PDFCoTemp.PPT 주요유방염세균의검출및 항생제감수성검사 임숙경 1. 검사시료 1. 시료채취 유방염우유 2. 체세포수측정 3. 대상세균 - Staphylococcus aureus - Coagulase negative staphylococci -Escherichia coli 3. 균분리방법 E. coli CHEC Agar 직접도말 (37 18-24h) 보라색집락 EMB Agar

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

Original Article Infect Chemother 2012;44(4): pissn eissn Infection & Chemothera

Original Article   Infect Chemother 2012;44(4): pissn eissn Infection & Chemothera Original Article http://dx.doi.org/10.3947/ic.2012.44.4.289 Infect Chemother 2012;44(4):289-298 pissn 2093-2340 eissn 2092-6448 Infection & Chemotherapy 다중시설을이용한시민의손에서분리된황색포도알균의항생제내성및메티실린내성황색포도알균의분자역학적특성

More information

( )Kju225.hwp

( )Kju225.hwp 비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin

More information

Microsoft Word - 2-황수명.doc

Microsoft Word - 2-황수명.doc Journal of Bacteriology and Virology 2009. Vol. 39, No. 2 p.71 78 DOI 10.4167/jbv.2009.39.2.71 Correlation Between Staphylococcal Cassette Chromosome mec Type and Coagulase Serotype of Methicillin-Resistant

More information

Microsoft Word - 05-김종배.doc

Microsoft Word - 05-김종배.doc J. Exp. Biomed. Sci. 11 (2005) 447 453 Patterns of Antimicrobial Resistance and Detection of meca Gene from Methicillin Resistant Staphylococcus aureus Isolated from Healthcare Facilities and U.S. Military

More information

- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

한수지 49(5), , 2016 Original Article Korean J Fish Aquat Sci 49(5), ,2016 창선해역의지중해담치 (Mytilus galloprovincialis) 양식장및육상오염원에서분리한대장균 (Escheri

한수지 49(5), , 2016 Original Article Korean J Fish Aquat Sci 49(5), ,2016 창선해역의지중해담치 (Mytilus galloprovincialis) 양식장및육상오염원에서분리한대장균 (Escheri 한수지 49(5), 564-572, 2016 Original Article Korean J Fish Aquat Sci 49(5),564-572,2016 창선해역의지중해담치 (Mytilus galloprovincialis) 양식장및육상오염원에서분리한대장균 (Escherichia coli) 의항생제내성 권순재 이가정 * 정연중 박상기 고경리 양지혜 목종수 국립수산과학원남동해수산연구소

More information

주간건강과질병 제 12 권제 16 호 연구단신, Brief report 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : s

주간건강과질병 제 12 권제 16 호 연구단신, Brief report 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : s 연구단신, Brief report 2 2013 2017 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : sea2sky@korea.kr, 043-719-7580 Results of healthcare-associated infection

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

jaeryomading review.pdf

jaeryomading review.pdf 4 5 6 7 8 9 10 11 12 13 1. S. Kim, H. Y. Jeong, S. K. Kim, S. Y. Choi and K. J. Lee, Nano Lett. 11, 5438 (2011). 2. E. Menard, K. J. Lee, D. Y. Khang, R. G. Nuzzo and J. A. Rogers, Appl. Phys. Lett. 84,

More information

α α α α α

α α α α α α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를

More information

- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -

More information

untitled

untitled Korean J Clin Microbiol Vol. 13, No. 1, March, 2010 DOI: 10.5145/KJCM.2010.13.1.1 Microbiological Characteristics of Methicillin-resistant Staphylococcus aureus Jongyoun Yi 1, *, Eui-Chong Kim 1,2 1 Department

More information

<3037C1D6BCBCC0CD2E687770>

<3037C1D6BCBCC0CD2E687770> 대한임상검사학회지 : 38 권제 1 호, 38-44, 2006 포도구균의 Erythromycin 유도성 Clindamycin 내성검출을위한간편한디스크확산법의유용성 서울대학교병원진단검사의학과 1, 서울대학교의과대학검사의학교실 2 주세익 1 이현 1 임규상 1 김의종 1, 2 An Easy Method of Disk Diffusion Antibiotic Susceptibility

More information

< B3E2BAB8B0C7BFF8BAB828BAB8B0C72CC3E0BBEA29312E687770>

< B3E2BAB8B0C7BFF8BAB828BAB8B0C72CC3E0BBEA29312E687770> 부산광역시보건환경연구원보제 14 권 (I), 15~27, 2004 Rep. Busan Inst. Health & Environ, Vol.14, 15~27, 2004 미생물과 이주현 Study on the Antimicrobial Susceptbility of Vibrio spp. Isolated from Environmental source and Patients

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

14.531~539(08-037).fm

14.531~539(08-037).fm G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked

More information

fm

fm pissn 1229-1153 J. Fd Hyg. Safety Vol. 29, No. 3, pp. 228~233 (2014) http://dx.doi.org/10.13103/jfhs.2014.29.3.228 Journal of Food Hygiene and Safety Available online at http://www.foodhygiene.or.kr 축산물과수산물에서분리된장구균의항생제감수성및유전형분석

More information

노인정신의학회보14-1호

노인정신의학회보14-1호 제14권 1호 통권 제23호 www.kagp.or.kr 발행인 : 정인과 / 편집인 : 이동우 / 발행처 : 정인과 (152-703) 서울특별시 구로구 구로동 80번지 고려대학교 구로병원 정신과 / TEL : 02-818-6608 / FAX : 02-852-1937 발행일 : 2008년 4월 30일 / 제 작 : (주)엠엘커뮤니케이션 140-846 서울특별시

More information

한국성인에서초기황반변성질환과 연관된위험요인연구

한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -

More information

< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770>

< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770> 대한임상검사학회지 : 40권제2호, 75-79, 2008 ISSN 1738-3544 대구지역병원에서분리된 Acinetobacter baumannii와 Pseudomonas aeruginosa의항생제내성현황 대구보건대학임상병리과 1, 세명대학교임상병리학과 2 김수정 1 이재식 2 Antibiotic Resistance Patterns of Acinetobacter

More information

<B8F1C2F72E687770>

<B8F1C2F72E687770> 제1장 제17장 성홍열 및 사슬알균 감염증 사슬알균 (Streptococci)은 증식 중의 특징적으로 쌍 또는 사슬모양의 그람양성 알균 으로 catalase 음성, 통성혐기성균이며, 보통 한천배지에서는 발육이 어렵고 혈액이나 혈청 등을 첨가한 배지에서 잘 발육한다. 포도당이나 다른 탄수화물을 분해하나 포도당 을 분해하여 가스를 생성하지 않는다. 이들은 최소

More information

한수지 49(5), , 2016 Original Article Korean J Fish Aquat Sci 49(5), ,2016 곰소만해역해수에서분리한장염비브리오 (Vibrio parahaemolyticus) 의항균제내성및최소발육억제농도의구명 김

한수지 49(5), , 2016 Original Article Korean J Fish Aquat Sci 49(5), ,2016 곰소만해역해수에서분리한장염비브리오 (Vibrio parahaemolyticus) 의항균제내성및최소발육억제농도의구명 김 한수지 49(5), 582-588, 206 Original Article Korean J Fish Aquat Sci 49(5),582-588,206 곰소만해역해수에서분리한장염비브리오 (Vibrio parahaemolyticus) 의항균제내성및최소발육억제농도의구명 김태옥 엄인선 김희대 박권삼 * 군산대학교식품생명공학과, 충북도립대학바이오생명의약과 Antimicrobial

More information

<B0E6B3B2C1F6BFAA20C1F6BFAABBE7C8B8C8B9B5E620B8DEC6BCBDC7B8B0B3BBBCBA20C8B2BBF6C6F7B5B5BECBB1D5C0C720B9DFBBFDBEE7BBF320B9D720C6AFBCBAC1B6BBE72E687770>

<B0E6B3B2C1F6BFAA20C1F6BFAABBE7C8B8C8B9B5E620B8DEC6BCBDC7B8B0B3BBBCBA20C8B2BBF6C6F7B5B5BECBB1D5C0C720B9DFBBFDBEE7BBF320B9D720C6AFBCBAC1B6BBE72E687770> 제출문 질병관리본부장 귀하 이보고서를 경남지역지역사회획득메티실린내성황색포도알균의발생양상및특성조 사 ( 경북대학교 / 이제철 ) 과제의연구결과보고서로제출합니다. 2006. 4. 5 주관연구기관명 : 경북대학교 주관연구책임자 : 이제철 - 1 - 연구결과보고서요약문 연구과제명 중심단어 경남지역지역사회획득메티실린내성황색포도알균의발생양상및특성조사 지역사회감염, SCCmec,

More information

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling

More information

1..

1.. Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :

More information

A Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran

More information

untitled

untitled Korean J Clin Microbiol Vol. 14, No. 1, March, 2011 DOI: 10.5145/KJCM.2011.14.1.18 Prevalence and Clinical Characteristics of Mupirocin-Resistant Staphylococcus aureus A-jin Lee, Hun-Suk Suh, Chang-Ho

More information

약수터2호최종2-웹용

약수터2호최종2-웹용 Contents 06 08 11 14 17 17 18 19 23 28 28 33 37 41 45 45 51 56 59 64 66 72 80 26 29 31 34 35 35 38 39 40 42 43 43 46 46 47 49 50 51 52 53 54 56 57 59 60 61 62 69 73 74 77 78 79 14 15 25 36 48 06 07 08

More information

???춍??숏

???춍??숏 Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY

More information

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF. 1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -

More information

10(3)-10.fm

10(3)-10.fm w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction

More information

자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr

자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr Original Article pissn 1738-2637 J Korean Soc Radiol 2012;67(2):129-134 The Survey of Magnetic Resonance Imaging Quality according to in Korea 1 자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 1 Hyun-Hae

More information

03(12-65)p fm

03(12-65)p fm 한국임상약학회지제 23 권제 1 호 Kor. J. Clin. Pharm., Vol. 23, No. 1. 2013 화상감염소아환자에서분리된주요균종에대한항생제의내성률 강주연 신혜순 * 덕성여자대학교약학대학 (2012 년 12 월 28 일접수 2013 년 3 월 2 일수정 2013 년 3 월 4 일승인 ) Antimicrobial Resistance of Clinically

More information

untitled

untitled 대한내과학회지 : 제 72 권제 1 호 27 Streptococcus pneumoniae와 Haemophilus influenzae 임상분리주에대한 Cefditoren의시험관내항균력 인제대학교의과대학일산백병원감염내과, 울산대학교의과대학서울아산병원감염내과 2, 울산대학교항균제내성ㆍ미생물유전학연구센터 3 곽이경 추은주 2, 3 박수진 3 이정은 3 정진용 2,

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

untitled

untitled Ann Clin Microbiol Vol. 19, No. 2, June, 2016 http://dx.doi.org/10.5145/acm.2016.19.2.48 pissn 2288-0585 eissn 2288-6850 Distribution and Antimicrobial Resistance of Streptococcus pneumoniae at Four University

More information

A 617

A 617 Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R

More information

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를 Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는

More information

패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer

패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 1 2 3 4 5 6 7 8 9 9 2010.1 Fashionbiz

More information

Microsoft Word - 03-황수명.doc

Microsoft Word - 03-황수명.doc Journal of Bacteriology and Virology 2011. Vol. 41, No. 3 p.157 164 http://dx.doi.org/10.4167/jbv.2011.41.3.157 Original Article Correlation Between the Prevalence of Superantigenic Toxin Genes and Coagulase

More information

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770> Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한

More information

Trd022.hwp

Trd022.hwp 김신태, 이선녕, 이석정, 정필문, 박홍준, 신명상, 김종환, 이부길, 김상하, 리원연, 신계철, 용석중 Shin-Tae Kim, M.D., Shun Nyung Lee, M.D., Seok Jeong Lee, M.D., Pil Moon Jung, M.D., Hong Jun Park, M.D., Myung Sang Shin, M.D., Chong Whan Kim,

More information

untitled

untitled 대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran

More information

674 권순재ㆍ정연중ㆍ윤현진ㆍ목종수ㆍ권지영,.., (Watts et al., 2017)., 70% (Kummerer, 2009). (Witte, 2000)., (Souli et al., 2008)., % ,113 (NIFS, 2017

674 권순재ㆍ정연중ㆍ윤현진ㆍ목종수ㆍ권지영,.., (Watts et al., 2017)., 70% (Kummerer, 2009). (Witte, 2000)., (Souli et al., 2008)., % ,113 (NIFS, 2017 한수지 51(6), 673-681, 2018 Original Article Korean J Fish Aquat Sci 51(6),673-681,2018 용남광도해역의굴 (Crassostrea gigas) 및육상오염원에서분리한대장균 (Escherichia coli) 의항생제내성 권순재 정연중 윤현진 목종수 1 권지영 * 국립수산과학원남동해수산연구소, 1 국립수산과학원식품위생가공과

More information

K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis

More information

- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α

More information

ORIGINAL ARTICLE Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist

ORIGINAL ARTICLE   Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist ORIGINAL ARTICLE http://dx.doi.org/10.15263/jlmqa.2015.37.4.209 Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resistance: MicroScan versus Etest Goeun Kang, Hyun Soo Kim,

More information

2 - ceftazidime-clavulanate 디스크를이용하여 ESBL 생성균주를확인하였다. 또한 2009년도에수집된균주인 P. aeruginosa(386주 ), A. baumannii(349주 ) 를대상으로 imipenem에대한감수성을확인하였고 imipenem-h

2 - ceftazidime-clavulanate 디스크를이용하여 ESBL 생성균주를확인하였다. 또한 2009년도에수집된균주인 P. aeruginosa(386주 ), A. baumannii(349주 ) 를대상으로 imipenem에대한감수성을확인하였고 imipenem-h 1 - 국내종합병원을대상으로한항균제내성모니터링 Monitoring of antimicrobial resistance on general hospitals in Korea 질병관리본부국립보건연구원감염병센터약제내성과 연세대학교의과대학진단검사의학교실, 세균내성연구소 Ⅰ. 들어가는말 항균제내성세균의출현과확산으로인하여세균감염증치료는점점어려워지고있다 [1-4]. 항균제내성률은흔히국가간,

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing

More information

04_이근원_21~27.hwp

04_이근원_21~27.hwp 1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일

More information

<C7D1B1B9B1B3C0B0B0B3B9DFBFF85FC7D1B1B9B1B3C0B05F3430B1C733C8A35FC5EBC7D5BABB28C3D6C1BE292DC7A5C1F6C6F7C7D42E687770>

<C7D1B1B9B1B3C0B0B0B3B9DFBFF85FC7D1B1B9B1B3C0B05F3430B1C733C8A35FC5EBC7D5BABB28C3D6C1BE292DC7A5C1F6C6F7C7D42E687770> 기혼 여성이 사이버대학에서 상담을 전공하면서 겪는 경험 방기연 (고려사이버대학교 상담심리학과 부교수) * 요 약 본 연구는 기혼 여성의 사이버대학 상담전공 학과 입학에서 졸업까지의 경험을 이해하는 것을 목적으로 한 다. 이를 위해 연구참여자 10명을 대상으로 심층면접을 하고, 합의적 질적 분석 방법으로 분석하였다. 입학 전 에 연구참여자들은 고등교육의 기회를

More information

?

? http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ

More information

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung

More information

ECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of

More information

슬라이드 1

슬라이드 1 LC-MS 단백질분석을위한 SDS-PAGE staining protocol 및주의할점 Proteomics Core Facility 2017.12.28 Contents LC-MS 분석의뢰용 protein SDS-PAGE staining 시주의할점 Coomassie Blue R-250 을이용한 gel staining (general protocol) Coomassie

More information

목원 한국화- 북경전을 준비하며 지난해부터 시작 된 한국의 목원대학교 한국화 전공의 해외미술체험은 제자와 스승의 동행 속에서 미술가로 성장하는 학생들의 지식에 샘을 채워주는 장학사업으로 진행되고 있으며, 한국의 우수한 창작인력 양성을 위해, 배움을 서로 나누는 스승들의

목원 한국화- 북경전을 준비하며 지난해부터 시작 된 한국의 목원대학교 한국화 전공의 해외미술체험은 제자와 스승의 동행 속에서 미술가로 성장하는 학생들의 지식에 샘을 채워주는 장학사업으로 진행되고 있으며, 한국의 우수한 창작인력 양성을 위해, 배움을 서로 나누는 스승들의 K o r e a n P a i n t i n g F i n e A r t s D e p t. A r t C o l l e g e M o k w o n U n i v e r s i t y 목원대학교 미술대학 한국화전공 우수창작인력양성 특성화장학생-제2차 해외미술체험 陌生的眼神看 展ː 望 목 원 한 국 화 -Beijing을 걷다- Korean Painting

More information

untitled

untitled ORIGINAL ARTICLE Korean J Clin Lab Sci. Vol. 45, No. 1, Mar. 2013 21 Korean J Clin Lab Sci. 2013, 45(1):21-25 ISSN 1738-3544 Errors of Antibiotic Susceptibility Testing from Automated and Manual Systems

More information

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*

More information

歯1.PDF

歯1.PDF 200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   3 * The Effect of H Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales

More information

- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

석사논문.PDF

석사논문.PDF ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh

More information

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770> 대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

<353420B1C7B9CCB6F52DC1F5B0ADC7F6BDC7C0BB20C0CCBFEBC7D120BEC6B5BFB1B3C0B0C7C1B7CEB1D7B7A52E687770>

<353420B1C7B9CCB6F52DC1F5B0ADC7F6BDC7C0BB20C0CCBFEBC7D120BEC6B5BFB1B3C0B0C7C1B7CEB1D7B7A52E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 13, No. 2 pp. 866-871, 2012 http://dx.doi.org/10.5762/kais.2012.13.2.866 증강현실을 이용한 아동교육프로그램 모델제안 권미란 1*, 김정일 2 1 나사렛대학교 아동학과, 2 한세대학교 e-비즈니스학과

More information

ePapyrus PDF Document

ePapyrus PDF Document 육아지원연구 2008. 제 3권 1 호, 147-170 어린이집에서의 낮잠에 대한 교사와 부모의 인식 및 실제 이 슬 기(동작구 보육정보센터)* 1) 요 약 본 연구의 목적은 어린이집에서의 일과 중 낮잠 시간에 대한 교사와 부모의 인식 및 실제를 알아봄 으로써, 교사와 부모의 협력을 통해 바람직한 낮잠 시간을 모색해 보는 데 있었다. 연구 대상은 서울, 경기지역

More information

264 축되어 있으나, 과거의 경우 결측치가 있거나 폐기물 발생 량 집계방법이 용적기준에서 중량기준으로 변경되어 자료 를 활용하는데 제한이 있었다. 또한 1995년부터 쓰레기 종 량제가 도입되어 생활폐기물 발생량이 이를 기점으로 크 게 줄어들었다. 그러므로 1996년부

264 축되어 있으나, 과거의 경우 결측치가 있거나 폐기물 발생 량 집계방법이 용적기준에서 중량기준으로 변경되어 자료 를 활용하는데 제한이 있었다. 또한 1995년부터 쓰레기 종 량제가 도입되어 생활폐기물 발생량이 이를 기점으로 크 게 줄어들었다. 그러므로 1996년부 大 韓 環 境 工 學 會 誌 特 輯 - Special Feature - 263~268. 2008. 인구구조변화에 따른 생활폐기물 발생량 현황 및 전망 서울대학교 보건대학원 Status and Forecast of the Municipal Solid Waste Generation by the Change of Population Structure Sa-rah

More information

Evaluation of Phoenix for AST of S. pneumoniae 213 mento, CA, USA) 이사용되고있다. 2000년에 Becton Dickinson에서포도알균, 장알균과그람음성세균의동정과항균제감수성검사를위한 Phoenix Automated

Evaluation of Phoenix for AST of S. pneumoniae 213 mento, CA, USA) 이사용되고있다. 2000년에 Becton Dickinson에서포도알균, 장알균과그람음성세균의동정과항균제감수성검사를위한 Phoenix Automated 대한진단검사의학회지제 29 권제 3 호 2009 Korean J Lab Med 2009;29:212-7 DOI 10.3343/kjlm.2009.29.3.212 Original Article Clinical Microbiology 폐렴알균의항균제감수성검사를위한 Phoenix System 의평가 이교관 1 류남희 2 김성태 1 채석래 1 허희진 1 동국대학교일산병원진단검사의학과

More information

<5BC0FAC0DABCF6C1A430355D434D30362D313320BEE7BAB4BCB12D E687770>

<5BC0FAC0DABCF6C1A430355D434D30362D313320BEE7BAB4BCB12D E687770> 대한임상검사학회지 : 38 권제 3 호, 173-178, 2006 Multiplex Polymerase Chain Reaction 을이용한 Extended-Spectrum β-lactamase 생성 Klebsiella pneumoniae 균주의검출 진주보건대학임상병리과 양병선 Detection of Extended-Spectrum β-lactamase Producing

More information

..........5-45..

..........5-45.. K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap

Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI:   * Strenghening the Cap Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education

More information

Æ÷Àå½Ã¼³94š

Æ÷Àå½Ã¼³94š Cho, Mun Jin (E-mail: mjcho@ex.co.kr) ABSTRACT PURPOSES : The performance of tack coat, commonly used for layer interface bonding, is affected by application rate and curing time. In this study, bonding

More information

433대지05박창용

433대지05박창용 Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina

More information

10(3)-12.fm

10(3)-12.fm w y wz 10«3y 273~280 (2010.12.) Journal of Korean Society of Urban Environment p yá xá½k w y œw (2010 9 15, 2010 12 2 k) Analysis of Characteristics of Delivered Nonpoint Source Pollution at Forested Watershed

More information

:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( )

:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( ) :,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α=.83.91.,.,,..,,,.,. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ..,.,.,. Bandura(1997),.,,,,., (,,, 2009), (,,,, 2014).?.,,,.. Bandura (1995) (Resiliency

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words

More information

16(1)-3(국문)(p.40-45).fm

16(1)-3(국문)(p.40-45).fm w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University

More information

(59-69)Kjcm13.hwp

(59-69)Kjcm13.hwp Korean J Clin Microbiol Vol. 10, No. 1, April, 2007 Antimicrobial Resistance of Clinically Important Bacteria Isolated from 12 Hospitals in Korea in 2005 and 2006 Hyukmin Lee 1, Chang Ki Kim 2, Jongwook

More information

인문사회과학기술융합학회

인문사회과학기술융합학회 Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4) THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method

More information

( ).fm

( ).fm Korean J. Food Sci. An. Vol. 33, No. 1, pp. 133~138(2013) DOI http://dx.doi.org/10.5851/kosfa.2013.33.1.133 ARTICLE 시판축산물및수산물에서 Enterococcus faecalis 와 Enterococcus faecium 분포및항생제감수성에관한연구 성창현 천정환 곽효선 1

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp DOI: * A Study on Teache

Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp DOI:   * A Study on Teache Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp.149-171 DOI: http://dx.doi.org/10.21024/pnuedi.27.4.201712.149 * A Study on Teachers and Parents Perceptions on the Introduction of Innovational

More information

Korean J Lab Med 2010;30: DOI /kjlm Original Article Clinical Microbiology Evaluation of the Performance of the MicroScan P

Korean J Lab Med 2010;30: DOI /kjlm Original Article Clinical Microbiology Evaluation of the Performance of the MicroScan P Korean J Lab Med 200;0:67-46 DOI 0.4/kjlm.200.0.6.67 Original Article Clinical Microbiology Evaluation of the Performance of the MicroScan Pos Breakpoint Combo Panel Type 28 for Susceptibility Testing

More information

4.ƯÁýb61èÈñÁøÇ62~772Çà°£

4.ƯÁýb61èÈñÁøÇ62~772Çà°£ J KMA Special Issue Current Situation of Tuberculosis and Its Control in Korea Hee Jin Kim, MD Department of Technical Cooperation, Korean Institute of Tuberculosis, Korean National Tuberculosis Assciation

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 27(2), 2007, 96-121 S ij k i POP j a i SEXR j i AGER j i BEDDAT j ij i j S ij S ij POP j SEXR j AGER j BEDDAT j k i a i i i L ij = S ij - S ij ---------- S ij S ij = k i POP j a i SEXR j i AGER j i BEDDAT

More information

7.ƯÁýb71ÎÀ¯È« š

7.ƯÁýb71ÎÀ¯È« š J KMA Special Issue Myelodysplastic Syndrome June Won Cheong, MD Yoo Hong Min, MD Department of Internal Medicine, Yonsei University College of Medicine E mail : jwcheong70@yumc.yonsei.ac.kr minbrmmd@yumc.yonsei.ac.kr

More information

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]

More information

Çмúº¸°í6ÇÏÇý¹Î

Çмúº¸°í6ÇÏÇý¹Î 병원약사회지 (27), 제 34 권제 4 호 J. Kor. Soc. Health-syst. Pharm., Vol. 34, No. 4, 433 ~ 442 (27) Original Article 국내지역사회획득폐렴원인균의경험적항균제에대한내성현황 하혜민 a, 김윤숙 b, 안정미 c, 천부순 a, 인제대학교약학대학 a, 인제대학교해운대백병원약제부 b, 인제대학교상계백병원약제부

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jun.; 27(6),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jun.; 27(6), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Jun.; 27(6), 495 503. http://dx.doi.org/10.5515/kjkiees.2016.27.6.495 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Design

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although

More information

09권오설_ok.hwp

09권오설_ok.hwp (JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction

More information

Abstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,

More information