DBPIA-NURIMEDIA

농약과학회지 (Korean J. Pestic. Sci.) Vol. 20, No. 4, pp. 369-374 (2016) Open Access https://doi.org/10.7585/kjps.2016.20.4.369 Online ISSN 2287-2051 Print ISSN 1226-6183 ORIGINAL ARTICLES / BIOPESTICIDE Bacillus velezensis YP2 의겨자채흰가루병의생물적방제 이상엽 * 원항연 김정준 한지희국립농업과학원농업미생물과 Biocontrol of Leaf Mustard Powdery Mildew Caused by Erysiphe cruciferarm using Bacillus velezensis YP2 Sang Yeob Lee*, Hang Yeon Weon, Jeong Jun Kim and Ji Hee Han Agricultural Microbiology Division, National Institute of Agricultural Sciences, RDA, Wanju 55365, Korea (Received on October 30, 2016. Revised on November 24, 2016. Accepted on November 25, 2016) Abstract Bacillus velezensis YP2 inhibited the mycelial growth of several plant pathogens including Cercespora spp., Septoria sp., Phoma sp., Botrytis cinerea and Sclerotinia scleotiorum occurring in leafy vegetables. Control efficacy for powdery mildew caused by Erysiphe cruciferarm on red leaf mustard and cheong mustard by treatment of spraying with 10-fold diluted Luria-Bertani (LB) broth of B. velezensis YP2 was 91.8% and 80.9%, respectively. When B. velezensis YP2 was treated four times with five-day interval, three times at seven-day interval and two times at ten day interval in the greenhouse test, the control effect of red leaf mustard powdery mildew was 70.6%, 65.0% and 40.9%, respectively. Also B. velezensis YP2 could promote the seed germination and plant growth of led leaf mustard. The results showed that the culture broth of B. velezensis YP2 was very effective to control the powdery mildew of leaf mustard. Key words leaf mustard Antifungal activity, Bacillus velezensis, biological control, Erysiphe cruciferarm, powdery mildew, 서 론 겨자채는쌍떡잎식물로십자화과에속하는 Brassica juncea 이며, 청겨자와적겨자로구분되며쌈채소의대표작물중에하나로재배되고있다. 우리나라에서겨자채에발생하는흰가루병은 2011년 5월에경기도화성에비닐하우스재배하는청겨자에서첫발생을보고하였다 (Kim et al., 2013). 우리나라에서는 Erysiphe cruciferarm에의한흰가루병은배추, 다닥냉이, 애기똥풀, 애기장대와풍접초에서보고되어있다 (The Korean Society of Plant Pathology, 2009). 배추흰가루병경우에는주로온실내의채종재배시피해가크며, 자낭각으로월동하여 1차전염원이되며, 온실내의건조한조건하에서심하게발생하며일반적으로노지재배포장에서는발생이매우드물다고하였다 (Jeong 2000). 겨자채 *Corresponding author E-mail: lsy2014@korea.kr 흰가루병도유리온실이나비닐하우스재배에서주로봄과가을에발생하며농가경우에는재배관리가제대로되지않은경우에심하게발생한다. 이를방제하기위한등록된화학약제는없으며신선한쌈채소를생식하기때문에친환경재배방법을사용할수있으며, 작물에대한잔류문제가거의없는유용미생물을이용하여방제하는것이바람직한하나의방법으로사료된다. 전세계적으로미생물농약은 149종이등록되어병해충과잡초방제에사용되고있으며, 흰가루병을비롯한잿빛곰팡이병방제용으로 Bacillus subtilis QST 713 (Rhapsody R, Serenade R ) 과 Bacillus pumilus QST 2808 (Sonata R ) 이개발되어우리나라를포함한여러나라에서친환경방제재로사용되고있다 (Copping, 2004; Helene et al., 2011). 우리나라에서는흰가루병방제미생물농약으로는 9종이등록되어있으며주로바실러스가 8품목이등록되어사용되고있다. 식물병방제와관련이있는 Bacillus 균주의이차대사산물은 cyclic lipopeptides (bacillomycin D, fengycin, iturin, surfactin), 369

370 이상엽 원항연 김정준 한지희 siderophore (bacillibactin), polyketides (bacillaene, difficidin, and macrolactin), dipeptide (basilysin), acetoin, 2,3-butandiol 등이있으며 (Lee et al., 2012; Soumitra et al., 2015), 병원세균이나곰팡이병균의균사생장이나포자발아억제, 저항성유도및바이오필름형성등의작용기작으로식물병에대한친환경적방제로농가에서사용되고있다. 따라서본연구에서는소비자가흰가루병을친환경적으로방제하고안심하고먹을수있는겨자채를생산하기위하여선발한 Bacillus velezensis YP2균주가겨자채흰가루병발생억제효과검정을실시하였다. 재료및방법 선발미생물보관 Bacillus velezensis YP2 균주는양평의토마토잎을마쇄하여 80 o C에서 10분간처리한후 1/10 trypticase soy agar (TSA, Bacto Tryptone 15 g, Bacto Soytone 5 g, NaCl 5 g, Agar 15 g/l) 배지에도말하여 25 o C에서 2일간배양한다음, 분리하여 TSA 배지에다시획선배양하여재분리한후, TSA 배지에서 28 o C에서 2일간배양한후균체를멸균한글리세롤 20% 액에넣고 -20 o C에보관하면서계대배양하여사용하였으며, 국립농업과학원에기탁하여 KACC92130P 수탁번호를받았다. 미생물배양 Bacillus velezensis YP2 균주를 Luria-Bertani 액체배지 (LB, tryptone 10 g, yeast extract 5 g, NaCl 10 g) 를사용하여미리배양한균주를 2% (v/v) 으로접종하여 28 o C, 180 rpm으로조절한진탕배양기에서 48시간배양하여사용하였다. B. velezensis YP2 균주의쌈채에서분리한식물병원균에 대한항균활성검정 식물병원균 Cercospora sp. 1~3, Septoria sp., Colletotrichum sp., Sclerotinia sclerotiorum, Phoma sp., Botrytis cinerea를 potato dextrose agar (PDA, Potato 200 g, Dextrose 20 g, Agar 15 g/l) 배지에이식후 Cercospora sp. 1~3, Septoria sp., Colletotrichum sp., Phoma sp. 균주는 25 o C에서 Sclerotinia sclerotiorum, Botrytis cinerea 균주는 20 o C에서각각 7~25 일간배양하여직경 5mm 코르크보러를이용하여병원균의균총을 PDA 배지가분주된일회용페트리디쉬중앙에치상하였다. YP2 균주는 TSA 평판배지에배양하여루프를이용하여균을떼어내어 PDA 배지가분주된일회용페트리디쉬 3개소에치상하여병원균별로 25 o C와 20 o C 항온기에서 7~20일간배양후저지원의직경을조사하였다. 선발균주의동정 YP2균주의계통분류학적동정은일반적으로사용되는 16S rrna 유전자의염기서열을사용하였고, 추가로 Bacillus spp. 의분류에유용한것으로알려진 DNA gyrase유전자 (gyrb 유전자 ) 의염기서열을이용하여선발균주의분류학적위치를분석하였다 (Wang et al., 2007). YP2 균주는 TSB (Difco, Detroit, MI, USA) 배지에접종하여 30 o C에서 24시간이상배양후원심분리하여균체를수거하였다. Genomic DNA는 Genomic Plus DNA Prep kit (Inclone, Yongin, Korea) 를이용하여추출하였다. 16S rrna 유전자의증폭을위해범용프라이머인 27F와 1492R을사용하였고, gyrb 유전자의증폭을위해범용프라이머인 UP-1과 UP-2r을사용하여 PCR한후각각유전자의증폭산물을얻었다 (Yamamoto et al., 1955; Song et al., 2004). 3개의프라이머 (518F; CCAGCAGCCGCGGTAATACG, 800R; TACCAGGGTAT CTAATCC, 984F; ACGCGARGAACCTTAC) 를이용하여 16S rrna 유전자의염기서열을결정하였고, gyrb 유전자는두개의염기서열분석용프라이머 (UP-1S; GAA GTC ATC ATG ACC GTT CTG CA, UP-2Sr; AGC AGG GTA CGG ATG TGC GAG CC) 를이용하여제노텍 (GenoTech, Daejeon, Korea) 에분석의뢰하였다. 얻어진염기서열은 SeqMan (DNASTAR, Madison, WI, USA) 을이용하여직접오류를검정하고연결하였다. 각유전자의비교분석을위해서 16S rrna 유전자의염기서열및균주간상동성은 EzTaxon (http://www.ezbiocloud.net/eztaxon) 을통해서얻었으며 (Kim et al., 2012), gyrb 유전자의염기서열은 GenBank (www.ncbi.nlm.nih/genbank) 를통하여얻었다. 계통도의작성을위해 MEGA 5.0 프로그램의 Clustal W 프로그램으로염기서열을정렬하고염기서열길이를맞추었다. 계통도를작성하기위해 neighbor-joining 알고리즘을사용하였으며, 계통도의신뢰성을확보하기위해 1,000회반복 bootstrapping 을수행하였다 (Tamura et al., 2011). B. velezensis YP2 균주의겨자채흰가루병에대한방제효과검정청겨자 ( 아시아종묘 ) 종자를흑색비닐포트 ( 직경 9.6 cm) 에바로커상토 ( 서울바이오 ) 를담아서파종하여 20일간생육한청겨자에흰가루병이자연발생한다음, YP2 균주를 LB 배지에서 28 o C에서 200 rpm으로 48시간진탕배양하여배양액을 10배희석하여구당 10주씩 3반복으로 7일간격으로 3회분무처리하여최종처리 7일후병반면적율 (%) 을육안으로달관조사하였다. B. velezensis YP2 균주의처리간격및횟수에따른적겨자흰가루병방제효과검정적겨자 ( 아시아종묘 ) 재배중에흰가루병이자연발생한초

Bacillus velezensis YP2 의겨자채흰가루병의생물적방제 371 기에 LB 배지에서배양한 YP2 균주의배양액을 10배희석하여구당 15주씩 3반복으로 5일간격 4회, 7일간격 3회와 10일간격 2회분무처리하여최종처리 10일후병반면적율 (%) 을육안으로달관조사하였다. 대조구는시판미생물제를 500배희석하여 7일간격 3회처리하였다. B. velezensis YP2 균주의침지에의한적겨자종자발아및생육촉진효과검정적겨자종자발아의영향을조사하기위하여 YP2 균주를 LB액체배지에 25 o C, 200 rpm에서 48시간진탕배양후원심분리하여균체를회수후 hemacytometer (Bright-Line, USA) 로계수하여 1 10 8 cell/ml로조절하여적겨자종자를 1시간침지후 100립씩 5반복으로페트리디쉬에치상하여 25 o C도항온기내에서 3일간보관한다음종자발아율 (%) 를조사하였다. 적겨자생육촉진효과는 YP2 균주를 LB 액체배지에 25 o C, 200rpm에서 48시간진탕배양한후원심분리하여균체를회수하여 1.0 10 8 cell/ml로농도를조절하였다. 적겨 자종자를 BM-6 상토에파종하고, 파종일로부터 7일간격으로 50 ml 씩 4회관주처리하였다. 100립씩 5반복으로실험하였으며, 최종처리 8일후에반복당 20주씩초장, 근장과생체중을각각조사하였다. 결과및고찰 B. velezensis YP2 균주의쌈채에서분리한식물병원균에대한항균활성쌈채류에서분리한식물병원균 Cercospora sp. 1~3, Septoria sp., Colletotrichum sp., Phoma sp., Botrytis cinerea, Sclerotinia sclerotiorum에대한 B. velezensis YP2 균주의군사생장억제효과를조사한결과에서 Cercospora sp. 1~3 에대하여 8.3~8.8 mm, Septoria sp. 에대하여 4.4 mm, Colletotrichum sp. 에대하여 5.8 mm, Phoma sp. 에대하여 8.5 mm, Botrytis cinerea에대하여 6.1 mm, Sclerotinia sclerotiorum에대하여 5.9 mm의균사생육을저지하였다 (Table 1). Bacillus 균주는 cyclic lipopeptides (bacillomycin Fig. 1. Phylogenetic dendrogram based on partial 16S rrna (A) and gyrb (B) gene sequences (1,416 bp and 1,065 bp, respectively) of Bacillus strains. Numbers above branches indicate bootstrap values (>50%) from 1,000 replicates. Strain or culture collection and accession numbers are indicated next to species name. T means type strain.

372 이상엽 원항연 김정준 한지희 Table 1. Antifungal activity of B. velezensis YP2 on fungal pathogens of leafy vegetables on PDA agar Plant pathogen Inhibition zone of mycelial growth (mm) ± SD Cercospora sp. 1 8.7 ± 0.4 a) Cercospora sp. 2 8.8 ± 0.2 Cercospora sp. 3 8.3 ± 0.4 Septoria sp. 4.4 ± 0.1 Collectotrichum sp. 5.8 ± 0.3 Phoma sp. 8.5 ± 0.4 Botrytis cinerea 6.1 ± 0.0 Sclerotinia sclerotiorum 5.9 ± 0.2 a) average of three replicates. Fig. 2. Morphology of cells of B. velezensis YP2 by microscopy (Leica DM2500). D, fengycin, iturin, surfactin), siderophore (bacillibactin), polyketides (bacillaene, difficidin, macrolactin), dipeptide (basilysin), acetoin, 2,3-butandiol 등의이차대사물질을생산하는것으로보고되었으며 (Lee et al., 2012; Soumitra et al., 2015), 이러한이차대사물질들이식물병원세균이나곰팡이의생장과포자발아를억제및저항성유도등으로식물병방제가가능하며본연구에서선발된균주도식물병원균의균사생육억제와관련유전자를지니고있다고추정된다. 선발균주의동정 16S rrna와 gyrb 유전자를바탕으로 MEGA5 프로그램을이용하여분자유전학적인계통도를작성하고, 선발균주의분류학적위치를확인하였다 (Fig. 2). 16S rrna 유전자를바탕으로작성한계통도에서 YP2 균주는 Bacillus velezensis BCRC 17467(T) 균주와높은상동성 (100%) 을보였다 (Fig. 1A). B. siamensis 균주와는계통도의신뢰성을확보하기위한 bootstrap 값도 81% 로비교적높은값을보였다. YP2 균주는 gyrb 유전자를바탕으로작성한계통도에서 B. amyloliquefaciens subsp. plantarum 균주에높은상동성 (100%) 을보였으며, 99% 의 Bootstrap 값을보이며높은계통도의신뢰성을보였다 (Fig. 1B). 최근계통유전체학을근거로한 Bacillus spp. 의분류연구는근연종 Bacillus 4종, 즉 B. amyloliquefaciens subsp. plantarum, B. methylotrophicus, B. oryzicola, 및 B. velezensis를모두 B. velezensis로분류되어야한다고보고된바있다 (Dunlap et al., 2016). 본연구의선발균주인 YP2 균주는 16S rrna 와 gyrb 유전자를이용하여분석한결과 Dunlap 등의보고에따라 B. velezensis로동정되었으며, YP2균주를배양하여현미경상에서세균이다 (Fig. 2). B. velezensis YP2 균주의겨자채흰가루병에대한방제효과 20일간생육한청겨자에흰가루병이발생한초기에 YP2 균주를 LB배지에서배양한배양액을 10배희석하여 7일간격으로 3회분무처리한결과, YP2 균주는적겨자에처리하여흰가루병이 5.3% 병반면적율을나타내어 91.8% 방제효과를보였으며, 청겨자에대해서는청겨자에대해서는흰가루병병반면적율이 14.2% 로 80.9% 의높은방제효과를나타내었다 (Table 2). B. velezensis YP2 균주의처리간격및횟수에따른적겨자흰가루병방제효과적겨자흰가루병이발생한초기에 LB 배지에서배양한 YP2 균주의배양액을 10배희석하여 5일간격 4회, 7일간격 3회와 10일간격 2회분무처리한결과에서 5일간격 4 회처리구가흰가루병발생이 24.6% 로 70.6% 가장높은방제효과를, 7일간격 3회처리구는 29.3% 의흰가루병발생하여 65.0% 방제효과를보인반면에 10일간격 2회처리구는흰가루병발생이 49.5% 발생하여 40.9% 의낮은방제효과를나타내었다 (Table 3, Fig. 3). 10일간격 2회처리구의낮은방제효과는흰가루병균의분생포자가식물체에부 Table 2. Control effect of powdery mildew on leaf mustard variety by cultured broth of B. velezensis YP2 Treatment Red-Kyeoja Cheong-Kyeoja Lesion area (%) Control efficacy (%) Lesion area (%) Control efficacy (%) YP2 55.3 a a) 91.8 14.2 a a) 80.9 Untreated check 63.8 b - 74.4 b - a) In a column, means followed by a common letter are not significantly different at the 5% level by DMRT (Duncan's multiple range test).

Bacillus velezensis YP2 의겨자채흰가루병의생물적방제 373 Table 3. Control effect of powdery mildew by treatment of cultured broth of B. velezensis YP2 at interval and frequency of treatment on red leaf mustard Treatment Application interval (day) Application frequency Lesion area (%) Control efficacy (%) 5 4 times 24.6 a a) 70.6 YP2 7 3 times 29.3 ab 65.0 10 2 times 49.5 c 40.9 Microbial agent 7 3 times 65.7 d 21.6 Untreated check - - 83.8 f - a) In a column, means followed by a common letter are not significantly different at the 5% level by DMRT. Fig. 3. Control effect of red leaf mustard powdery mildew by the cultured broth of B. velezensis YP2 at interval and frequency of application. A; 5 days interval 4 times treatment, B; 7 days interval 3 times treatment, C; 10 days interval 2 times treatment, D; untreated check. Table 4. Growth promoting activity and seed germination of red leaf mustard by treatment of B. velezensis YP2 Treatment Seed germination rate (%) Height (cm) Root length (cm) Fresh weight (g) YP2 81.4 a a) 10.8 a 28.5 a 2.1 a Untreated check 75.6 b 58.5 b 30.1 ab 1.1 b a) In a column, means followed by a common letter are not significantly different at the 5% level by DMRT. 착하여발아되어 5일 ~6일이면한세대가경과하여다시분생포자가형성되어매우빠른속도로분생포자세대를유지하면서식물체에피해를주어 (Endo, 1989) 새로운흰가루병균포자가비산되어서병발생하는생활사와깊은연관이있을것으로생각된다. Bacillus pumilus와 Bacillus subtilis 균주가식물병방제에효과가인정되어미국의아그라퀘스트사에서흰가루병등방제제로개발하여세레나데, 랩쏘디와쏘나타라는미생물농약제품으로등록하여, 미국, 독일, 스위스, 페루, 캐나다이태리와프랑스등에서사용되고있다 (Helene et al., 2011). 국내에서는 B. amyloliquefaciens M27 (Lee et al., 2013), B. subtilis B29, B. subtilis M10과 Streptomyces sp. CC19 균주가오이흰가루병에효과적인균주로서선발한바있으며 (Lee et al., 2010), 그리고 Bacillus sp. BS061 균주의 20배희석한배양여액은오이흰가루병을 62.4% 방제하였으며, 딸기흰가루병을 80.3% 방제효과를나타내었다 (Kim et al., 2013). 그리고 B. subtilis가생성한항균물질이투린과펜기신이오이흰가루병균 (Podosphaera fusca) 에대한길항력에큰주요역할을보고한바있다 (Romero et al., 2007). B. velezensis YP2 균주의침지에의한적겨자종자발아및생육촉진효과적겨자의종자발아에미치는영향을조사한결과에서 YP2 균주처리가종자발아율이 81.4% 로무처리 75.6% 보다 5.8% 종자발아율이증가되었으며, 적겨자의생육촉진을조사한결과에서는초장은 10.8 cm과생체중이 2.1 g으로무처리에비하여각각 127.1%, 190.9% 각각증가되었다 (Table 4). 바실러스균주의식물체의생육촉진에관여하는일차대사물질에서 2,3-butandiol과 IAA 생성유전자가가지고있다고밝혀져서 (Lee et al., 2012; Soumitra et al., 2015), YP2 균주도이런유전자를가지고있다고추정된다. 이상의결과에서와같이 B. velezensis YP2 균주는겨자채흰가루병에방제효과가우수하며, 종자발아를향상시키고생육을촉진하는특성을가지고있어친환경재배에사용될수있는우수한균주라고사료된다. 감사의글 본연구는농촌진흥청국립농업과학원농업과학기술연구개발사업 ( 과제번호 : PJ010049) 의지원에의해수행되었습니다.

374 이상엽 원항연 김정준 한지희 Literature Cited Chowdhury, S. P., A. Hartmann, X. W. Gao and R. Borriss (2015) Biocontrol mechanism by root-associated Bacillus amyloliquefaciens FZB42-a review. Frontiers in Microbiology/ www.frontiersin.org. 6:780. Copping, L. G. (2004) The manual of biocontrol agents. edition 4th, Alton: BCPC; UK, pp. 702. Dunlap, C. A, S. J. Kim, S. W. Kwon and A. P. Rooney (2016) Bacillus velezensis is not a later heterotypic synonym of Bacillus amyloliquefaciens; Bacillus methylotrophicus, Bacillus amyloliquefaciens subsp. plantarum and Bacillus oryzicola are later heterotypic synonyms of Bacillus velezensis based on phylogenomics. Int J Syst Evol Microbiol. 66:1212-17. Endo, T. (1989) Studies on the life-cycle of cucurbit powdery mildew fungus Sphaerotheca fuliginea (schlecht) Poll. Spec. Bull. Fukushima Pref. Agr. Exp. Stn. 5:1-106. Helene, C., B. Wagner, F. Patrick and O. Marc (2011) Bacillusbased biological control of plant diseases in pesticides in the modern world - pesticides use and management. pp. 273-302. http;//www.intechopen.com. Accessed 14 October 2013. Jeong, Y. H. (2000) Diagnosis and control of vegetables diseases and insects, Seoul : publisher Academy. 34. Kim, J. Y., B. S. Kim, S. E. Cho and H. D. Shin (2013) First report of powdery mildew caused by Erysiphe cruciferarum on indian mustard (Brassica juncea) in Korea. Plant Disease. 97:1383. Kim, Y. S., J. G. Song, I. K. Lee, W. H. Yeo and B. S. Yun (2013) Bacillus sp. BS061 Suppresses powdery mildew and gray mold. Mycobiology. 41(2):108-111. Kim, O. S., Y. J. Cho, K. Lee, S. H. Yoon, M. Kim, Na H, S. C. Park, Y. S. Jeon, J. H. Lee and H. Y, et al. (2012) Introducing EzTaxon-e: a prokaryotic 16S rrna gene sequence database with phylotypes that represent uncultured species. Int J Syst Evol Microbiol. 62:716-21. Lee, S. Y., B. Y. Kim, J. H. Ahn, J. Song, Y. J. Seol, W. G. Kim and H. Y. Weon (2012) Draft genome sequence of the biocontrol bacterium Bacillus amyloliquefaciens strain M27. J Bacteriol. 194:6934-5. Lee, S. Y., Y. K. Lee, K. Park and Y. K. Kim (2010) Selection of beneficial microbial agents for control of fungal diseases in the phyllosphere of cucumber plant. Korean J. Pestic. Sci. 14(4):326-331 (in Korea) Lee, S. Y., H. Y. Weon, J. J. Kim, J. H. Han and W. G. Kim (2013) Control effect of the mixture of Bacillus amyloliquefaciens M27 and plant extract against cucumber powdery mildew. Korean J. Pestic. Sci. 17(4):435-439. Romero, D., de Vicente A. Rakotoaly, R. H. Dufour, S. E. Veening, J. W. Arrebola, E. Cazorla, F. M. Kuipers, O. P. Paquot and M. A. Perez-Garcia1 (2007) The iturin and fengycin families of lipopeptides are key factors in antagonism of Bacillus subtilis toward Podosphaera fusca. MPMI. 20(4):430-440. Song, J., S. C. Lee, J. W. Kang, H. J. Baek and J. W. Suh (2004) Phylogenetic analysis of Streptomyces spp. isolated from potato scab lesions in Korea on the basis of 16s rrna gene and 16s 23s rdna internally transcribed spacer sequences. Int J Syst Evol Microbiol. 54:203-9. Tamura, K, D. Peterson, N. Peterson, G. Stecher, M. Nei, S. Kumar (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 28:2731-9. The Korean Society of Plant Pathology (2009) List of plant diseases in Korea. 5th ed. Seoul: Korean Society of Plant Pathology. Wang, L. T, F. L. Lee, C. J. Tai and H. Kasai (2007) Comparison of gyrb gene sequences, 16s rrna gene sequences and DNA-DNA hybridization in the Bacillus subtilis group. Int J Syst Evol Microbiol. 57:1846-50. Yamamoto, S. and S. Harayama (1995) PCR amplification and direct sequencing of gyrb genes with universal primers and their application to the detection and taxonomic analysis of Pseudomonas putida strains. Appl Environ Microbiol. 61:1104-9. Bacillus velezensis YP2 의겨자채흰가루병의생물적방제 이상엽 * 원항연 김정준 한지희국립농업과학원농업미생물과 요약 Bacillus velezensis YP2 균주는쌈채소에서분리한 Cercospora sp. 1~3, Septoria sp., Colletotrichum sp., Sclerotinia sclerotiorum, Phoma sp., Botrytis cinerea 에대하여균사생육을억제하였다. B. velezensis YP2 균주의 LB 배양액을 10 배희석액은적겨자와청겨자에발생하는 Erysiphe cruciferarm 에의한흰가루병을 91.8% 와 80.9% 방제효과을보였다. B. velezensis YP2 균주의배양액을 10 배희석하여 5 일간격 4 회처리구가적겨자흰가루병을 70.6%, 7 일간격 3 회처리구는 65.0%, 10 일간격 2 회처리구는 49.5% 방제하였다. 또한 B. velezensis YP2 균주는적겨자종자발아를증가시켜고생육을촉진하였다. 이상의결과에서 YP2 균주는겨자채흰가루병방제에매우효과적이었다. 색인어 항균력, 바실러스벨레젠시스, 생물적방제, Erysiphe cruciferarm, 겨자채, 흰가루병