338 김승민ㆍ전려진ㆍ박명애ㆍ정현도ㆍ정준범 viral hemorrhagic septicemia (VHS) Scuticocilate,, cm, 1-3.,,.,, cohabitation test. 실험어 재료및방법 2010 (E03), 2011 (E06),

Size: px

Start display at page:

Download "338 김승민ㆍ전려진ㆍ박명애ㆍ정현도ㆍ정준범 viral hemorrhagic septicemia (VHS) Scuticocilate,, cm, 1-3.,,.,, cohabitation test. 실험어 재료및방법 2010 (E03), 2011 (E06),"

종옥 조
6 years ago
Views:

1 한수지 48(3), , 2015 Original Article Korean J Fish Aquat Sci 48(3), ,2015 제주도여윔증상넙치 (Paralichthys olivaceus) 로부터분리한점액포자충의특성분석 김승민 전려진 1 박명애 2 정현도 3 정준범 * 제주대학교해양의생명과학부, 1 제주대학교수산백신연구센터, 2 국립수산과학원수산생물방역과, 3 부경대학교수산생명의학과 Characterization of the Myxosporean Parasite Isolated from Emaciated Olive Flounders Paralichthys olivaceus on Jeju Island Seung Min Kim, Lyu Jin Jun 1, Myoung Ae Park 2, Hyun Do Jeong 3 and Joon Bum Jeong* Faculty of Marine Biomedical Science, Jeju National University, Jeju , Korea 1 Fish Vaccine Resarch Center, Jeju National University, Jeju , Korea 2 Aquatic Life Disease Control Division, National Fisheries Research and Development Institute, Busan , Korea 3 Department of Aquatic Life Medicine, Pukyong National University, Busan , Korea To investigate the causes of emaciation in cultured olive flounder Paralichthys olivaceus in Korea. We performed histological examinations and polymerase chain reaction (PCR) with a new primer set. In most cases, the most severe emaciation was observed in the abdominal area Using PCR on extracted livers, kidneys, spleens, gills, brains, and intestines, we found that areas around the kidneys and intestines were as almost always positive. In significantly emaciated fish, PCR was positive in all internal organs except the gills. In addition, the homology of 812-bp nucleotide sequences of the 28S rrna gene was more than 99% in emaciated fish. Partial homology with Myxobolus spp. and Cystodiscus axonis, whose data were obtained from GenBank was 86% and 88%, respectively. Histological examinations detected spores in kidneys and intestines but not in other organs. We also performed cohabitation experiments to determine whether infections could be exchanged among species or only within species. Uninfected olive flounder and red sea bream, Pagrus major, cohabitating with emaciated olive flounder showed 100% and 0% cumulative mortality, respectively. Thus the cause of emaciation in cultured olive flounder of Korea is likely due to a new parasite. Key words: Emaciation disease, Olive flounder, PCR, Spore, Cohabitation experiment 서론 1990 (Takifugu rubripes), (Pagrus major), (Oplegnathus fasciatus), (Paralichthys olivaceus),., (Tun et al., 2000). Tun et al. (2002), 3, Enteromyxum fugu, Enteromyxum leei Leptotheca fugu., (Ogawa and Yokoyama, 2001). Yasuda et al. (2005),, 3 primers PCR. 50% 95% Korean J Fish Aquat Sci 48(3) , June 2015 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial Licens ( permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Received 23 February 2015; Revised 1 June 2015; Accepted 8 June 2015 *Corresponding author: Tel: Fax: address: jeongjb@jejunu.ac.kr Copyright 2014 The Korean Society of Fisheries and Aquatic Science 337 pissn: , eissn:

2 338 김승민ㆍ전려진ㆍ박명애ㆍ정현도ㆍ정준범 viral hemorrhagic septicemia (VHS) Scuticocilate,, cm, 1-3.,,.,, cohabitation test. 실험어 재료및방법 2010 (E03), 2011 (E06), 2012 (E03) 2013 (E12)., tryptic soy agar (Difco Co., USA), thiosulfate citrate bile salts sucrose agar (Difco), Salmonella-Shigella (Difco),,, 25. Cho et al. (2007) viral hemorrhagic septicemia virus (VHSV), viral nervous necrosis virus (VNNV), hirame rhabdovirus (HRV) red seabream iridovirus (RSIV) 4 PCR. DNA 추출,,,,, DNA DNeasy Blood & Tissue Kit (Qiagen Hilden, Germany). 10 mg ATL buffer 180 L proteinase K 20 L 56., AL buffer 200 L ethanol 200 L spin column 6,000 g 1. Column tube AW1 buffer 500 L AW2 buffer 500 L, AE buffer 50 L DNA. DNA -20. Primer 제작, E. leei small subunit ribosomal DNA gene (SSU rdna) MM18Sf/MM18Sr primer set (1,589 bp) (Table 1) DNA PCR, PCR. GenBank (NCBI, USA) (Myxidium sp.) degenerated primers, DNA PCR, DNA sequencing EM-F/EM-R primer set (Table 1). PCR 및 DNA sequencing PCR microtube 1 M primer, 2.5 mm dntp, 10 G-Taq Buffer, 2.5 U G-Taq DNA polymerase (Gene Pro Themal Cycler Cosmo, Korea) template DNA distilled water PCR volume 20 L. PCR 95 3 predenaturation, denaturation, annealing, extension 1 cycle, 35 cycles., 72 7 postextension. PCR 1 TAE buffer (40 Mm Tris-acetate, 1 mm EDTA), 0.5 g/ L ethidium bromide 1% agarose gel, UV band. PCR gel purification kit (Bioneer, Korea) Table 1. PCR primers used for the detection of new pathogen MM18S-F MM18S-R 28S-F 28S-R EM-F EM-R Primer Oligonucleotide sequence (5'-3') Expected sizes Function CTGGTTGATTCTGCCAGTGGTC CGGTACTAGCGACGGGCG CTAGGGGAATCCGACTGT ATCAAACTAGAGTCAAGC CAACCGCAATGTGTTTACTC CCAAACAACCTGCCACAATG 1,589 bp 313 bp 812 bp Detection of E. leei (Palenzuela et al., 2002) House keeping gene (28S ribosomal RNA) Detection of new pathogen (in this study)

원인불명여윔증진단 339, ToPo TA cloning kit (Invitrogen, USA) cloning (Solgent, Korea). 조직병리학적분석, Edwardsiella tarda, Vibrio harveyi Streptococcus sp.

(Leica EG 1150HC, Germany) (Leica Jung 820, Germany). 4-5 m. haematoxylin eosin (H&E) (Zeiss LT60, Germany). 어류간의전이실험 Ishimatsu et al.

100 L recipient group.. 100 L, 10 (6.5 0.5 cm, 3.5 0.7 g) 10 cohabitation. 19 1 1 1,., PCR. Fig. 1. The external (A) and internal (B) signs of the emaciated olive flounder Paralichthys olivaceus.

3 원인불명여윔증진단 339, ToPo TA cloning kit (Invitrogen, USA) cloning (Solgent, Korea). 조직병리학적분석, Edwardsiella tarda, Vibrio harveyi Streptococcus sp.. Viral hemorrhagic septicemia virus (VHSV), viral nervous,,,,, Bouin's solution 24 70% EtOH. (Leica EG 1150HC, Germany) (Leica Jung 820, Germany). 4-5 m. haematoxylin eosin (H&E) (Zeiss LT60, Germany). 어류간의전이실험 Ishimatsu et al., (2007) cohabitation. PCR donor group, recipient group. ( cm, g) 15 ( cm, g) 15 cohabitation. 100 L recipient group L, 10 ( cm, g) 10 cohabitation ,., PCR. Fig. 1. The external (A) and internal (B) signs of the emaciated olive flounder Paralichthys olivaceus. 결과 여윔증의원인체검출,, (Tun et al., 2000) (Fig. 1A, 1B)., 5-8 m, 7-9 m (Fig. 2), Fig. 2. The spore from the intestine of emaciated olive flounder Paralichthys olivaceus. Bar=10 μm.

340 김승민ㆍ전려진ㆍ박명애ㆍ정현도ㆍ정준범 necrosis virus (VNNV), hirame rhabdovirus (HRV) red seabream iridovirus (RSIV) 4 viruses (data not shown). EM-F/EM-R primer set PCR (Table 1),, (Fig. 3).

조직병리학적검사,, Fig. 3. PCR amplification from nucleic acids of internal organs from the emaciated olive flounder Paralichthys olivaceus in the level stages of infection.

4 340 김승민ㆍ전려진ㆍ박명애ㆍ정현도ㆍ정준범 necrosis virus (VNNV), hirame rhabdovirus (HRV) red seabream iridovirus (RSIV) 4 viruses (data not shown). EM-F/EM-R primer set PCR (Table 1),, (Fig. 3). PCR,,,,., PCR (Fig. 3). PCR products, 99%, (Fig. 4). GenBank database, 150 bp Myxobolus sp. (Accession No. JN ) Cystodiscus axonis (Accession No. JN ) 86% 88%, GenBank. 조직병리학적검사,, Fig. 3. PCR amplification from nucleic acids of internal organs from the emaciated olive flounder Paralichthys olivaceus in the level stages of infection. Lanes 1, 7, 13 and 19, Kidney; lanes 2, 8, 14 and 20, Intestine; lanes 3, 9, 15 and 21, Spleen; lanes 4, 10, 16 and 22, Liver; lanes 5, 11, 17 and 23, Brain ; lanes 6, 12, 18 and 24, Gill; M, 1 kb DNA ladder.

5 원인불명여윔증진단 341 Fig. 4. Comparison analysis of the DNA nucleotide sequences of pathogens detected from the emaciated olive flounder Paralichthys olivaceus. Primers used in PCR are in boxes.

342 김승민ㆍ전려진ㆍ박명애ㆍ정현도ㆍ정준범,,, (plasmodium) (Fig. 5A and 5B)., (Fig. 5C and 5D)., (data not shown). 어류간의전이실험 PCR, 2 groups donor 3 100%, recipient 12 100% (Fig. 6A).

6 342 김승민ㆍ전려진ㆍ박명애ㆍ정현도ㆍ정준범,,, (plasmodium) (Fig. 5A and 5B)., (Fig. 5C and 5D)., (data not shown). 어류간의전이실험 PCR, 2 groups donor 3 100%, recipient % (Fig. 6A). recipient group donor group 7, recipient group PCR, 73.3% (Table 2),, donor fish (Fig. 7)., 3 donor group 100%, recipient group (Fig. 6B), PCR (Table 2). (data not shown). 고찰,, Fig. 5. Histological findings of kidney (A, 200 and B, 400) and intestine (C, 200 and D, 400) from the emaciated olive flounder Paralichthys olivaceus. H & E stain. Bar = 20 μm.

원인불명여윔증진단 343 (A) (B) 100 100 Cumulative mortality (%) 80 60

7 원인불명여윔증진단 343 (A) (B) Cumulative mortality (%) Cumulative mortality (%) Day Day Fig. 6. Cumulative mortality (%) of olive flounder Paralichthys olivaceus (A) and red seabream Pagrus major (B) after cohabitated with the emaciated olive flounder., emaciated olive flounder; and, cohabitated olive flounder and red sea bream, respectively. Fig. 7. Histological findings of kidney (A, 200 and B, 400) and intestine (C, 200 and D, 400) from the recipient olive flounder Paralichthys olivaceus cohabitated with the emaciated olive flounder. H & E stain. Bar=20 μm. Table 2. Infection rate (%) of olive flounder Paralichthys olivaceus and red seabream Pagrus major after cohabitated with the emaciated olive flounder Donor fish (olive flounder) Recipient fish (olive flounder) Donor fish (olive flounder) Recipient fish (red seabream) PCR Positive 100% (15/15) 73.3% (11/15) 100% (10/10) 0% (0/10)

8 344 김승민ㆍ전려진ㆍ박명애ㆍ정현도ㆍ정준범.,, 30-40% (data not shown),. Choi et al. (2012) E. tarda, V. harveyi,., 5-8 m, 7-9 m (Fig. 2), (Tetsuza et al., 2004). Tun et al. (2002) E. fugu, E. leei L. fugu. SSU rdna gene MM18Sf/MM18Sr primer set (Palenzuela et al., 2002; Yasuda et al., 2005) PCR. Choi et al. (2012), primer set PCR. primer set (EM-F/EM-R) (Table 1), PCR band (Fig. 3),,., DNA nucleotide sequences 99% (Fig. 4)., GenBank Myxobolus sp. Cystodiscus axonis 80% GenBank database., DNA walking. sharpsnout sea bream Puntazzo puntazzo, red sea bream Pagrus major, red drum Sciaenops ocellatus Myxidium leei (Le Breton and Marques, 1995; Diamant, 1998; Athanassopoulou et al., 1999)., Myxosporea turbot, Scophthalmus maximus turbot (Beaman et al., 1999). Bartholomew et al. (1989) Ceratomyxa shasta., (Tun et al., 2002).,,,,.,,,. E. leei donor fish cohabitaiton, E. leei (Diamant, 1997; Yasuda et al., 2002). (Table 2), PCR.,,, cohabitation, GenBank.,,,. 사사 ( ). References Athanassopoulou F, Prapas T and Rodger H Diseases of Puntazzo puntazzo cuvier in marine aquaculture systems in Greece. J Fish Dis 22, Bartholomew JL, Smith CH, Rohovec JS and Fryer JL Characterization of a host response to the myxosporean parasite, Ceratomyxa shasta (Noble), by histology, scanning electron microscopy and immunological techniques.

9 원인불명여윔증진단 345 J Fish Dis 12, tb00561.x. Beaman HJ, Speare DJ, Brimacombe M and Daley J Evaluating protection against Loma salmonae generated from primary exposure of rainbow trout, Oncorhynchus mykiss (Walbaum), outside of the xenoma-expression temperature boundaries. J Fish Dis 22, 445, org/ /j x. Cho MY, Kim MS, Kwon MG, Jee BY, Choi HS, Choi DL, Park GH, Lee CH, Kim JD, Lee JS, Oh YK, Lee DC, Park SH and Park MA Epidemiological study of bacterial diseases of cultured olive flounder, Paralichthys olivaceus from 2005 to 2006 in Korea. J Fish Pathol 20, Choi HS, Jun LJ, Kim SM, Jeong HD, Kim YK, Lim H, Yeo Ik and Jeong JB Clinical features of fish with pathogens isolated from emaciated olive flounder Paralichthys oliveaceus. J Fish Pathol 25, Diamant A Fish-to-fish transrmission of a marine myxosporean. Dis Aquat Org 30, Diamant A Red drum Sciaenops ocellatus (Sciaenidae), a recent introduction to Mediterranean mariculture, is susceptible to Myxidium leei (Myxosporea). Aquaculture 162, Ishimatsu A, Hayashi M, Nakane M and Sameshima M Pathophysiology of cultrured tiger puffer Takifugu rubripes suffering from the myxosporean emaciation disease. Fish Pathol 42, Le Breton A and Marques A Occurrence of a histozoic Myxidium infection in two marine cultured species: Puntazzo puntazzo C and Pagrus major. Bull Fish Pathol 15, Ogawa K and Yokoyama H Emaciation disease of cultured tiger puffer Takifugu rubripes. Bull Aquacult Suppl 5, Palenzuela O, Redondo MJ and Alvarez-Pellitero P Description of Enteromyxum scophthalmi gen. nov., sp. nov. (Myxozoa), an intestinal patasite of turbot (Scophthalmus maximus L.) using morphological and ribosomal RNA sequence data. Parasitology 124, org/ /s Tetsuya Y, Yoshinori N, Takeshi K, Yutaka F, Hiroshi Y and Kazuo O Molecular and Morphological Redescriptions of Enteric Myxozoans, Enteromyxum leei (formerly Myxidium sp. TP) and Enteromyxum fugu comb.n.(syn, Myxidium fugu) from cultrured Tiger puffer. J Fish Pathol 39, Tun T, Yokoyama H, Ogawa K and Wakabayashi H Myxosporeans and their hyperparasitic microsporeans in the intestine of emaciated tiger puffer. J Fish Pathol 35, Tun T, Ogawa K and Wakabayashi H Pathological changes induced by three myxosporeans in the intestine of cultured tiger puffer, Takifugu rubripes (Temminck and Schlegel). J Fish Pathol 25, j x. Yasuda H, Ooyama T, lwata K, Tun T, Yokoyama H and Ogawa K Fish-to-fish transmission of Myxidium sp. (Myxozoa) in cultured tiger puffer suffering from emaciation disease. J Fish Pathol 37, jsfp Yasuda H, Ooyama T, Nakamura A, lwata K, Palenzuela O and Yokoyama H Occurrence of the myxosporean emaciation disease caused by Enteromyxum leei in cultured Japanese flounder Paralichthys olivaceus. Fish Pathol, 40,

VHS 및 RSIVD 모니터링 177 al., 2001) (World Organization for Animal Health, OIE). VHSV Rhabdoviridae Novirhabdovirus RNA 6 gene nucleocapsid protein (N), p

VHS 및 RSIVD 모니터링 177 al., 2001) (World Organization for Animal Health, OIE). VHSV Rhabdoviridae Novirhabdovirus RNA 6 gene nucleocapsid protein (N), p 한수지 49(2), 176-183, 2016 Original Article Korean J Fish Aquat Sci 49(2),176-183,2016 2015 년제주도양식넙치 (Paralichthys olivaceus) 를대상으로한 VHS 및 RSIVD 모니터링 박현경 전려진 1 김승민 박명애 2 조미영 2 황성돈 2 박신후 2 정현도 3 정준범 * 제주대학교해양의생명과학부,